Maintenance of persistent transmission of a plant arbovirus in its insect vector mediated by the Toll-Dorsal immune pathway.

Throughout evolution, arboviruses have developed various strategies to counteract the host's innate immune defenses to maintain persistent transmission. Recent studies have shown that, in addition to bacteria and fungi, the innate Toll-Dorsal immune system also plays an essential role in preventing viral infections in invertebrates. However, whether the classical Toll immune pathway is involved in maintaining the homeostatic process to ensure the persistent and propagative transmission of arboviruses in insect vectors remain unclear. In this study, we revealed that the transcription factor Dorsal is actively involved in the antiviral defense of an insect vector (Laodelphax striatellus) by regulating the target gene, zinc finger protein 708 (LsZN708), which mediates downstream immune-related effectors against infection with the plant virus (Rice stripe virus, RSV). In contrast, an antidefense strategy involving the use of the nonstructural-protein (NS4) to antagonize host antiviral defense through competitive binding to Dorsal from the MSK2 kinase was employed by RSV; this competitive binding inhibited Dorsal phosphorylation and reduced the antiviral response of the host insect. Our study revealed the molecular mechanism through which Toll-Dorsal-ZN708 mediates the maintenance of an arbovirus homeostasis in insect vectors. Specifically, ZN708 is a newly documented zinc finger protein targeted by Dorsal that mediates the downstream antiviral response. This study will contribute to our understanding of the successful transmission and spread of arboviruses in plant or invertebrate hosts.

Cross-kingdom RNA interference mediated by insect salivary microRNAs may suppress plant immunity.

Communication between insects and plants relies on the exchange of bioactive molecules that traverse the species interface. Although proteinic effectors have been extensively studied, our knowledge of other molecules involved in this process remains limited. In this study, we investigate the role of salivary microRNAs (miRNAs) from the rice planthopper Nilaparvata lugens in suppressing plant immunity. A total of three miRNAs were confirmed to be secreted into host plants during insect feeding. Notably, the sequence-conserved miR-7-5P is specifically expressed in the salivary glands of N. lugens and is secreted into saliva, distinguishing it significantly from homologues found in other insects. Silencing miR-7-5P negatively affects N. lugens feeding on rice plants, but not on artificial diets. The impaired feeding performance of miR-7-5P-silenced insects can be rescued by transgenic plants overexpressing miR-7-5P. Through target prediction and experimental testing, we demonstrate that miR-7-5P targets multiple plant genes, including the immune-associated bZIP transcription factor 43 (OsbZIP43). Infestation of rice plants by miR-7-5P-silenced insects leads to the increased expression of OsbZIP43, while the presence of miR-7-5P counteracts this upregulation effect. Furthermore, overexpressing OsbZIP43 confers plant resistance against insects which can be subverted by miR-7-5P. Our findings suggest a mechanism by which herbivorous insects have evolved salivary miRNAs to suppress plant immunity, expanding our understanding of cross-kingdom RNA interference between interacting organisms.

Endogenous nege-like viral elements in arthropod genomes reveal virus-host coevolution and ancient history of two plant virus families.

Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.

The JAK-STAT pathway promotes persistent viral infection by activating apoptosis in insect vectors.

The Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway is an evolutionarily conserved signaling pathway that can regulate various biological processes. However, the role of JAK-STAT pathway in the persistent viral infection in insect vectors has rarely been investigated. Here, using a system that comprised two different plant viruses, Rice stripe virus (RSV) and Rice black-streaked dwarf virus (RBSDV), as well as their insect vector small brown planthopper, we elucidated the regulatory mechanism of JAK-STAT pathway in persistent viral infection. Both RSV and RBSDV infection activated the JAK-STAT pathway and promoted the accumulation of suppressor of cytokine signaling 5 (SOCS5), an E3 ubiquitin ligase regulated by the transcription factor STAT5B. Interestingly, the virus-induced SOCS5 directly interacted with the anti-apoptotic B-cell lymphoma-2 (BCL2) to accelerate the BCL2 degradation through the 26S proteasome pathway. As a result, the activation of apoptosis facilitated persistent viral infection in their vector. Furthermore, STAT5B activation promoted virus amplification, whereas STAT5B suppression inhibited apoptosis and reduced virus accumulation. In summary, our results reveal that virus-induced JAK-STAT pathway regulates apoptosis to promote viral infection, and uncover a new regulatory mechanism of the JAK-STAT pathway in the persistent plant virus transmission by arthropod vectors.

Comparative transcriptomic analysis of salivary glands between the zoophytophagous Cyrtorhinus lividipennis and the phytozoophagous Apolygus lucorum.

BACKGROUND: Saliva plays a crucial role in shaping the feeding behavior of insects, involving processes such as food digestion and the regulation of interactions between insects and their hosts. Cyrtorhinus lividipennis serves as a predominant natural enemy of rice pests, while Apolygus lucorum, exhibiting phytozoophagous feeding behavior, is a destructive agricultural pest. In this study, a comparative transcriptome analysis, incorporating the published genomes of C.lividipennis and A.lucorum, was conducted to reveal the role of salivary secretion in host adaptation. RESULTS: In contrast to A.lucorum, C.lividipennis is a zoophytophagous insect. A de novo genome analysis of C.lividipennis yielded 19,706 unigenes, including 16,217 annotated ones. On the other hand, A.lucorum had altogether 20,111 annotated genes, as obtained from the published official gene set (20,353 unigenes). Functional analysis of the top 1,000 salivary gland (SG)-abundant genes in both insects revealed that the SG was a dynamically active tissue engaged in protein synthesis and secretion. Predictions of other tissues and signal peptides were compared. As a result, 94 and 157 salivary proteins were identified in C.lividipennis and A.lucorum, respectively, and were categorized into 68 and 81 orthogroups. Among them, 26 orthogroups were shared, potentially playing common roles in digestion and detoxification, including several venom serine proteases. Furthermore, 42 and 55 orthogroups were exclusive in C.lividipennis and A.lucorum, respectively, which were exemplified by a hyaluronidase in C.lividipennis that was associated with predation, while polygalacturonases in A.lucorum were involved in mesophyll-feeding patterns. CONCLUSIONS: Findings in this study provide a comprehensive insight into saliva secretions in C.lividipennis and A.lucorum via a transcriptome approach, reflecting the intricate connections between saliva secretions and feeding behaviors. It is found that conserved salivary secretions are involved in shaping the overlapping feeding patterns, while a plethora of unique salivary secretions may drive the evolution of specific feeding behaviors crucial for their survival. These results enhance our understanding of the feeding mechanisms in different insects from the perspective of saliva and contribute to future environmentally friendly pest control by utilizing predatory insects.

Horizontally Transferred Salivary Protein Promotes Insect Feeding by Suppressing Ferredoxin-Mediated Plant Defenses.

Herbivorous insects such as whiteflies, planthoppers, and aphids secrete abundant orphan proteins to facilitate feeding. Yet, how these genes are recruited and evolve to mediate plant-insect interaction remains unknown. In this study, we report a horizontal gene transfer (HGT) event from fungi to an ancestor of Aleyrodidae insects approximately 42 to 190 million years ago. BtFTSP1 is a salivary protein that is secreted into host plants during Bemisia tabaci feeding. It targets a defensive ferredoxin 1 in Nicotiana tabacum (NtFD1) and disrupts the NtFD1-NtFD1 interaction in plant cytosol, leading to the degradation of NtFD1 in a ubiquitin-dependent manner. Silencing BtFTSP1 has negative effects on B. tabaci feeding while overexpressing BtFTSP1 in N. tabacum benefits insects and rescues the adverse effect caused by NtFD1 overexpression. The association between BtFTSP1 and NtFD1 is newly evolved after HGT, with the homologous FTSP in its fungal donor failing to interact and destabilize NtFD1. Our study illustrates the important roles of horizontally transferred genes in plant-insect interactions and suggests the potential origin of orphan salivary genes.

Molecular and biological characterization of a bunyavirus infecting the brown planthopper (Nilaparvata lugens).

A negative-strand symbiotic RNA virus, tentatively named Nilaparvata lugens Bunyavirus (NLBV), was identified in the brown planthopper (BPH, Nilaparvata lugens). Phylogenetic analysis indicated that NLBV is a member of the genus Mobuvirus (family Phenuiviridae, order Bunyavirales). Analysis of virus-derived small interfering RNA suggested that antiviral immunity of BPH was successfully activated by NLBV infection. Tissue-specific investigation showed that NLBV was mainly accumulated in the fat-body of BPH adults. Moreover, NLBV was detected in eggs of viruliferous female BPHs, suggesting the possibility of vertical transmission of NLBV in BPH. Additionally, no significant differences were observed for the biological properties between NLBV-infected and NLBV-free BPHs. Finally, analysis of geographic distribution indicated that NLBV may be prevalent in Southeast Asia. This study provided a comprehensive characterization on the molecular and biological properties of a symbiotic virus in BPH, which will contribute to our understanding of the increasingly discovered RNA viruses in insects.

Complete genome analysis of a novel narnavirus in sweet viburnum (Viburnum odoratissimum).

Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This is the first report of a narnavirus in V. odoratissimum.

Complete genome sequence of a novel amalgavirus in sponge gourd, Luffa cylindrica.

A novel monopartite dsRNA virus, tentatively named "sponge gourd amalgavirus 1" (SGAV1), was discovered by high-throughput sequencing in sponge gourd (Luffa cylindrica) displaying mosaic symptoms in Jiashan County, Zhejiang Province, China. The genome of SGAV1 is 3,447 nucleotides in length and contains partially overlapping open reading frames (ORFs) encoding a putative replication factory matrix-like protein and a fusion protein, respectively. The fusion protein of SGAV1 shares 57.07% identity with the homologous protein of salvia miltiorrhiza amalgavirus 1 (accession no. DAZ91057.1). Phylogenetic analysis based on the RNA-dependent RNA polymerase (RdRp) protein suggests that SGAV1 belongs to the genus Amalgavirus of the family Amalgaviridae. Moreover, analysis of SGAV1-derived small interfering RNAs indicated that SGAV1 was actively replicating in the host plant. Semi-quantitative RT-PCR showed higher levels of SGAV1 expression in leaves than in flowers and fruits. This is the first report of a novel amalgavirus found in sponge gourd in China.

Complete genome sequence of a novel robigovirus infecting Mentha arvensis.

The complete genomic sequence of a novel robigovirus, provisionally named "Mentha arvensis robigovirus 1" (MARV1), was determined by combining next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), and rapid amplification of cDNA ends (RACE) PCR. The complete genomic sequence of this new virus is 7617 nucleotides in length, excluding the 3' poly(A) tail. The MARV1 genome encodes a putative replicase, "triple gene block" proteins, and a coat protein. Phylogenetic analysis demonstrated that MARV1 is a member of the genus Robigovirus, with closest relationships to African oil palm ringspot virus (AOPRV). Furthermore, MARV1-derived small interfering RNAs (siRNAs) showed typical patterns of plant-virus-derived siRNAs produced by the host antiviral RNA interference pathway. This is the first report of a plant virus of the genus Robigovirus in M. arvensis.

Complete genome sequence and genetic characterization of a novel segmented RNA virus infecting Nilaparvata lugens.

The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.

First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

First report of potato virus H infecting tomato (Solanum lycopersicum) in China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

First report of citrus leaf blotch virus infecting Forsythia viridissima in China.

Green-stem forsythia (Forsythia viridissima), also known as golden bell, is cultivated widely in China as an early spring flowering shrub. In July 2020, yellow or white vein clearing symptoms on leaves were observed in approximate 15% golden bell plants along a landscape river in Ningbo city, Zhejiang province, China. Symptomatic leaves from six different plants were collected and pooled. Total RNA was extracted from about 200 mg pooled sample using TRIzol Reagent (Invitrogen, Carlsbad, USA) and used for high-throughput sequencing (HTS). The cDNA library was constructed using a TruSeq RNA Sample Preparation Kit (Illumina) and an Illumina NovaSeq 6000 platform was utilized to yield 150 nt paired-end reads. CLC Genomic Workbench 11 (QIAGEN) with default parameters were used for data analysis. A total of 41,604,174 paired-end reads were obtained, and 156,853 contigs (16 - 26,665 nt) were generated de novo and compared with sequences in the NCBI nt and nr database using BLASTn and BLASTx, respectively. A total of 197,277 reads were mapped to the citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae) genome with an average coverage of 3191×. A contig of 8783 nt (excluding the poly(A) tail) was aligned to CLBV isolate Vib (accession No. OP751940) by BLASTn with the highest nt sequence identity of 99.7% and 99% query coverage, suggesting that the samples were infected with CLBV (Myung-Hwi Kim et al. 2023). No other virus was detected by this analysis. Subsequently, leaves of the six plants collected above, three plants with mild chlorotic symptoms and three plants without obvious symptoms were tested separately by RT-PCR and all were positive for CLBV. Sap from multiple symptomatic F. viridissima leaves was mechanically inoculated to Nicotiana benthamiana, N. tabacum and Datura stramonium in sextuplicate, but after two months, none of the inoculated plants had obvious symptoms and all of them tested negative for CLBV using RT-PCR. To determine the genome sequence of CLBV present in F. viridissima, a single sample from one plant was selected for genome validtion. The contig sequence was confirmed by Sanger sequencing of RT-PCR products amplified using CLBV-specific primers, and the 5' terminal sequence of the virus was determined using a commercial SUPERSWITCH RACE cDNA Synthesis Kit (Tiosbio, Beijing, China). The complete genomic sequence of CLBV isolated from F. viridissima was 8787 nts long, excluding the poly(A) tail, has the expected three predicted ORFs and was deposited in the GenBank database (accession no. OR766026). Phylogenetic analysis of different CLBV genome sequences from fruit trees and other hosts in GenBank using MEGA11 showed that the golden bell isolate was most closely related to isolate Vib (OP751940) from Viburnum lentago in South Korea, with which it was almost identical (99.7% complete nt sequence identity and >99% aa sequence identity in each of the three ORFs). Ten viruses have been previously reported from Forsythia spp. (Kaminska, M. 1985; Lee et al. 1997), but this is the first report of CLBV in this host. CLBV mainly infects citrus, kiwifruit and apple causing mosaic, chlorosis or yellow vein clearing symptoms, however, bud union disorder was observed in 'Nagami' kumquat infected by CLBV, which caused serious production losses (Cao et al. 2017; Li et al. 2018; Liu et al. 2019; Galipienso et al. 2001). Therefore, further investigation is needed to assess if F. viridissima can be an intermediate host to transfer CLBV to other crops.

Long-wave opsin involved in body color plastic development in Nilaparvata lugens.

BACKGROUND: As one of the components of visual photopigments in photoreceptor cells, opsin exhibits different spectral peaks and plays crucial roles in visual function. Besides, it is discovered to evolve other functions despite color vision. However, research on its unconventional function is limited nowadays. With the increase in genome database numbers, various numbers and types of opsins have been identified in insects due to gene duplications or losses. The Nilaparvata lugens (Hemiptera) is a rice pest known for its long-distance migration capability. In this study, opsins were identified in N. lugens and characterized by genome and transcriptome analyses. Meanwhile, RNA interference (RNAi) was carried out to investigate the functions of opsins, and then the Illumina Novaseq 6000 platform-based transcriptome sequencing was performed to reveal gene expression patterns. RESULTS: Four opsins belonging to G protein-coupled receptors were identified in the N. lugens genome, including one long-sensitive opsin (Nllw) together with two ultraviolet-sensitive opsins (NlUV1/2) and an additional new opsin with hypothesized UV peak sensitivity (NlUV3-like). A tandem array of NlUV1/2 on the chromosome suggested the presence of a gene duplication event, with similar exons distribution. Moreover, as revealed by spatiotemporal expression, the four opsins were highly expressed in eyes with age-different expression levels. Besides, RNAi targeting each of the four opsins did not significantly affect the survival of N. lugens in phytotron, but the silencing of Nllw resulted in the melanization of body color. Further transcriptome analysis revealed that silencing of Nllw resulted in up-regulation of a tyrosine hydroxylase gene (NlTH) and down-regulation of an arylalkylamine-N-acetyltransferases gene (NlaaNAT) in N. lugens, demonstrating that Nllw is involved in body color plastic development via the tyrosine-mediated melanism pathway. CONCLUSIONS: This study provides the first evidence in a Hemipteran insect that an opsin (Nllw) takes part in the regulation of cuticle melanization, confirming a cross-talk between the gene pathways underlying the visual system and the morphological differentiation in insects.

TC2N Promotes Cell Proliferation and Metastasis in Hepatocellular Carcinoma by Targeting the Wnt/ß-Catenin Signaling Pathway.

Hepatocellular carcinoma (HCC), one of the most prevalent types of cancer worldwide, has an exceedingly poor prognosis. Tandem C2 domain nuclear protein (TC2N) has been implicated in tumorigenesis and serves as an oncogene or tumor suppressor in different types of cancer. Here, we explore the possible regulatory activities and molecular mechanisms of TC2N in HCC progression. However, TC2N expression was significantly upregulated in HCC tissues and hepatoma cell lines, and this upregulation was positively correlated with tumor progression in HCC patients. The ectopic overexpression of TC2N accelerated the proliferation, migration, and invasion of HCC cells, whereas its knockdown showed the opposite effects. Bioinformatics analysis showed that TC2N participates in the regulation of the Wnt/ß-catenin signaling pathway. Mechanistically, TC2N activated the Wnt/ß-catenin signaling pathway by regulating the expression levels of ß-catenin and its downstream targets CyclinD1, MMP7, c-Myc, c-Jun, AXIN2, and glutamine synthase. Furthermore, the deletion of ß-catenin effectively neutralized the regulation of TC2N in HCC proliferation and metastasis. Overall, this study showed that TC2N promotes HCC proliferation and metastasis by activating the Wnt/ß-catenin signaling pathway, indicating that TC2N might be a potential molecular target for the treatment of HCC.

Chromosomal abnormalities in recurrent pregnancy loss and its association with clinical characteristics.

OBJECTIVE: To evaluate the distribution of chromosomal abnormalities in a recurrent pregnancy loss (RPL) cohort and explore the associations between chromosomal abnormalities and clinical characteristics. METHOD: Over a 5-year period, fresh products of conception (POC) from women with RPL were analyzed by single-nucleotide polymorphism (SNP) array at our hospital. After obtaining the information on clinical characteristics, we investigated the associations between the causative chromosomal abnormalities and clinical characteristics by the chi-squared test or Fisher's exact test and logistic regression. RESULTS: A total of 2383 cases were enrolled. Overall, 56.9% (1355/2383) were identified with causative chromosomal abnormalities, of which 92.1% (1248/1355) were numerical abnormalities, 7.5% (102/1355) were structural variants, and 0.4% (5/1355) were loss of heterozygosity (LOH). The risk of numerical abnormalities was increased in women with maternal age ≥ 35 years (OR, 1.71; 95% CI, 1.41-2.07), gestational age at pregnancy loss ≤ 12 weeks (OR, 2.78; 95% CI, 1.79-4.33), less number of previous pregnancy losses (twice: OR, 2.32; 95% CI, 1.84-2.94; 3 times: OR, 1.59; 95% CI, 1.23-2.05, respectively), and pregnancy with a female fetus (OR, 1.37; 95% CI, 1.15-1.62). The OR of pregnancy loss with recurrent abnormal CMA was 4.00 (95% CI: 1.87-8.58, P < 0.001) and the adjusted OR was 5.05 (95% CI: 2.00-12.72, P = 0.001). However, the mode of conception was not associated with the incidence of numerical abnormality. No association was noted between structural variants and clinical characteristics. CONCLUSION: Chromosomal abnormality was the leading cause of RPL. Numerical chromosome abnormality was more likely to occur in cases with advanced maternal age, an earlier gestational age, fewer previous pregnancy losses, and pregnancy with a female fetus.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

Venous-arterial extracorporeal membrane oxygenation support for patients poisoned by Macleaya cordata.

Macleaya cordata is a Chinese herbal medicine containing a variety of highly cardiotoxic alkaloids, and might result in cardiac failure. Venous-arterial Extracorporeal membrane oxygenation (VA-ECMO) could be used as a therapeutic option in patients poisoned by Macleaya cordata complicating refractory cardiogenic shock or cardiac arrest. A 60-year-old man suffered from severe arrhythmia, cardiogenic shock and cardiac arrest after consuming Macleaya cordata. The patient received VA-ECMO support in the emergency department at 5 hours after hospitalization, and was weaned from VA-ECMO on day 4, and was discharged with complete clinical improvement on Day 12. VA-ECMO is an effective method in treating cardiogenic shock or cardiac arrest induced by severe poisoning from Chinese herbal medicine. Timely and appropriate interventions with venoarterial extracorporeal membrane oxygenation devices could improve clinical outcomes in these patients.

Impact of mind-body intervention on proinflammatory cytokines interleukin 6 and 1ß: A three-arm randomized controlled trial for persons with sleep disturbance and depression.

Depressed people are prone to sleep disturbance, which may in return perpetuate the depression. Both depression and sleep disturbance influence proinflammatory cytokines interleukin (IL) 6 and 1ß. Thus interventions for depression should consider the effect on sleep disturbance, and vice versa. Integrative Body-Mind-Spirit (IBMS) and Qigong interventions have been applied in a wide range of health and mental health conditions, including depression and sleep disturbance. This study aimed to evaluate the effect of these two mind-body therapies for persons with both depressive symptoms and sleep disturbance. A three-arm randomized controlled trial was conducted among 281 participants, who were randomly assigned to either IBMS, Qigong or wait list control group. Participants in IBMS and Qigong groups received eight weekly sessions of intervention. Outcome measures were plasma concentrations of IL-6 and IL-1ß, and a questionnaire containing Pittsburgh Sleep Quality Index, Center for Epidemiologic Studies Depression Scale, Somatic Symptom Inventory, Perceived Stress Scale and Body-Mind-Spirit Holistic Well-being Scale. Outcomes were assessed at baseline (T0), immediate post-intervention (T1) and at three-months post-intervention (T2). Besides intervention efficacy analysis, path analysis was performed to explore the relations among perceived stress, depression, sleep disturbance, and IL-6 and IL-1ß values. The study found both IBMS and Qigong reduced depression, sleep disturbance, painful and painless somatic symptoms, IL-6 and IL-1ß levels, and increased holistic well-being. The effect sizes of IBMS and Qigong, mostly in the medium magnitude range, were approximatively equivalent. Path analysis models revealed a predictive role of perceived stress in depression and sleep disturbance, a bidirectional relationship between depression and sleep disturbance, and significant influence of depression and sleep disturbance on IL-6 and IL-1ß. Compared with control, the findings support the efficacy of IBMS and Qigong interventions in relieving depression and sleep disturbance, and in reducing IL-6 and IL-1ß levels.