Discovery of charge order in a cuprate Mott insulator.

Copper oxide superconductors universally exhibit multiple forms of electronically ordered phases that break the native translational symmetry of the CuO2 planes. In underdoped cuprates with correlated metallic ground states, charge/spin stripes and incommensurate charge density waves (CDWs) have been experimentally observed over the years, while early theoretical studies also predicted the emergence of a Coulomb-frustrated 'charge crystal' phase in the very lightly doped, insulating limit of CuO2 planes. Here, we search for signatures of CDW order in very lightly hole-doped cuprates from the 123 family RBa2Cu3O7 - δ (RBCO; R: Y or rare earth), by using resonant X-ray scattering, electron transport, and muon spin rotation measurements to resolve the electronic and magnetic ground states fully. Specifically, Pr is used to substitute Y at the R-site to systematically suppress the superconductivity and access the extremely low hole-doping regime of the cuprate phase diagram without changing the oxygen stoichiometry. X-ray scattering data taken on Pr-doped YBCO thin films reveal an in-plane CDW order that follows the same linear evolution of wave vector versus hole concentration as oxygen-underdoped YBCO but extends all the way to the insulating and magnetically ordered Mott limit. Combined with the recent observation of charge crystal phase on an insulating surface of Bi2Sr2CaCu2O8 + z, our results in RBCO suggest that this electronic symmetry breaking is universally present in very lightly doped CuO2 planes. These findings bridge the gap between the Mott insulating state and the underdoped metallic state and underscore the prominent role that Coulomb-frustrated electronic phase separation plays among all cuprates.

Comparison of contrast-enhanced ultrasonography and MRI results obtained by expert and novice radiologists indicating short-term response after transarterial chemoembolisation for hepatocellular carcinoma.

AIM: To evaluate inter-reader agreement between novice and expert radiologists in assessing contrast-enhanced ultrasonography (CEUS) and magnetic resonance imaging (MRI) images for detecting viable tumours with different sizes after conventional transarterial chemoembolisation (cTACE). MATERIALS AND METHODS: This prospective study included patients who had less than five hepatomas and who underwent cTACE. Hepatomas with one or two feeding arteries were selected as target lesions. CEUS and MRI were performed within 1 week after cTACE to evaluate viable tumours. RESULTS: The expert group had higher kappa values in evaluating all tumour sizes via CEUS compared with MRI. The novice group had similar kappa values. In patients with tumours measuring ≤3 cm, the expert group had higher kappa values in reading CEUS compared with MRI images; however, in the novice group, the kappa value was lower in evaluating CEUS compared with MRI images. In patients with tumours measuring >3 cm, the expert and novice groups had good to excellent kappa values. The confidence level of the two groups in reading MRI images was high; however, the novice group had a lower confidence level. CONCLUSION: CEUS is a convenient, cost-effective, and easy to apply imaging tool that can help interventionists perform early detection of viable hepatocellular carcinoma post-TACE. It has a higher inter-rater agreement in interpreting CEUS images compared with MRI images among expert radiologists even when they are extremely familiar with post-cTACE MRI images. In novice radiologists, there may be a learning curve to achieve good consistency in CEUS interpretation.

[Incidence and risk factors of congenital ventricular septal defect in Qingdao].

Objective: To analyze the incidence and risk factors of ventricular septal defect (VSD) in Qingdao. Methods: A prospective cohort study design was used to include pregnant women who underwent prenatal screening in Qingdao between August 2018 and June 2020 (the whole population coverage). VSD was diagnosed according to the pulse oxygen saturation and heart auscultation, and the final diagnosis was made according to the echocardiography of VSD positive newborns within postnatal day 7. Results: The study included 115 238 live births, among which 388 were diagnosed as VSD, with an incidence of 3.37‰. The results of multivariate logistic regression analysis showed that mother with postgraduate level (OR=1.61, 95%CI: 1.00-2.58, P=0.049) (compared with junior high school and below), preterm birth history (OR=2.90, 95%CI: 1.47-5.70, P=0.002), and pregnancy history of congenital heart disease (OR=5.98, 95%CI: 2.63-14.73, P<0.001) were risk factors for VSD. Compared with female infants, the overall risk of VSD in male infants was relatively low (OR=0.74, 95%CI: 0.60-0.91, P=0.005). Conclusions: The incidence of VSD in Qingdao is 3.37‰. The risk factors of VSD include higher maternal education level, pregnancy history of congenital heart disease and preterm birth history. Moreover, the overall risk of VSD in male infants is low.

Chronic kidney disease-related osteoporosis is associated with incident frailty among patients with diabetic kidney disease: a propensity score-matched cohort study.

Chronic kidney disease (CKD)-related osteoporosis is a major complication in patients with CKD, conferring a higher risk of adverse outcomes. We found that among those with diabetic kidney disease, this complication increased the risk of incident frailty, an important mediator of adverse outcomes. INTRODUCTION: Renal osteodystrophy and chronic kidney disease (CKD)-related osteoporosis increases complications for patients with diabetic kidney disease (DKD). Since musculoskeletal degeneration is central to frailty development, we investigated the relationship between baseline osteoporosis and the subsequent frailty risk in patients with DKD. METHODS: From the Longitudinal Cohort of Diabetes Patients in Taiwan (n = 840,000), we identified 12,027 patients having DKD with osteoporosis and 24,054 propensity score-matched controls having DKD but without osteoporosis. The primary endpoint was incident frailty on the basis of a modified FRAIL scale. Patients were prospectively followed-up until the development of endpoints or the end of this study. The Kaplan-Meier technique and Cox proportional hazard regression were used to analyze the association between osteoporosis at baseline and incident frailty in these patients. RESULTS: The mean age of the DKD patients was 67.2 years, with 55.4% female and a 12.6% prevalence of osteoporosis at baseline. After 3.5 ± 2.2 years of follow up, the incidence rate of frailty in patients having DKD with osteoporosis was higher than that in DKD patients without (6.6 vs. 5.7 per 1000 patient-year, p = 0.04). A Cox proportional hazard regression showed that after accounting for age, gender, obesity, comorbidities, and medications, patients having DKD with osteoporosis had a significantly higher risk of developing frailty (hazard ratio, 1.19; 95% confidence interval, 1.02-1.38) than those without osteoporosis. CONCLUSIONS: CKD-related osteoporosis is associated with a higher risk of incident frailty in patients with DKD.

A case of GNE myopathy mimicking hereditary motor neuropathy.

A 36-year-old woman who presented with upper limb distal weakness since the age of 15 years, with gradual progression to the lower limbs, is reported. Hereditary motor neuropathy was initially suspected based on distal weakness and hyporeflexia; however, whole exome sequencing accidentally revealed a compound heterozygous variant in the GNE gene, and ultrasound revealed increased homogeneous echogenicity in the involved muscles, which is characteristic of myopathic changes. Muscle magnetic resonance imaging revealed fatty infiltration in all limb muscles, sparing the triceps brachii, vastus lateralis and vastus medialis. Muscle biopsy revealed intracytoplasmic rimmed vacuole, supporting the diagnosis of GNE myopathy.

[Comparison of islet autoantigen-specific T cell response detected by direct enzyme-linked immunospot (ELISPOT) assay and accelerated co-cultured dendritic cells (acDCs) assay].

Objective: To investigate the effect of enzyme-linked immunospot (ELISPOT) on accelerated co-cultured dendritic cells (acDCs) and direct detection of islet full-length antigen-specific T cell response in peripheral blood of patients with type 1 diabetes mellitus (T1DM). Methods: Sixteen patients with T1DM[9 males, 7 females, mean age(28.5±9.4)years] and 12 age-and sex-matched healthy controls were selected in the Department of Metabolism and Endocrinology, the Second Xiangya Hospital between March 2012 and August 2014. The numbers of IFN-γ secreting CD4(+)T cells responding to glutamic acid decarboxylase 65 (GAD(65)), C-peptide (CP) and insulin (INS) were detected by ELISPOT-acDCs and ELISPOT-direct assays, respectively. The positive rate of islet autoantigen and associated antigen reactive T cells under different detection assays were compared. Results: The positive rate for GAD(65), INS, and CP antigen reactive T cells detected by ELISPOT-acDCs was 1/16, 6/16 and 4/16, respectively, and T cells positive for INS in T1DM patients were higher than that in the controls (0/12) (P=0.024). Combining GAD(65), CP and INS-ELISPOT-acDCs detection, the positive rate for CD4(+) T cells in T1DM patients was higher than that in the controls (9/16 vs 1/12, P=0.016). The positive rate for GAD(65), INS, and CP antigen reactive T cells detected by ELISPOT-direct detection was 2/16, 1/16 and 7/16, respectively, and T cells positive for CP was higher than that in the controls (1/12), but the difference was not statistically significant (P=0.088). Likewise, the positive rate for CD4(+) T cells was higher in T1DM patients than that in the controls by combined GAD(65), CP and INS-ELISPOT-direct detection (8/16 vs 1/12, P=0.039). Compared with the ELISPOT-direct assay, the positive rate of INS antigen specific T cell response detected by ELISPOT-acDCs was higher (P=0.041). No statistical differences of other antigens were found between the two groups (all P>0.05). Conclusions: Both multiple islet antigens-combined CD4(+)-ELISPOT-acDCs and direct assays could provide diagnostic value of cellular immunology for T1DM patients. The ELISPOT-acDCs assay is superior to the ELISPOT-direct assay in the detection of INS antigen-specific T cell response.

A population-based study of the prevalence and risk factors of low-grade Plasmodium falciparum malaria infection in children aged 0-15 years old in northern Tanzania.

OBJECTIVES: Northern Tanzania experiences significant malaria-related morbidity and mortality, but accurate data are scarce. We update the data on patterns of low-grade Plasmodium falciparum malaria infection among children in northern Tanzania. METHODS: Plasmodium falciparum malaria prevalence (pfPR) was assessed in a representative sample of 819 children enrolled in 94 villages in northern Tanzania between October 2015 and August 2016, using a complex survey design. Individual- and household-level risk factors for pfPR were elicited using structured questionnaires. pfPR was assessed using rapid diagnostic tests (RDTs) and thick film microscopy (TFM). Associations with pfPR, based on RDT, were assessed using adjusted odds ratios (aOR) and confidence intervals (CI) from weighted survey logistic regression models. RESULTS: Plasmodium falciparum malaria prevalence (pfPR) was 39.5% (95% CI: 31.5, 47.5) by RDT and 33.4% (26.0, 40.6) by TFM. pfPR by RDT was inversely associated with higher-education parents, especially mothers (5-7 years of education: aOR 0.55; 95% CI: 0.31, 0.96, senior secondary education: aOR 0.10; 95% CI: 0.02, 0.55), living in a house near the main road (aOR 0.34; 95% CI: 0.15, 0.76), in a larger household (two rooms: aOR 0.40; 95% CI: 0.21, 0.79, more than two rooms OR 0.35; 95% CI: 0.20, 0.62). Keeping a dog near or inside the house was positively associated with pfPR (aOR 2.01; 95% CI: 1.26, 3.21). pfPR was not associated with bed-net use or indoor residual spraying. CONCLUSIONS: Nearly 40% of children in northern Tanzania had low-grade malaria antigenaemia. Higher parental education and household metrics but not mosquito bed-net use were inversely associated with pfPR.

OBJECTIFS: La Tanzanie connaît une morbidité et une mortalité importantes liées au paludisme, mais les données précises sont rares. Nous mettons à jour les données sur les profils en matière d'infection par le paludisme à Plasmodium falciparum de faible grade chez les enfants dans le nord de la Tanzanie. MÉTHODES: La prévalence du paludisme à P. falciparum (pfPR) a été évaluée sur un échantillon représentatif de 819 enfants inscrits dans 94 villages dans le nord de la Tanzanie entre octobre 2015 et août 2016, à l'aide d'un plan d'enquête complexe. Des facteurs de risque de pfPR au niveau individuel et au niveau du ménage ont été déterminés à l'aide de questionnaires structurés. La pfPR a été évaluée à l'aide de tests de diagnostic rapides (TDR) et de microscopie à film épais (TFM). Les associations avec la pfPR, sur la base des TDR, ont été évaluées à l'aide des rapports de cotes ajustés (aOR) et des intervalles de confiance (IC) de modèles de régression logistique de surveillances pondérées. RÉSULTATS: La pfPR était de 39,5% (IC95%: 31,5-47,5) avec les TDR et de 33,4% (26,0-40,6) avec la TFM. La pfPR par les TDR était inversement associée aux parents avec un niveau d'éducation plus élevé, en particulier les mères (5-7 ans d'études: aOR: 0,55; IC95%: 0,31-0,96, enseignement secondaire supérieur: aOR: 0,10; IC95%: 0,02-0,55), vivre dans une maison proche de la route principale (aOR: 0,34; IC95%: 0,15-0,76), dans un ménage plus grand (2 chambres: aOR: 0,40; IC95%: 0,21-0,79, plus de 2 pièces aOR: 0,35; IC95%: 0,20-0,62). Garder un chien près ou à l'intérieur de la maison était positivement associé à la pfPR (aOR: 2,01; IC95%: 1,26-3,21). La pfPR n'était pas associée à l'utilisation de moustiquaire ou à la pulvérisation de résidus à l'intérieur. CONCLUSIONS: Près de 40% des enfants dans nord de la Tanzanie présentaient une antigénémie paludéenne de faible grade. Un niveau d'éducation parentale plus élevé et les indicateurs du ménage, mais pas l'utilisation de moustiquaires, étaient inversement associés à la pfPR.

[Constitution of a New Specialised Pediatric Home Care Team - First Year Experience]. / Aufbau eines Palliativteams für Kinder und Jugendliche (SAPV-KJ).

BACKGROUND: Since the amendment of the Social Law V in Germany in 2007 the financial basis for a Specialised Home Palliative Care for Children (SHPC) for children was established. In Hesse 3 different SHPC teams entered into collective negotiations with health insurance companies. In 2014, the team of the University Children's Hospital in Giessen started to treat the first patient with a lead time of two months. METHODS: Thus in this paper the development of a SHPC team is described. After the first year anonymized patients data were retrospectively analyzed. RESULTS: Within 12 months 35 patients, 24 females and 11 males, were treated. All of the 6 patients who died, died at home. Calculated 48 weeks survival was 78%. 45% of the patients suffered from malignancies, 34% of malformations and 34% had metabolic disorders. 51% needed crisis intervention and 51% infusion therapy. Only 26% of parents denied cardiopulmonary resuscitation (CPR). Only 10% of the patients or their families received professional psychological care. CONCLUSION: Formation of a SHPC is feasible within a short time period once a financial basis is established. So, empathic guidance of families to help decision making for emergency situations are considered to be important. Analysis of patient's data after one year could help to improve the quality of care. Our data provides information for developing a palliative care team und could motivate colleagues to start the job.

Chloroplast heterogeneity and historical admixture within the genus Malus.

UNLABELLED: • PREMISE OF THE STUDY: The genus Malus represents a unique and complex evolutionary context in which to study domestication. Several Malus species have provided novel alleles and traits to the cultivars. The extent of admixture among wild Malus species has not been well described, due in part to limited sampling of individuals within a taxon.• METHODS: Four chloroplast regions (1681 bp total) were sequenced and aligned for 412 Malus individuals from 30 species. Phylogenetic relationships were reconstructed using maximum parsimony. The distribution of chloroplast haplotypes among species was examined using statistical parsimony, phylogenetic trees, and a median-joining network.• KEY RESULTS: Chloroplast haplotypes are shared among species within Malus. Three major haplotype-sharing networks were identified. One includes species native to China, Western North America, as well as Malus domestica Borkh, and its four primary progenitor species: M. sieversii (Ledeb.) M. Roem., M. orientalis Uglitzk., M. sylvestris (L.) Mill., and M. prunifolia (Willd.) Borkh; another includes five Chinese Malus species, and a third includes the three Malus species native to Eastern North America.• CONCLUSIONS: Chloroplast haplotypes found in M. domestica belong to a single, highly admixed network. Haplotypes shared between the domesticated apple and its progenitors may reflect historical introgression or the retention of ancestral polymorphisms. Multiple individuals should be sampled within Malus species to reveal haplotype heterogeneity, if complex maternal contributions to named species are to be recognized.

History of chronic comorbidity and risk of chemotherapy-induced febrile neutropenia in cancer patients not receiving G-CSF prophylaxis.

BACKGROUND: Chemotherapy-induced febrile neutropenia (FN) is a clinically important complication that affects patient outcome by delaying chemotherapy doses or reducing dose intensity. Risk of FN depends on chemotherapy- and patient-level factors. We sought to determine the effects of chronic comorbidities on risk of FN. DESIGN: We conducted a cohort study to examine the association between a variety of chronic comorbidities and risk of FN in patients diagnosed with six types of cancer (non-Hodgkin lymphoma and breast, colorectal, lung, ovary, and gastric cancer) from 2000 to 2009 who were treated with chemotherapy at Kaiser Permanente Southern California, a large managed care organization. We excluded those patients who received primary prophylactic granulocyte colony-stimulating factor. History of comorbidities and FN events were identified using electronic medical records. Cox models adjusting for propensity score, stratified by cancer type, were used to determine the association between comorbid conditions and FN. Models that additionally adjusted for cancer stage, baseline neutrophil count, chemotherapy regimen, and dose reduction were also evaluated. RESULTS: A total of 19 160 patients with mean age of 60 years were included; 963 (5.0%) developed FN in the first chemotherapy cycle. Chronic obstructive pulmonary disease [hazard ratio (HR) = 1.30 (1.07-1.57)], congestive heart failure [HR = 1.43 (1.00-1.98)], HIV infection [HR = 3.40 (1.90-5.63)], autoimmune disease [HR = 2.01 (1.10-3.33)], peptic ulcer disease [HR = 1.57 (1.05-2.26)], renal disease [HR = 1.60 (1.21-2.09)], and thyroid disorder [HR = 1.32 (1.06-1.64)] were all associated with a significantly increased FN risk. CONCLUSIONS: These results provide evidence that history of several chronic comorbidities increases risk of FN, which should be considered when managing patients during chemotherapy.

Asian Foxtail (Uraria crinita), a New Host for Sclerotium rolfsii from Taiwan.

Asian foxtail (Uraria crinita (L.) Desv. ex DC.) is an herb cultivated for the use of roots and stems in Taiwanese cuisine. In September 2013, symptoms of leaf blight and basal rot were observed on U. crinita in a commercial field in Longjing District, Taichung, Taiwan, at an incidence of approximately 20%. White mycelia and brown sclerotia formed on the surfaces of the basal stems. The infected plant gradually wilted and eventually died. Diseased lower stem tissues were surface sterilized in 0.6% NaOCl, rinsed with sterile distilled water, and transferred to potato dextrose agar plates. The cultures were incubated at 25°C in the dark. The radial mycelial growth was 9.0 mm/day during the first 4 days, and the diameter of mature sclerotia was 1.76 mm following 3 weeks of incubation. The internal transcribed spacer (ITS) sequence of the isolate was amplified by PCR using the primers ITS5 and ITS4 (2). The amplicon was cloned, sequenced, and deposited in GenBank (Accession No. KJ677121). The sequence similarity was 99% compared with that of Sclerotium rolfsii Sacc. from Spain (GU080230) (1). Based on the characteristics, the fungus was identified as S. rolfsii. The fungal isolate (BCRC FU30230) was deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were conducted on six 2-month-old potted U. crinita plants in a greenhouse. Prior to infesting the plant, fungal inoculum of S. rolfsii BCRC FU30230 was prepared by inoculating the isolate on autoclaved rice (rice/water/dextrose = 50:50:1) in a flask. After 20 days incubation at room temperature, rice colonized by S. rolfsii was placed near the base of the plants (approximately 30 g/plant) in the greenhouse. Sterile rice applied to an equal number of plants served as negative controls. All inoculated plants developed blight symptoms with mycelia and sclerotia produced near the bases of each seedling 1 week after inoculation at an average temperature of 26°C. The control plants remained healthy. The pathogen re-isolated from the inoculated plants was morphologically identical to the original isolate. The pathogenicity test was repeated by inoculated healthy plants with reduced inoculum (five granules/plant). A delay of symptom development was observed and similar results were obtained. To our knowledge, this is the first report of Sclerotium rot on U. crinita in Taiwan, and the first report on U. crinita as a host for S. rolfsii. References: (1) E. Remesal et al. Plant Dis. 94:280, 2010. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.

Biliary tract infections caused by Aeromonas species.

This study investigated the clinical and microbiological characteristics of patients with Aeromonas infections of the biliary tract. Patients with bile cultures positive for Aeromonas species during the period July 2004 to December 2011 were identified from a computerized database of a hospital in Taiwan. Patients with Aeromonas infections of the biliary tract were further identified. During the study period, a total of 1,142 isolates of Aeromonas species were obtained from 750 patients. Of those patients, 91 (12.1 %) had Aeromonas infections of the biliary tract. The annual incidence (episodes per 10,000 patient-days) of biliary tract infections caused by all Aeromonas species was 0.31 in 2007, 0.12 in 2010, and 0.27 in 2011. A. hydrophila was the most common species isolated (n = 41, 45.1 %), followed by A. caviae (n = 30, 33.0 %), A. veronii biovar sobria (n = 15, 16.5 %), and A. veronii biovar veronii (n = 5, 5.5 %). The majority of patients (n = 77, 84.6 %) had polymicrobial infections. Hepatobiliary stones (n = 50, 54.9 %) and hepatobiliary cancer (n = 38, 41.8 %) were the most common underlying diseases, followed by diabetes mellitus (n = 29, 31.9 %) and liver cirrhosis (n = 7, 7.7 %). The in-hospital mortality rate was 8.8 %. Infection-related mortality was associated with underlying immunocompromised condition (p = 0.044) and use of mechanical ventilation (p = 0.004), but was not associated with inappropriate antibiotic usage or concomitant bacteremia (n = 8, 8.8 %). In conclusion, biliary tract infections caused by Aeromonas species are not uncommon and can develop in both immunocompromised and immunocompetent patients; however, patients with underlying hepatobiliary diseases are particularly susceptible to these infections.

Skin and soft-tissue infections caused by Aeromonas species.

This study investigated the clinical characteristics of patients with skin and soft-tissue infections (SSTIs) due to Aeromonas species. Patients with SSTIs caused by Aeromonas species during the period from January 2009 to December 2011 were identified from a computerized database of a regional hospital in southern Taiwan. The medical records of these patients were retrospectively reviewed. A total of 129 patients with SSTIs due to Aeromonas species were identified. A. hydrophila (n = 77, 59.7 %) was the most common pathogen, followed by A. veronii biovar sobria (n = 22, 17.1 %), A. veronii biovar veronii (n = 20, 15.5 %), A. caviae (n = 9, 7.0 %), and A. schubertii (n = 1, 0.8 %). The most common isolates obtained from patients with polymicrobial infections were Klebsiella species (n = 33), followed by Enterococcus spp. (n = 24), Enterobacter spp. (n = 21), Escherichia coli (n = 17), Staphylococcus spp. (n = 17), Streptococcus spp. (n = 17), and Acinetobacter spp. (n = 15). Liver cirrhosis and concomitant bacteremia were more common among patients with monomicrobial Aeromonas SSTIs than among patients with polymicrobial SSTIs. Nine (7 %) patients required limb amputations. The in-hospital mortality rate was 1.6 %. In conclusion, Aeromonas species should be considered as important causative pathogens of SSTIs, and most infections are polymicrobial. In addition, the clinical presentation differs markedly between patients with monomicrobial and those with polymicrobial Aeromonas SSTIs.

Pneumonia caused by Aeromonas species in Taiwan, 2004-2011.

We investigated the clinical characteristics of patients with pneumonia caused by Aeromonas species. Patients with pneumonia caused by Aeromonas species during the period 2004 to 2011 were identified from a computerized database of a regional hospital in southern Taiwan. The medical records of these patients were retrospectively reviewed. Of the 84 patients with pneumonia due to Aeromonas species, possible Aeromonas pneumonia was diagnosed in 58 patients, probable Aeromonas pneumonia was diagnosed in 18 patients, and pneumonia due to Aeromonas was conclusively diagnosed in 8 patients. Most of the cases of Aeromonas pneumonia developed in men and in patients of advanced age. A. hydrophila (n = 50, 59.5 %) was the most common pathogen, followed by A. caviae (n = 24, 28.6 %), A. veronii biovar sobria (n = 7, 8.3 %), and A. veronii biovar veronii (n = 3, 3.6 %). Cancer (n = 37, 44.0 %) was the most common underlying disease, followed by diabetes mellitus (n = 27, 32.1 %). Drowning-associated pneumonia developed in 6 (7.1 %) patients. Of 47 patients who were admitted to the intensive care ward, 42 patients developed acute respiratory failure and 24 of those patients died. The overall in-hospital mortality rate was significantly associated with liver cirrhosis, cancer, initial presentation of shock, and usage of mechanical ventilation. In conclusion, Aeromonas species should be considered as one of the causative pathogens of severe pneumonia, especially in immunocompromised patients, and should be recognized as a cause of drowning-associated pneumonia. Cirrhosis, cancer, and shock as the initial presenting symptom are associated with poor outcome.

Study on the interzonal migration of airborne infectious particles in an isolation ward using benign bacteria.

UNLABELLED: Negative pressure isolation wards are essential infection control facilities against airborne transmissible diseases. Airborne infectious particles are supposed to be contained in the isolation room. However, negative pressure may break down by door-opening action or by human movement. Understanding the interzonal transport of airborne infectious particles in the isolation wards can aid the design and operation strategy of isolation facilities. In this work, the interzonal migration of airborne infectious particles by human movement was studied experimentally in an isolation ward. Artificial saliva solution with benign E. coli bacteria was aerosolized to simulate bacterium-laden infectious particles. The interzonal migration of aerosolized bacteria was characterized by biological air sampling. Less than 1% of airborne infectious particles were transported to the higher pressure zone when door was closed. With human movement, 2.7% of the particles were transported from the anteroom to the corridor. From high-to-low pressure zones, as much as 20.7% of airborne infectious particles were migrated. Only a minimal amount of particles was transported from the corridor to the positive pressure nurses' station. Infection risk of tuberculosis of the healthcare workers and other occupants in the isolation wards were also assessed based on the measured migration ratios. PRACTICAL IMPLICATIONS: Human movement is an important factor governing interzonal migration. It is the main cause of migration of airborne infectious particles to a relatively negative pressure zone. This study provides a set of experimentally obtained particle migration ratios by human movement. Other than serving as empirical data for further studies on the mechanics, these migration ratios can also be used to assess the infection risk for occupants in the isolation ward.

Indoor aerosols: from personal exposure to risk assessment.

Motivated by growing considerations of the scale, severity, and risks associated with human exposure to indoor particulate matter, this work reviewed existing literature to: (i) identify state-of-the-art experimental techniques used for personal exposure assessment; (ii) compare exposure levels reported for domestic/school settings in different countries (excluding exposure to environmental tobacco smoke and particulate matter from biomass cooking in developing countries); (iii) assess the contribution of outdoor background vs indoor sources to personal exposure; and (iv) examine scientific understanding of the risks posed by personal exposure to indoor aerosols. Limited studies assessing integrated daily residential exposure to just one particle size fraction, ultrafine particles, show that the contribution of indoor sources ranged from 19% to 76%. This indicates a strong dependence on resident activities, source events and site specificity, and highlights the importance of indoor sources for total personal exposure. Further, it was assessed that 10-30% of the total burden of disease from particulate matter exposure was due to indoor-generated particles, signifying that indoor environments are likely to be a dominant environmental factor affecting human health. However, due to challenges associated with conducting epidemiological assessments, the role of indoor-generated particles has not been fully acknowledged, and improved exposure/risk assessment methods are still needed, together with a serious focus on exposure control.

Sub-lethal concentrations of antibiotics increase mutation frequency in the cystic fibrosis pathogen Pseudomonas aeruginosa.

Approximately 80% of adult patients with cystic fibrosis (CF) become chronically infected with Pseudomonas aeruginosa and consequently require antibiotic therapy at intervals throughout their lives. Achieving lethal concentrations of antibiotics in the lung remains a challenge. Recent evidence from Escherichia coli and Staphylococcus aureus suggests that the generation of hydroxyl radicals by sublethal concentrations of antibiotics may induce mutagenesis and confer bacteria with resistance to a wide range of antimicrobials. As Ps. aeruginosa can persist for many years following colonization of the airways and during this time it is repeatedly exposed to bactericidal antibiotics, we tested whether its exposure to sublethal levels increases mutation frequency. We demonstrate that sublethal levels of three classes of bactericidal antibiotics commonly used against Ps. aeruginosa infections, ß-lactams, aminoglycosides and quinolones lead to an increase in mutation frequency, varying between c. threefold increase with aminoglycosides and a c. 14-fold increase in mutation frequency with ß-lactam antibiotics. These findings could be clinically significant because exposure to sublethal concentrations of antibiotics during chronic infection leading to increased mutation frequency may facilitate adaptive radiation of pathogenic bacteria in the heterogeneous environment of the CF lung.

First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan.

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5'CCGACATTGCCGTCAGCGATCACG3' and rv-5'AGCGTTCTTGGGTGTGTTGAGCATTTG3' (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Heating, ventilation, and air-conditioning systems in healthcare: a scoping review.

Guidelines for heating, ventilation, and air-conditioning systems have been developed for different settings. However, there is a lack of up-to-date evidence providing concrete recommendations for the heating, ventilation, and air-conditioning systems of an isolation room, which is essential to appropriately guide infection control policies. To highlight the guidelines for heating, ventilation, and air-conditioning systems in isolation rooms to inform relevant stakeholders and policymakers. A systematic search was performed based on Joanna Briggs Methodology using five databases (CINAHL, Embase, Joanna Briggs Institute, Medline, and Web of Science) and websites. Eight articles published by government departments were included in this review. Most studies recommended controlled airflow without recirculation, 12 air changes per hour, high-efficiency particulate air filtrate to exhaust contaminated air from the airborne isolation room, humidity ≤60%, and temperature in the range of 18-30 °C. This review provides further evidence that there is a need for interdisciplinary collaborative research to quantify the optimum range for heating, ventilation, and air conditioning system parameters, considering door types, anterooms, and bed management, to effectively reduce the transmission of infection in isolation rooms.