Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Salinity-Induced Photorespiration in Populus Vascular Tissues Facilitate Nitrogen Reallocation.

Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. We used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell-specific changes in proteins and metabolites were determined. Salinity induced a vascular-specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3-phosphoglycerate and NH4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt-induced photorespiration in vascular cells mediates N-reallocation in Populus, an essential process for the adaptation of trees to adverse conditions.

De novo transcriptome analysis of white teak (Gmelina arborea Roxb) wood reveals critical genes involved in xylem development and secondary metabolism.

BACKGROUND: Gmelina arborea Roxb is a fast-growing tree species of commercial importance for tropical countries due to multiple industrial uses of its wood. Wood is primarily composed of thick secondary cell walls of xylem cells which imparts the strength to the wood. Identification of the genes involved in the secondary cell wall biosynthesis as well as their cognate regulators is crucial to understand how the production of wood occurs and serves as a starting point for developing breeding strategies to produce varieties with improved wood quality, better paper pulping or new potential uses such as biofuel production. In order to gain knowledge on the molecular mechanisms and gene regulation related with wood development in white teak, a de novo sequencing and transcriptome assembly approach was used employing secondary cell wall synthesizing cells from young white teak trees. RESULTS: For generation of transcriptome, RNA-seq reads were assembled into 110,992 transcripts and 49,364 genes were functionally annotated using plant databases; 5071 GO terms and 25,460 SSR markers were identified within xylem transcripts and 10,256 unigenes were assigned to KEGG database in 130 pathways. Among transcription factor families, C2H2, C3H, bLHLH and MYB were the most represented in xylem. Differential gene expression analysis using leaves as a reference was carried out and a total of 20,954 differentially expressed genes were identified including monolignol biosynthetic pathway genes. The differential expression of selected genes (4CL, COMT, CCoAOMT, CCR and NST1) was validated using qPCR. CONCLUSIONS: We report the very first de novo transcriptome of xylem-related genes in this tropical timber species of commercial importance and constitutes a valuable extension of the publicly available transcriptomic resource aimed at fostering both basic and breeding studies.

Induced secretion system mutation alters rhizosphere bacterial composition in Sorghum bicolor (L.) Moench.

MAIN CONCLUSION: A novel inducible secretion system mutation in Sorghum named Red root has been identified. The mutant plant root exudes pigmented compounds that enriches Actinobacteria in its rhizosphere compared to BTx623. Favorable plant-microbe interactions in the rhizosphere positively influence plant growth and stress tolerance. Sorghum bicolor, a staple biomass and food crop, has been shown to selectively recruit Gram-positive bacteria (Actinobacteria) in its rhizosphere under drought conditions to enhance stress tolerance. However, the genetic/biochemical mechanism underlying the selective enrichment of specific microbial phyla in the sorghum rhizosphere is poorly known due to the lack of available mutants with altered root secretion systems. Using a subset of sorghum ethyl methanesulfonate (EMS) mutant lines, we have isolated a novel Red root (RR) mutant with an increased accumulation and secretion of phenolic compounds in roots. Genetic analysis showed that RR is a single dominant mutation. We further investigated the effect of root-specific phenolic compounds on rhizosphere microbiome composition under well-watered and water-deficit conditions. The microbiome diversity analysis of the RR rhizosphere showed that Actinobacteria were enriched significantly under the well-watered condition but showed no significant change under the water-deficit condition. BTx623 rhizosphere showed a significant increase in Actinobacteria under the water-deficit condition. Overall, the rhizosphere of RR genotype retained a higher bacterial diversity and richness relative to the rhizosphere of BTx623, especially under water-deficit condition. Therefore, the RR mutant provides an excellent genetic resource for rhizosphere-microbiome interaction studies as well as to develop drought-tolerant lines. Identification of the RR gene and the molecular mechanism through which the mutant selectively enriches microbial populations in the rhizosphere will be useful in designing strategies for improving sorghum productivity and stress tolerance.

The Photoperiodic Flowering Time Regulator FKF1 Negatively Regulates Cellulose Biosynthesis.

Cellulose synthesis is precisely regulated by internal and external cues, and emerging evidence suggests that light regulates cellulose biosynthesis through specific light receptors. Recently, the blue light receptor CRYPTOCHROME 1 (CRY1) was shown to positively regulate secondary cell wall biosynthesis in Arabidopsis (Arabidopsis thaliana). Here, we characterize the role of FLAVIN-BINDING KELCH REPEAT, F-BOX 1 (FKF1), another blue light receptor and well-known photoperiodic flowering time regulator, in cellulose biosynthesis. A phenotype suppression screen using a cellulose deficient mutant cesa1aegeus,cesa3ixr1-2 (c1,c3), which carries nonlethal point mutations in CELLULOSE SYNTHASE A 1 (CESA1) and CESA3, resulted in identification of the phenotype-restoring large leaf (llf) mutant. Next-generation mapping using the whole genome resequencing method identified the llf locus as FKF1 FKF1 was confirmed as the causal gene through observation of the llf phenotype in an independent triple mutant c1,c3,fkf1-t carrying a FKF1 T-DNA insertion mutant. Moreover, overexpression of FKF1 in llf plants restored the c1,c3 phenotype. The fkf1 mutants showed significant increases in cellulose content and CESA gene expression compared with that in wild-type Columbia-0 plants, suggesting a negative role of FKF1 in cellulose biosynthesis. Using genetic, molecular, and phenocopy and biochemical evidence, we have firmly established the role of FKF1 in regulation of cellulose biosynthesis. In addition, CESA expression analysis showed that diurnal expression patterns of CESAs are FKF1 independent, whereas their circadian expression patterns are FKF1 dependent. Overall, our work establishes a role of FKF1 in the regulation of cell wall biosynthesis in Arabidopsis.

Mutation in a PHD-finger protein MS4 causes male sterility in soybean.

BACKGROUND: Male sterility has tremendous scientific and economic importance in hybrid seed production. Identification and characterization of a stable male sterility gene will be highly beneficial for making hybrid seed production economically feasible. In soybean, eleven male-sterile, female-fertile mutant lines (ms1, ms2, ms3, ms4, ms5, ms6, ms7, ms8, ms9, msMOS, and msp) have been identified and mapped onto various soybean chromosomes, however the causal genes responsible for male sterility are not isolated. The objective of this study was to identify and functionally characterize the gene responsible for the male sterility in the ms4 mutant. RESULTS: The ms4 locus was fine mapped to a 216 kb region, which contains 23 protein-coding genes including Glyma.02G243200, an ortholog of Arabidopsis MALE MEIOCYTE DEATH 1 (MMD1), which is a Plant Homeodomain (PHD) protein involved in male fertility. Isolation and sequencing of Glyma.02G243200 from the ms4 mutant line showed a single base insertion in the 3rd exon causing a premature stop codon resulting in truncated protein production. Phylogenetic analysis showed presence of a homolog protein (MS4_homolog) encoded by the Glyma.14G212300 gene. Both proteins were clustered within legume-specific clade of the phylogenetic tree and were likely the result of segmental duplication during the paleoploidization events in soybean. The comparative expression analysis of Ms4 and Ms4_homologs across the soybean developmental and reproductive stages showed significantly higher expression of Ms4 in early flowering (flower bud differentiation) stage than its homolog. The functional complementation of Arabidopsis mmd1 mutant with the soybean Ms4 gene produced normal stamens, successful tetrad formation, fertile pollens and viable seeds, whereas the Ms4_homolog was not able to restore male fertility. CONCLUSIONS: Overall, this is the first report, where map based cloning approach was employed to isolate and characterize a gene responsible for the male-sterile phenotype in soybean. Characterization of male sterility genes may facilitate the establishment of a stable male sterility system, highly desired for the viability of hybrid seed production in soybean. Additionally, translational genomics and genome editing technologies can be utilized to generate new male-sterile lines in other plant species.

Genome-wide identification and characterization of LRR-RLKs reveal functional conservation of the SIF subfamily in cotton (Gossypium hirsutum).

BACKGROUND: As one of the largest subfamilies of the receptor-like protein kinases (RLKs) in plants, Leucine Rich Repeats-RLKs (LRR-RLKs) are involved in many critical biological processes including growth, development and stress responses in addition to various physiological roles. Arabidopsis contains 234 LRR-RLKs, and four members of Stress Induced Factor (SIF) subfamily (AtSIF1-AtSIF4) which are involved in abiotic and biotic stress responses. Herein, we aimed at identification and functional characterization of SIF subfamily in cultivated tetraploid cotton Gossypium hirsutum. RESULTS: Genome-wide analysis of cotton LRR-RLK gene family identified 543 members and phylogenetic analysis led to the identification of 6 cotton LRR-RLKs with high homology to Arabidopsis SIFs. Of the six SIF homologs, GhSIF1 is highly conserved exhibiting 46-47% of homology with AtSIF subfamily in amino acid sequence. The GhSIF1 was transiently silenced using Virus-Induced Gene Silencing system specifically targeting the 3' Untranslated Region. The transiently silenced cotton seedlings showed enhanced salt tolerance compared to the control plants. Further, the transiently silenced plants showed better growth, lower electrolyte leakage, and higher chlorophyll and biomass contents. CONCLUSIONS: Overall, 543 LRR-RLK genes were identified using genome-wide analysis in cultivated tetraploid cotton G. hirsutum. The present investigation also demonstrated the conserved salt tolerance function of SIF family member in cotton. The GhSIF1 gene can be knocked out using genome editing technologies to improve salt tolerance in cotton.

Downregulation of RWA genes in hybrid aspen affects xylan acetylation and wood saccharification.

High acetylation of angiosperm wood hinders its conversion to sugars by glycoside hydrolases, subsequent ethanol fermentation and (hence) its use for biofuel production. We studied the REDUCED WALL ACETYLATION (RWA) gene family of the hardwood model Populus to evaluate its potential for improving saccharification. The family has two clades, AB and CD, containing two genes each. All four genes are expressed in developing wood but only RWA-A and -B are activated by master switches of the secondary cell wall PtNST1 and PtMYB21. Histochemical analysis of promoter::GUS lines in hybrid aspen (Populus tremula × tremuloides) showed activation of RWA-A and -B promoters in the secondary wall formation zone, while RWA-C and -D promoter activity was diffuse. Ectopic downregulation of either clade reduced wood xylan and xyloglucan acetylation. Suppressing both clades simultaneously using the wood-specific promoter reduced wood acetylation by 25% and decreased acetylation at position 2 of Xylp in the dimethyl sulfoxide-extracted xylan. This did not affect plant growth but decreased xylose and increased glucose contents in the noncellulosic monosaccharide fraction, and increased glucose and xylose yields of wood enzymatic hydrolysis without pretreatment. Both RWA clades regulate wood xylan acetylation in aspen and are promising targets to improve wood saccharification.

Genome wide comprehensive analysis and web resource development on cell wall degrading enzymes from phyto-parasitic nematodes.

BACKGROUND: The plant cell wall serves as a primary barrier against pathogen invasion. The success of a plant pathogen largely depends on its ability to overcome this barrier. During the infection process, plant parasitic nematodes secrete cell wall degrading enzymes (CWDEs) apart from piercing with their stylet, a sharp and hard mouthpart used for successful infection. CWDEs typically consist of cellulases, hemicellulases, and pectinases, which help the nematode to infect and establish the feeding structure or form a cyst. The study of nematode cell wall degrading enzymes not only enhance our understanding of the interaction between nematodes and their host, but also provides information on a novel source of enzymes for their potential use in biomass based biofuel/bioproduct industries. Although there is comprehensive information available on genome wide analysis of CWDEs for bacteria, fungi, termites and plants, but no comprehensive information available for plant pathogenic nematodes. Herein we have performed a genome wide analysis of CWDEs from the genome sequenced phyto pathogenic nematode species and developed a comprehensive publicly available database. RESULTS: In the present study, we have performed a genome wide analysis for the presence of CWDEs from five plant parasitic nematode species with fully sequenced genomes covering three genera viz. Bursaphelenchus, Glorodera and Meloidogyne. Using the Hidden Markov Models (HMM) conserved domain profiles of the respective gene families, we have identified 530 genes encoding CWDEs that are distributed among 24 gene families of glycoside hydrolases (412) and polysaccharide lyases (118). Furthermore, expression profiles of these genes were analyzed across the life cycle of a potato cyst nematode. Most genes were found to have moderate to high expression from early to late infectious stages, while some clusters were invasion stage specific, indicating the role of these enzymes in the nematode's infection and establishment process. Additionally, we have also developed a Nematode's Plant Cell Wall Degrading Enzyme (NCWDE) database as a platform to provide a comprehensive outcome of the present study. CONCLUSIONS: Our study provides collective information about different families of CWDEs from five different sequenced plant pathogenic nematode species. The outcomes of this study will help in developing better strategies to curtail the nematode infection, as well as help in identification of novel cell wall degrading enzymes for biofuel/bioproduct industries.

Populus GT43 family members group into distinct sets required for primary and secondary wall xylan biosynthesis and include useful promoters for wood modification.

The plant GT43 protein family includes xylosyltransferases that are known to be required for xylan backbone biosynthesis, but have incompletely understood specificities. RT-qPCR and histochemical (GUS) analyses of expression patterns of GT43 members in hybrid aspen, reported here, revealed that three clades of the family have markedly differing specificity towards secondary wall-forming cells (wood and extraxylary fibres). Intriguingly, GT43A and B genes (corresponding to the Arabidopsis IRX9 clade) showed higher specificity for secondary-walled cells than GT43C and D genes (IRX14 clade), although both IRX9 and IRX14 are required for xylosyltransferase activity. The remaining genes, GT43E, F and G (IRX9-L clade), showed broad expression patterns. Transient transactivation analyses of GT43A and B reporters demonstrated that they are activated by PtxtMYB021 and PNAC085 (master secondary wall switches), mediated in PtxtMYB021 activation by an AC element. The high observed secondary cell wall specificity of GT43B expression prompted tests of the efficiency of its promoter (pGT43B), relative to the CaMV 35S (35S) promoter, for overexpressing a xylan acetyl esterase (CE5) or downregulating REDUCED WALL ACETYLATION (RWA) family genes and thus engineering wood acetylation. CE5 expression was weaker when driven by pGT43B, but it reduced wood acetyl content substantially more efficiently than the 35S promoter. RNAi silencing of the RWA family, which was ineffective using 35S, was achieved when using GT43B promoter. These results show the utility of the GT43B promoter for genetically engineering properties of wood and fibres.

RhizoMAP: a comprehensive, nondestructive, and sensitive platform for metabolic imaging of the rhizosphere.

BACKGROUND: Elucidating the intricate structural organization and spatial gradients of biomolecular composition within the rhizosphere is critical to understanding important biogeochemical processes, which include the mechanisms of root-microbe interactions for maintaining sustainable plant ecosystem services. While various analytical methods have been developed to assess the spatial heterogeneity within the rhizosphere, a comprehensive view of the fine distribution of metabolites within the root-soil interface has remained a significant challenge. This is primarily due to the difficulty of maintaining the original spatial organization during sample preparation without compromising its molecular content. RESULTS: In this study, we present a novel approach, RhizoMAP, in which the rhizosphere molecules are imprinted on selected polymer membranes and then spatially profiled using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry imaging (MSI). We enhanced the performance of RhizoMAP by combining the use of two thin (< 20 µm) membranes (polyester and polycarbonate) with distinct MALDI sample preparations. This optimization allowed us to gain insight into the distribution of over 500 different molecules within the rhizosphere of poplar (Populus trichocarpa) grown in rhizoboxes filled with mycorrhizae soil. These two membranes, coupled with three different sample preparation conditions, enabled us to capture the distribution of a wide variety of molecules that included phytohormones, amino acids, sugars, sugar glycosides, polycarboxylic acids components of the Krebs cycle, fatty acids, short aldehydes and ketones, terpenes, volatile organic compounds, fertilizers from the soil, and others. Their spatial distribution varies greatly, with some following root traces, others showing diffusion from roots, some associated with soil particles, and many having distinct hot spots along the plant root or surrounding soil. Moreover, we showed how RhizoMAP can be used to localize the origin of the molecules and molecular transformation during root growth. Finally, we demonstrated the power of RhizoMAP to capture molecular distributions of key metabolites throughout a 20 cm deep rhizosphere. CONCLUSIONS: RhizoMAP is a method that provides nondestructive, untargeted, broad, and sensitive metabolite imaging of root-associated molecules, exudates, and soil organic matter throughout the rhizosphere, as demonstrated in a lab-controlled native soil environment.

Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar.

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

PeakQC: A Software Tool for Omics-Agnostic Automated Quality Control of Mass Spectrometry Data.

Mass spectrometry is broadly employed to study complex molecular mechanisms in various biological and environmental fields, enabling 'omics' research such as proteomics, metabolomics, and lipidomics. As study cohorts grow larger and more complex with dozens to hundreds of samples, the need for robust quality control (QC) measures through automated software tools becomes paramount to ensure the integrity, high quality, and validity of scientific conclusions from downstream analyses and minimize the waste of resources. Since existing QC tools are mostly dedicated to proteomics, automated solutions supporting metabolomics are needed. To address this need, we developed the software PeakQC, a tool for automated QC of MS data that is independent of omics molecular types (i.e., omics-agnostic). It allows automated extraction and inspection of peak metrics of precursor ions (e.g., errors in mass, retention time, arrival time) and supports various instrumentations and acquisition types, from infusion experiments or using liquid chromatography and/or ion mobility spectrometry front-end separations and with/without fragmentation spectra from data-dependent or independent acquisition analyses. Diagnostic plots for fragmentation spectra are also generated. Here, we describe and illustrate PeakQC's functionalities using different representative data sets, demonstrating its utility as a valuable tool for enhancing the quality and reliability of omics mass spectrometry analyses.

Modulation of Polar Auxin Transport Identifies the Molecular Determinants of Source-Sink Carbon Relationships and Sink Strength in Poplar.

Source-to-sink carbon (C) allocation driven by the sink strength, i.e., the ability of a sink organ to import C, plays a central role in tissue growth and biomass productivity. However, molecular drivers of sink strength have not been thoroughly characterized in trees. Auxin, as a major plant phytohormone, regulates the mobilization of photoassimilates in source tissues and elevates the translocation of carbohydrates toward sink organs, including roots. In this study, we used an 'auxin-stimulated carbon sink' approach to understand the molecular processes involved in the long-distance source-sink C allocation in poplar. Poplar cuttings were foliar sprayed with polar auxin transport modulators, including auxin enhancers (AE) (i.e., IBA and IAA) and auxin inhibitor (AI) (i.e., NPA), followed by a comprehensive analysis of leaf, stem, and root tissues using biomass evaluation, phenotyping, C isotope labeling, metabolomics, and transcriptomics approaches. Auxin modulators altered root dry weight and branching pattern, and AE increased photosynthetically fixed C allocation from leaf to root tissues. The transcriptome analysis identified highly expressed genes in root tissue under AE condition including transcripts encoding polygalacturonase and ß-amylase that could increase the sink size and activity. Metabolic analyses showed a shift in overall metabolism including an altered relative abundance levels of galactinol, and an opposite trend in citrate levels in root tissue under AE and AI conditions. In conclusion, we postulate a model suggesting that the source-sink C relationships in poplar could be fueled by mobile sugar alcohols, starch metabolism-derived sugars, and TCA-cycle intermediates as key molecular drivers of sink strength.

Mutation in the Endo-ß-1,4-glucanase (KORRIGAN) Is Responsible for Thick Leaf Phenotype in Sorghum.

Sorghum [Sorghum bicolor (L.) Moench] is an important crop for food, feed, and fuel production. Particularly, sorghum is targeted for cellulosic ethanol production. Extraction of cellulose from cell walls is a key process in cellulosic ethanol production, and understanding the components involved in cellulose synthesis is important for both fundamental and applied research. Despite the significance in the biofuel industry, the genes involved in sorghum cell wall biosynthesis, modification, and degradation have not been characterized. In this study, we have identified and characterized three allelic thick leaf mutants (thl1, thl2, and thl3). Bulked Segregant Analysis sequencing (BSAseq) showed that the causal mutation for the thl phenotype is in endo-1,4-ß-glucanase gene (SbKOR1). Consistent with the causal gene function, the thl mutants showed decreased crystalline cellulose content in the stem tissues. The SbKOR1 function was characterized using Arabidopsis endo-1,4-ß-glucanase gene mutant (rsw2-1). Complementation of Arabidopsis with SbKOR1 (native Arabidopsis promoter and overexpression by 35S promoter) restored the radial swelling phenotype of rsw2-1 mutant, proving that SbKOR1 functions as endo-1,4-ß-glucanase. Overall, the present study has identified and characterized sorghum endo-1,4-ß-glucanase gene function, laying the foundation for future research on cell wall biosynthesis and engineering of sorghum for biofuel production.

Cell-Type-Specific Proteomics Analysis of a Small Number of Plant Cells by Integrating Laser Capture Microdissection with a Nanodroplet Sample Processing Platform.

Plant organs and tissues contain multiple cell types, which are well organized in 3-dimensional structure to efficiently perform physiological functions such as homeostasis and response to environmental perturbation and pathogen infection. It is critically important to perform molecular measurements at the cell-type-specific level to discover mechanisms and unique features of cell populations that govern differentiation and respond to external perturbations. Although mass spectrometry-based proteomics has been demonstrated as an enabling discovery tool for studying plant physiology, conventional approaches require millions of cells to generate robust biological conclusions. Such requirements mask the cell-to-cell heterogeneities and limit the comprehensive profiling of plant proteins at spatially resolved and cell-type-specific resolutions. This article describes a recently developed proteomics workflow for studying a small number of plant cells by integrating laser capture microdissection, microfluidic nanodroplet-based sample preparation, and ultrasensitive liquid chromatography-mass spectrometry. Using poplar as a model tree species, we provide detailed protocols, including plant leaf and root tissue harvest, sample preparation, cryosectioning, laser microdissection, protein digestion, mass spectrometry measurement, and data analysis. We show that the workflow enables the precise identification and quantification of thousands of proteins from hundreds of isolated plant root and leaf cells. © 2021 Wiley Periodicals LLC. Basic Protocol 1: Plant tissue fixation and embedding Support Protocol 1: Preparation of 2.5% CMC solution Support Protocol 2: Slow freezing of CMC blocks to avoid crack development in the block Basic Protocol 2: Preparation of cryosections Alternate Protocol: Using a vacuum manifold to dehydrate the cryosection slides (primarily for root tissues) Basic Protocol 3: Laser capture microdissection of specific types of plant cells Basic Protocol 4: Nanodroplet-based sample preparation for ultrasensitive proteomic analysis Support Protocol 3: Fabrication of nanowell chips Basic Protocol 5: Liquid chromatography and mass spectrometry.

Genome-wide identification of multifunctional laccase gene family in cotton (Gossypium spp.); expression and biochemical analysis during fiber development.

The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality.

Identification, Characterization, and Expression Analysis of Cell Wall Related Genes in Sorghum bicolor (L.) Moench, a Food, Fodder, and Biofuel Crop.

Biomass based alternative fuels offer a solution to the world's ever-increasing energy demand. With the ability to produce high biomass in marginal lands with low inputs, sorghum has a great potential to meet second-generation biofuel needs. Despite the sorghum crop importance in biofuel and fodder industry, there is no comprehensive information available on the cell wall related genes and gene families (biosynthetic and modification). It is important to identify the cell wall related genes to understand the cell wall biosynthetic process as well as to facilitate biomass manipulation. Genome-wide analysis using gene family specific Hidden Markov Model of conserved domains identified 520 genes distributed among 20 gene families related to biosynthesis/modification of various cell wall polymers such as cellulose, hemicellulose, pectin, and lignin. Chromosomal localization analysis of these genes revealed that about 65% of cell wall related genes were confined to four chromosomes (Chr. 1-4). Further, 56 tandem duplication events involving 169 genes were identified in these gene families which could be associated with expansion of genes within families in sorghum. Additionally, we also identified 137 Simple Sequence Repeats related to 112 genes and target sites for 10 miRNAs in some important families such as cellulose synthase, cellulose synthase-like, and laccases, etc. To gain further insight into potential functional roles, expression analysis of these gene families was performed using publically available data sets in various tissues and under abiotic stress conditions. Expression analysis showed tissue specificity as well as differential expression under abiotic stress conditions. Overall, our study provides a comprehensive information on cell wall related genes families in sorghum which offers a valuable resource to develop strategies for altering biomass composition by plant breeding and genetic engineering approaches.