Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 16 de 16
Filtrar
Mais filtros

Base de dados
Tipo de documento
Intervalo de ano de publicação
1.
Angew Chem Int Ed Engl ; 63(13): e202318863, 2024 03 22.
Artigo em Inglês | MEDLINE | ID: mdl-38271265

RESUMO

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.


Assuntos
Complexos de Coordenação , Compostos Organometálicos , Rutênio , Compostos Organometálicos/química , DNA/química , Oligonucleotídeos/química , Complexos de Coordenação/química , Temperatura , Rutênio/química
2.
J Am Chem Soc ; 144(13): 5956-5964, 2022 04 06.
Artigo em Inglês | MEDLINE | ID: mdl-35324198

RESUMO

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.


Assuntos
Quadruplex G , Rutênio , Dicroísmo Circular , DNA/química , Humanos , Rutênio/química , Telômero/metabolismo
3.
Angew Chem Int Ed Engl ; 58(29): 9881-9885, 2019 07 15.
Artigo em Inglês | MEDLINE | ID: mdl-30958918

RESUMO

By using X-ray crystallography, we show that the complexes Λ/Δ-[Ru(TAP)2 (11-CN-dppz)]2+ (TAP=1,4,5,8-tetraazaphenanthrene, dppz=dipyridophenazine) bind DNA G-quadruplex in an enantiospecific manner that parallels the specificity of these complexes with duplex DNA. The Λ complex crystallises with the normally parallel stranded d(TAGGGTTA) tetraplex to give the first such antiparallel strand assembly in which syn-guanosine is adjacent to the complex at the 5' end of the quadruplex core. SRCD measurements confirm that the same conformational switch occurs in solution. The Δ enantiomer, by contrast, is present in the structure but stacked at the ends of the assembly. In addition, we report the structure of Λ-[Ru(phen)2 (11-CN-dppz)]2+ bound to d(TCGGCGCCGA), a duplex-forming sequence, and use both structural models to provide insight into the motif-specific luminescence response of the isostructural phen analogue enantiomers.

4.
Chemistry ; 24(59): 15859-15867, 2018 Oct 22.
Artigo em Inglês | MEDLINE | ID: mdl-30063271

RESUMO

The new complexes [Ru(TAP)2 (11-CN-dppz)]2+ , [Ru(TAP)2 (11-Br-dppz)]2+ and [Ru(TAP)2 (11,12-diCN-dppz)]2+ are reported. The addition of nitrile substituents to the dppz ligand of the DNA photo-oxidising complex [Ru(TAP)2 (dppz)]2+ promote π-stacking interactions and ordered binding to DNA, as shown by X-ray crystallography. The structure of Λ-[Ru(TAP)2 (11-CN-dppz)]2+ with the DNA duplex d(TCGGCGCCGA)2 shows, for the first time with this class of complex, a closed intercalation cavity with an AT base pair at the terminus. The structure obtained is compared to that formed with the 11-Br and 11,12-dinitrile derivatives, highlighting the stabilization of syn guanine by this enantiomer when the terminal base pair is GC. In contrast the AT base pair has the normal Watson-Crick orientation, highlighting the difference in charge distribution between the two purine bases and the complementarity of the dppz-purine interaction. The asymmetry of the cavity highlights the importance of the purine-dppz-purine stacking interaction.


Assuntos
Complexos de Coordenação/química , DNA/química , Nitrilas/química , Rutênio/química , Pareamento de Bases , Cristalografia por Raios X , Guanina/química , Substâncias Intercalantes/química , Ligantes , Modelos Químicos , Estrutura Molecular , Purinas/química , Estereoisomerismo , Relação Estrutura-Atividade , Raios X
5.
Nucleic Acids Res ; 44(19): 9472-9482, 2016 Nov 02.
Artigo em Inglês | MEDLINE | ID: mdl-27599841

RESUMO

[Ru(phen)2(dppz)]2+ has been studied since the 1990s due to its 'light-switch' properties. It can be used as a luminescent DNA probe, with emission switched on through DNA binding. The luminescence observed is dependent on the solvent accessibility of the pyrazine nitrogen atoms, and therefore is sensitive to changes in both binding site of the cation and chromophore orientation. The compound is also chiral, and there are distinct differences between the enantiomers in terms of the emission behaviour when bound to a variety of DNA sequences. Whilst a number of binary DNA-complex X-ray crystal structures are available, most include the Λ enantiomer and there is very little structural information about binding of the Δ enantiomer. Here, we present the first X-ray crystal structure of a Δ enantiomer bound to well-matched DNA, in the absence of the other, Λ enantiomer. We show how the binding site observed here can be related to a more general pattern of motifs in the crystallographic literature and propose that the Δ enantiomer can bind with five different binding modes, offering a new hypothesis for the interpretation of solution data.


Assuntos
DNA/química , Luz , Modelos Moleculares , Rutênio/química , Sítios de Ligação , DNA/metabolismo , Conformação Molecular , Motivos de Nucleotídeos , Compostos Organometálicos/química , Rutênio/metabolismo
6.
Chemistry ; 23(21): 4981-4985, 2017 Apr 11.
Artigo em Inglês | MEDLINE | ID: mdl-28105682

RESUMO

X-ray crystal structures of three Λ-[Ru(L)2 dppz]2+ complexes (dppz=dipyridophenazine; L=1,10-phenanthroline (phen), 2,2'-bipyridine (bpy)) bound to d((5BrC)GGC/GCCG) showed the compounds intercalated at a 5'-CG-3' step. The compounds bind through canted intercalation, with the binding angle determined by the guanine NH2 group, in contrast to symmetrical intercalation previously observed at 5'-TA-3' sites. This result suggests that canted intercalation is preferred at 5'-CG-3' sites even though the site itself is symmetrical, and we hypothesise that symmetrical intercalation in a 5'-CG-3' step could give rise to a longer luminescence lifetime than canted intercalation.


Assuntos
DNA/química , Guanina/química , Substâncias Intercalantes/química , Compostos Organometálicos/química , Fenantrolinas/química , Rutênio/química , Luminescência
7.
J Am Chem Soc ; 136(50): 17505-12, 2014 Dec 17.
Artigo em Inglês | MEDLINE | ID: mdl-25393319

RESUMO

Hydration-dependent DNA deformation has been known since Rosalind Franklin recognized that the relative humidity of the sample had to be maintained to observe a single conformation in DNA fiber diffraction. We now report for the first time the crystal structure, at the atomic level, of a dehydrated form of a DNA duplex and demonstrate the reversible interconversion to the hydrated form at room temperature. This system, containing d(TCGGCGCCGA) in the presence of Λ-[Ru(TAP)2(dppz)](2+) (TAP = 1,4,5,8-tetraazaphenanthrene, dppz = dipyrido[3,2-a:2',3'-c]phenazine), undergoes a partial transition from an A/B hybrid to the A-DNA conformation, at 84-79% relative humidity. This is accompanied by an increase in kink at the central step from 22° to 51°, with a large movement of the terminal bases forming the intercalation site. This transition is reversible on rehydration. Seven data sets, collected from one crystal at room temperature, show the consequences of dehydration at near-atomic resolution. This result highlights that crystals, traditionally thought of as static systems, are still dynamic and therefore can be the subject of further experimentation.


Assuntos
Complexos de Coordenação/química , DNA/química , Rutênio/química , Bário/química , Modelos Moleculares , Água/química
8.
Chem Sci ; 15(24): 9096-9103, 2024 Jun 19.
Artigo em Inglês | MEDLINE | ID: mdl-38903237

RESUMO

We report a crystal structure at atomic resolution (0.9 Å) of a ruthenium complex bound to a consecutive DNA double mismatch, which results in a TA basepair with flipped out thymine, together with the formation of an adenine bulge. The structure shows a form of metalloinsertion interaction of the Λ-[Ru(phen)2phi]2+ (phi = 9,10-phenanthrenediimine) complex at the bulge site. The metal complex interacts with the DNA via the major groove, where specific interactions between the adenines of the DNA and the phen ligands of the complex are formed. One Δ-[Ru(phen)2phi]2+ complex interacts via the minor groove, which shows sandwiching of its phi ligand between the phi ligands of the other two ruthenium complexes, and no interaction of its phen ligands with DNA. To our knowledge, this binding model represents a new form of metalloinsertion in showing major rather than minor groove insertion.

9.
Chem Sci ; 2024 Sep 06.
Artigo em Inglês | MEDLINE | ID: mdl-39246339

RESUMO

[This corrects the article DOI: 10.1039/D4SC01448K.].

10.
J Am Chem Soc ; 135(34): 12652-9, 2013 Aug 28.
Artigo em Inglês | MEDLINE | ID: mdl-23875832

RESUMO

We report an atomic resolution X-ray crystal structure containing both enantiomers of rac-[Ru(phen)2dppz](2+) with the d(ATGCAT)2 DNA duplex (phen = phenanthroline; dppz = dipyridophenazine). The first example of any enantiomeric pair crystallized with a DNA duplex shows different orientations of the Λ and Δ binding sites, separated by a clearly defined structured water monolayer. Job plots show that the same species is present in solution. Each enantiomer is bound at a TG/CA step and shows intercalation from the minor groove. One water molecule is directly located on one phenazine N atom in the Δ-enantiomer only.


Assuntos
Complexos de Coordenação/química , Oligodesoxirribonucleotídeos/química , Rutênio/química , Água/química , Cristalografia por Raios X , Modelos Moleculares , Estrutura Molecular
11.
Chem Commun (Camb) ; 55(62): 9116-9119, 2019 Jul 30.
Artigo em Inglês | MEDLINE | ID: mdl-31298665

RESUMO

Λ-[Ru(TAP)2(dppz)]2+ was crystallised with the G-quadruplex-forming heptamer d(TAGGGTT). Surprisingly, even though there are four unique binding sites, the complex is not in contact with any G-quartet surface. Two complexes stabilise cavities formed from terminal T·A and T·T mismatched pairs. A third shows kinking by a TAP ligand between T·T linkages, while the fourth shows sandwiching of a dppz ligand between a T·A/T·A quadruplex and a T·T mismatch, stabilised by an additional T·A base pair stacking interaction on a TAP surface. Overall, the structure shows an unexpected affinity for thymine, and suggests models for G-quadruplex loop binding.

12.
Chem Sci ; 7(5): 3075-3084, 2016 May 01.
Artigo em Inglês | MEDLINE | ID: mdl-29997799

RESUMO

The [Ru(phen)2(dppz)]2+ complex (1) is non-emissive in water but is highly luminescent in organic solvents or when bound to DNA, making it a useful probe for DNA binding. To date, a complete mechanistic explanation for this "light-switch" effect is still lacking. With this in mind we have undertaken an ultrafast time resolved infrared (TRIR) study of 1 and directly observe marker bands between 1280-1450 cm-1, which characterise both the emissive "bright" and the non-emissive "dark" excited states of the complex, in CD3CN and D2O respectively. These characteristic spectral features are present in the [Ru(dppz)3]2+ solvent light-switch complex but absent in [Ru(phen)3]2+, which is luminescent in both solvents. DFT calculations show that the vibrational modes responsible for these characteristic bands are predominantly localised on the dppz ligand. Moreover, they reveal that certain vibrational modes of the "dark" excited state couple with vibrational modes of two coordinating water molecules, and through these to the bulk solvent, thus providing a new insight into the mechanism of the light-switch effect. We also demonstrate that the marker bands for the "bright" state are observed for both Λ- and Δ-enantiomers of 1 when bound to DNA and that photo-excitation of the complex induces perturbation of the guanine and cytosine carbonyl bands. This perturbation is shown to be stronger for the Λ-enantiomer, demonstrating the different binding site properties of the two enantiomers and the ability of this technique to determine the identity and nature of the binding site of such intercalators.

13.
Nat Chem ; 7(12): 961-7, 2015 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-26587711

RESUMO

To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl-DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.


Assuntos
DNA/química , Guanina/química , Cristalografia por Raios X , Elétrons , Modelos Moleculares , Oxirredução , Espectrofotometria Infravermelho
14.
Chemosphere ; 51(9): 925-33, 2003 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-12697183

RESUMO

We report the first systematic study on the photocatalytic oxidation of humic acid (HA) in artificial seawater (ASW). TiO(2) (Degussa P25) dispersions were used as the catalyst with irradiation from a medium-pressure mercury lamp. The optimum quantity of catalyst was found to be between 2 and 2.5 gl(-1); while the decomposition was fastest at low pH values (pH 4.5 in the range examined), and the optimum air-flow, using an immersion well reactor with a capacity of 400 ml, was 850 ml min(-1). Reactivity increased with air-flow up to this figure, above which foaming prevented operation of the reactor. Using pure oxygen, an optimal flow rate was observed at 300 ml min(-1), above which reactivity remains essentially constant. Following treatment for 1 h, low-salinity water (2700 mg l(-1)) was completely mineralised, whereas ASW (46000 mg l(-1)) had traces of HA remaining. These effects are interpreted and kinetic data presented. To avoid problems of precipitation due to change of ionic strength humic substances were prepared directly in ASW, and the effects of ASW on catalyst suspension and precipitation have been taken into account. The Langmuir-Hinshelwood kinetic model has been shown to be followed only approximately for the catalytic oxidation of HA in ASW. The activation energy for the reaction derived from an Arrhenius treatment was 17 (+/-0.6) kJ mol(-1).


Assuntos
Substâncias Húmicas/química , Água do Mar/química , Purificação da Água/métodos , Catálise , Corantes/química , Concentração de Íons de Hidrogênio , Fotoquímica , Temperatura , Titânio/química
15.
Philos Trans A Math Phys Eng Sci ; 371(1995): 20120525, 2013 Jul 28.
Artigo em Inglês | MEDLINE | ID: mdl-23776304

RESUMO

The crystal structure of the ruthenium DNA 'light-switch' complex Λ-[Ru(TAP)2(11-Cl-dppz)](2+) (TAP=tetraazaphenanthrene, dppz=dipyrido[3,2-a':2',3'-c]phenazine) bound to the oligonucleotide duplex d(TCGGCGCCGA)2 is reported. The synthesis of the racemic ruthenium complex is described for the first time, and the racemate was used in this study. The crystal structure, at atomic resolution (1.0 Å), shows one ligand as a wedge in the minor groove, resulting in the 51(°) kinking of the double helix, as with the parent Λ-[Ru(TAP)2(dppz)](2+). Each complex binds to one duplex by intercalation of the dppz ligand and also by semi-intercalation of one of the orthogonal TAP ligands into a second symmetrically equivalent duplex. The 11-chloro substituent binds with the major component (66%) oriented with the 11-chloro substituent on the purine side of the terminal step of the duplex.


Assuntos
Cloro/química , Substâncias Intercalantes/química , Modelos Químicos , Modelos Moleculares , Oligonucleotídeos/química , Rutênio/química , Sítios de Ligação , Conformação de Ácido Nucleico
16.
Langmuir ; 25(1): 534-41, 2009 Jan 06.
Artigo em Inglês | MEDLINE | ID: mdl-19053627

RESUMO

Quartz crystal microbalance (QCM) measurements of the formation of a 4-aminothiophenol (4-ATP) self-assembled monolayer (SAM) at a gold electrode showed that a surface coverage of 118 ng cm(-2) was obtained after a 3 h exposure period, indicating that good surface coverage was achieved. Cyclic voltammetry of the ferricyanide redox couple across this SAM modified surface produced similar results to those of a bare electrode; however, the electroreduction of oxygen was found to be impaired. The 4-ATP SAM layer was not stable to repeated electrochemical oxidation and reduction; it is believed that the 4-ATP SAM layer was first converted to a 4'-mercapto-N-phenylquinone diimine (NPQD) layer followed by subsequent formation of a 4'-mercapto-N-phenylquinone monoimine (NPQM) layer. We also report a quartz crystal microbalance study of the attachment of platinum nanoparticles to such SAM modified electrodes. We show that five times the amount of platinum nanoparticles can be attached to a 4-ATP modified electrode surface (observed frequency change -187 Hz) compared with an NPQD modified electrode surface (observed frequency change -35 Hz). The presence of the platinum particles was confirmed electrochemically by their surface electrochemical properties, which were different from those of the underlying gold electrode. It is believed that this is the first time that such direct evidence of electrochemical communication between platinum nanoparticles and a SAM modified electrode surface has been obtained. It was also shown to be possible to build up multilayer SAM/nanoparticle modified surfaces while maintaining efficient electrochemical communication. Up to three SAM/nanoparticle sandwich layers were constructed.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA