Altered Plasma Membrane Lipid Composition in Hypertensive Neutrophils Impacts Epithelial Sodium Channel (ENaC) Endocytosis.

Biological membranes are composed of a lipid bilayer with embedded proteins, including ion channels like the epithelial sodium channel (ENaC), which are critical for sodium homeostasis and implicated in arterial hypertension (HTN). Changes in the lipid composition of the plasma membrane can significantly impact cellular processes related to physiological functions. We hypothesized that the observed overexpression of ENaC in neutrophils from HTN patients might result from alterations in the structuring domains within the plasma membrane, disrupting the endocytic processes responsible for ENaC retrieval. This study assessed the structural lipid composition of neutrophil plasma membranes from HTN patients along with the expression patterns of key elements regulating ENaC at the plasma membrane. Our findings suggest alterations in microdomain structure and SGK1 kinase activity, which could prolong ENaC presence on the plasma membrane. Additionally, we propose that the proteasomal and lysosomal degradation pathways are insufficient to diminish ENaC presence at the plasma membrane in HTN. These results highlight the importance of understanding ENaC retrieval mechanisms and suggest that targeting these mechanisms could provide insights for developing drugs to prevent and treat HTN.

First report of Zymoseptoria tritici causing Septoria tritici blotch in wheat in Paraguay.

Wheat (Triticum aestivum) is the third most cultivated field crop in Paraguay; it is grown on over 450,000 hectares with an annual production of 927,776 tons (fao.org/faostat). In 1952, Septoria tritici blotch (STB) was associated with the fungus Septoria tritici solely based on microscopic observation of conidia (Viedma and Delgado 1987). However, no morphometric or molecular studies have been performed in Paraguay up to date. Over the following decades, STB epidemic outbreaks were recorded, with a reduction in wheat production of up to 70% (Viedma and Delgado 1987). During winter 2021, leaf blotch symptoms were observed with an incidence above 50% in wheat fields in Capitán Miranda, Itapúa, Paraguay. Scattered, spherical, buried, and light brown necrotic spots with dark edges were observed on the leaves. Pycnidia with prominent central ostiole were observed. Leaves with symptoms were washed with 1% sodium hypochlorite for 1 min, rinsed with sterile distilled water, and incubated in wet chambers to induce sporulation of the fungus. Pycnidia produced greyish to white cirri. Isolated conidia were thin, elongated, and hyaline, ranging from 26.9-72.7 × 1.5-2.9 µm with one to three septa. Monosporic colonies on potato dextrose agar (PDA, ; Difco laboratories, Detroit, MI) media varied in color from white to pink, dark gray to black, or black with stroma-like structures. Based on morphology, the fungus was characterized as Zymoseptoria tritici (Hoorne et al. 2002; Gilchrist-Saavedra et al. 2005). Fungal DNA was extracted from mycelia, and the internal transcribed spacer (ITS), translation elongation factor 1-α (TEF1-α), 28S rRNA gene (LSU), actin gene (act), calmodulin (CaM) were amplified using ITS1/ITS4, EF1-728F/EF-2, LSU1Fd/ LR5, ACT-512F/ACT-783R, CAL-228F/CAL737R primers, respectively. PCR amplicons were sequenced at Macrogen (Seoul, Republic of Korea) and deposited in the NCBI GenBank database (ITS: OQ360718; TEF1-α: OQ999044, LSU: OQ996413, act: OQ999046, CaM: OQ999045). Sequences were aligned with several isolates of Septoria spp. previously reported (Verkley et al. 2013; Stukenbrock et al. 2012) using ClustalW. The alignments were concatenated with Bioedit (Hall 1999). The UPGMA method with 1,000 bootstrap replications, was used to construct the phylogenetic tree using MEGA11 with Readeriella mirabilis as the outgroup. The isolate from Paraguay grouped into the Zymoseptoria tritici clade with 96% bootstrap support. To confirm pathogenicity, ten wheat plants cv. Itapúa 80 were grown in pots for three weeks in growth chambers (22 ± 2°C; 16 h photoperiod). Subsequently, these plants were inoculated with 1×107 conidia ml-1 suspension, and ten non-inoculated plants served as control. Seven days after inoculation (DAI), symptoms were observed displaying oval necrotic lesions and approximately 14 DAI abundant pycnidia were observed on and around the lesions. Segments of symptomatic leaves were placed in moisture chambers overnight to enhance cirri development. Conidia were mounted on a slide and observed under the compound microscope. Individual cirrhus were transferred to plates containing PDA and produced colonies like those used in the inoculation (Hoorne et al. 2002). We confirmed that the causal agent of STB from wheat fields in Paraguay was Zymoseptoria tritici. This pathogen causes annual wheat disease epidemics in Paraguay; therefore, optimizing surveillance for early detection and understanding its distribution will improve integrated management.

First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay.

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

TRPV1 Contributes to Modulate the Nitric Oxide Pathway and Oxidative Stress in the Isolated and Perfused Rat Heart during Ischemia and Reperfusion.

The transient vanilloid receptor potential type 1 (TRPV1) regulates neuronal and vascular functions mediated by nitric oxide (NO) and by the calcitonin gene-related peptide (CGRP). Here, we study the participation of TRPV1 in the regulation of myocardial injury caused by ischemia-reperfusion and in the control of NO, tetrahydrobiopterin (BH4), the cGMP pathway, CGRP, total antioxidant capacity (TAC), malondialdehyde (MDA) and phosphodiesterase-3 (PDE-3). Isolated hearts of Wistar rats perfused according to the Langendorff technique were used to study the effects of an agonist of TRPV1, capsaicin (CS), an antagonist, capsazepine (CZ), and their combination CZ+CS. The hearts were subjected to three conditions: (1) control, (2) ischemia and (3) ischemia-reperfusion. We determined cardiac mechanical activity and the levels of NO, cGMP, BH4, CGRP, TAC, MDA and PDE-3 in ventricular tissue after administration of CS, CZ and CZ+CS. Western blots were used to study the expressions of eNOS, iNOS and phosphorylated NOS (pNOS). Structural changes were determined by histological evaluation. CS prevented damage caused by ischemia-reperfusion by improving cardiac mechanical activity and elevating the levels of NO, cGMP, BH4, TAC and CGRP. TRPV1 and iNOS expression were increased under ischemic conditions, while eNOS and pNOS were not modified. We conclude that the activation of TRPV1 constitutes a therapeutic possibility to counteract the damage caused by ischemia and reperfusion by regulating the NO pathway through CGRP.

Prolonged Intermittent Renal Replacement Therapy for Acute Kidney Injury in COVID-19 Patients with Acute Respiratory Distress Syndrome.

INTRODUCTION: Patients with acute respiratory distress syndrome (ARDS) secondary to COVID-19 frequently develop severe acute kidney injury (AKI). Although continuous renal replacement therapy is the standard of care for critically ill patients, prolonged intermittent renal replacement therapy (PIRRT) may be a feasible option. We aimed to describe the tolerability and security of PIRRT treatments in COVID-19 patients with ARDS who required mechanical ventilation and developed severe AKI. METHODS: We prospectively analyzed patients who underwent PIRRT treatments at a COVID-19 reference hospital in Mexico City. Intradialytic hypotension was defined as a systolic blood pressure decrease of ≥20 mm Hg or an increase of 100% in vasopressor dose. RESULTS: We identified 136 AKI cases (60.7%) in 224 patients admitted to the intensive care unit. Among them, 21 (15%) underwent PIRRT (130 sessions) due to stage 3 AKI. The median age of the cohort was 49 (range 36-73) years, 17 (81%) were male, 7 (33%) had diabetes, and the median time between symptoms onset and PIRRT initiation was 12 (interquartile range [IQR] 7-14) days. The median of PIRRT procedures for each patient was 5 (IQR 4-9) sessions. In 108 (83%) PIRRT sessions, the total ultrafiltration goal was achieved. In 84 (65%) PIRRT procedures, there was a median increase in norepinephrine dose of +0.031 mcg/kg/min during PIRRT (IQR 0.00 to +0.07). Intradialytic hypotensive events occurred in 56 (43%) procedures. Fifteen (12%) PIRRT treatments were discontinued due to severe hypotension. Vasopressor treatment at PIRRT session onset (OR 6.2, 95% CI 1.4-28.0, p: 0.02) and a pre-PIRRT lactate ≥3.0 mmol/L (OR 4.63, 95% CI 1.3-12.8, p: 0.003) were independently and significantly associated with the risk of hypotension during PIRRT. During follow-up, 11 patients (52%) recovered from AKI and respiratory failure and 9 (43%) died. Several adaptations to our PIRRT protocol during the COVID-19 outbreak are presented. CONCLUSIONS: PIRRT was feasible in the majority of COVID-19 patients with ARDS and severe AKI, despite frequent transitory intradialytic hypotensive episodes. PIRRT may represent an acceptable alternative of renal replacement therapy during the COVID-19 outbreak.

Tocotrienol Nanoemulsion Platform of Curcumin Elicit Elevated Apoptosis and Augmentation of Anticancer Efficacy against Breast and Ovarian Carcinomas.

Vitamin E (VE) tocotrienols (T3), recognized for their cancer-specific anti-proliferative and pro-apoptotic activities, have been previously fabricated into bio-active nanoemulsion (NE) formulations. Here, our viscosity-adapted δ-T3 NE platform was developed to additionally incorporate curcumin (CUR), which is known for its potent suppression of signaling pathways involved in malignant cell growth, survival and metastasis. Thanks to efficient 70:30 wt % surfactant mix of Lutrol F-127:VE-TPGS, in conjunction with optimal CUR loading, a prototype CUR in δ-T3 NE was successfully prepared. Model CUR/δ-T3 NE demonstrated excellent nano-scale aspects (mean particle size = 261 nm, PDI = 0.27, and ζ-potential = -35 mV), pharmaceutical stability, and controlled release properties. Suitability for systemic administration was also verified via standardized in vitro biocompatibility and hemocompatibility assays. In two human cancer cells (MCF-7 and OVCAR-8), our CUR/δ-T3 NE prominently suppressed constitutive NF-κB activation, and significantly induced apoptosis. Finally, the combined CUR/δ-T3 NE produced superior cytotoxicity profiles, in concentration- and time-dependent manners (p ≤ 0.05), at least three to four folds lower IC50 than in closest CUR control. The strong synergism, estimated in both cultured carcinomas, revealed the augmented therapeutic efficacy of our CUR/δ-T3 NE combined platform, supporting its strong potential towards pharmaceutical development for cancer therapy.

Norovirus genome circularization and efficient replication are facilitated by binding of PCBP2 and hnRNP A1.

Sequences and structures within the terminal genomic regions of plus-strand RNA viruses are targets for the binding of host proteins that modulate functions such as translation, RNA replication, and encapsidation. Using murine norovirus 1 (MNV-1), we describe the presence of long-range RNA-RNA interactions that were stabilized by cellular proteins. The proteins potentially responsible for the stabilization were selected based on their ability to bind the MNV-1 genome and/or having been reported to be involved in the stabilization of RNA-RNA interactions. Cell extracts were preincubated with antibodies against the selected proteins and used for coprecipitation reactions. Extracts treated with antibodies to poly(C) binding protein 2 (PCBP2) and heterogeneous nuclear ribonucleoprotein (hnRNP) A1 significantly reduced the 5'-3' interaction. Both PCBP2 and hnRNP A1 recombinant proteins stabilized the 5'-3' interactions and formed ribonucleoprotein complexes with the 5' and 3' ends of the MNV-1 genomic RNA. Mutations within the 3' complementary sequences (CS) that disrupt the 5'-3'-end interactions resulted in a significant reduction of the viral titer, suggesting that the integrity of the 3'-end sequence and/or the lack of complementarity with the 5' end is important for efficient virus replication. Small interfering RNA-mediated knockdown of PCBP2 or hnRNP A1 resulted in a reduction in virus yield, confirming a role for the observed interactions in efficient viral replication. PCBP2 and hnRNP A1 induced the circularization of MNV-1 RNA, as revealed by electron microscopy. This study provides evidence that PCBP2 and hnRNP A1 bind to the 5' and 3' ends of the MNV-1 viral RNA and contribute to RNA circularization, playing a role in the virus life cycle.

Pharmacokinetic Profile and Comparative Bioavailability of an Oral Fixed-Dose Combination of Metformin and Acetylsalicylic Acid (Aspirin).

Patients with diabetes face a 2-4-fold greater cardiovascular risk compared to those without diabetes. Both metformin and acetylsalicylic acid (aspirin) treatment have demonstrated a significant reduction in this risk. This single-center, open-label, sequence randomized, 2 × 2 crossover, single-dose clinical trial evaluated the pharmacokinetics profile and comparative bioavailability of a novel oral fixed-dose combination (FDC) of metformin/acetylsalicylic acid (500/100 mg tablet) versus the reference mono-drugs administered concomitantly, metformin 500 mg tablet and acetylsalicylic acid 100 mg tablet, in 22 healthy Mexican adult volunteers under fasting conditions. Blood samples were collected predose and at specified intervals across a 24-hour period following administration and were analyzed for metformin and salicylic acid using high-performance liquid chromatography coupled with tandem mass spectrometry. Test products were considered to have comparative bioavailability if confidence intervals of natural log-transformed (maximum plasma drug concentration (Cmax), (area under the plasma drug concentration-time curve form 0 up to last sampling time (AUC0 -t), and (area under the plasma drug concentration-time cruve from 0 up to infinity (AUC0 ∞) data were within the range of 80%-125%. The results obtained from the present clinical study demonstrate the comparative bioavailability of the FDC when compared with the coadministration of reference mono-drugs. There were no adverse events or adverse reactions reported throughout the study.

[Dexamethasone and diclofenac by LC-MS-MS as herbal product adulterants]. / Confirmación de dexametasona y diclofenaco por LC-MS-MS como adulterantes en un producto herbolario.

OBJECTIVE: To confirm the presence of dexamethasone and diclofenac as adulterants of an herbal product. MATERIALS AND METHODS: For identificaction and confirmation of drugs a method of instrumental analysis by liquid chromatography coupled with high pressure tandem mass spectrometry was used. RESULTS: The presence of dexamethasone and diclofenac was confirmed in samples of 11 bottles of Reumofan Plus obtained from patients and/or physicians. The methodology used, allowed separation of stereoisomers dexamethasone and betamethasone, the relative abundances of product ions 237.2 and 279.2 m / z spectrally differentiate the compounds. CONCLUSIONS: The presence of dexamethasone and diclofenac was confirmed in samples of a product marketed as "100% natural" obtained from patients and / or physicians in a period from January to December, 2011.