Spt4 is selectively required for transcription of extended trinucleotide repeats.

Lengthy trinucleotide repeats encoding polyglutamine (polyQ) stretches characterize the variant proteins of Huntington's disease and certain other inherited neurological disorders. Using a phenotypic screen to identify events that restore functionality to polyQ proteins in S. cerevisiae, we discovered that transcription elongation factor Spt4 is required to transcribe long trinucleotide repeats located either in ORFs or nonprotein-coding regions of DNA templates. Mutation of SPT4 selectively decreased synthesis of and restored enzymatic activity to expanded polyQ protein without affecting protein lacking long-polyQ stretches. RNA-seq analysis revealed limited effects of Spt4 on overall gene expression. Inhibition of Supt4h, the mammalian ortholog of Spt4, reduced mutant huntingtin protein in neuronal cells and decreased its aggregation and toxicity while not altering overall cellular mRNA synthesis. Our findings identify a cellular mechanism for transcription through repeated trinucleotides and a potential target for countermeasures against neurological disorders attributable to expanded trinucleotide regions.

A viral movement protein co-opts endoplasmic reticulum luminal-binding protein and calreticulin to promote intracellular movement.

Intracellular movement is an important step for the initial spread of virus in plants during infection. This process requires virus-encoded movement proteins (MPs) and their interaction with host factors. Despite the large number of known host factors involved in the movement of different viruses, little is known about host proteins that interact with one of the MPs encoded by potexviruses, the triple-gene-block protein 3 (TGBp3). The main obstacle lies in the relatively low expression level of potexviral TGBp3 in hosts and the weak or transient nature of interactions. Here, we used TurboID-based proximity labeling to identify the network of proteins directly or indirectly interacting with the TGBp3 of a potexvirus, Bamboo mosaic virus (BaMV). Endoplasmic reticulum (ER) luminal-binding protein 4 and calreticulin 3 of Nicotiana benthamiana (NbBiP4 and NbCRT3, respectively) associated with the functional TGBp3-containing BaMV movement complexes, but not the movement-defective mutant, TGBp3M. Fluorescent microscopy revealed that TGBp3 colocalizes with NbBiP4 or NbCRT3 and the complexes move together along ER networks to cell periphery in N. benthamiana. Loss- and gain-of-function experiments revealed that NbBiP4 or NbCRT3 is required for the efficient spread and accumulation of BaMV in infected leaves. In addition, overexpression of NbBiP4 or NbCRT3 enhanced the targeting of BaMV TGBp1 to plasmodesmata (PD), indicating that NbBiP4 and NbCRT3 interact with TGBp3 to promote the intracellular transport of virion cargo to PD that facilitates virus cell-to-cell movement. Our findings revealed additional roles for NbBiP4 and NbCRT3 in BaMV intracellular movement through ER networks or ER-derived vesicles to PD, which enhances the spread of BaMV in N. benthamiana.

The intracellular environment affects protein-protein interactions.

Protein-protein interactions are essential for life but rarely thermodynamically quantified in living cells. In vitro efforts show that protein complex stability is modulated by high concentrations of cosolutes, including synthetic polymers, proteins, and cell lysates via a combination of hard-core repulsions and chemical interactions. We quantified the stability of a model protein complex, the A34F GB1 homodimer, in buffer, Escherichia coli cells and Xenopus laevis oocytes. The complex is more stable in cells than in buffer and more stable in oocytes than E. coli Studies of several variants show that increasing the negative charge on the homodimer surface increases stability in cells. These data, taken together with the fact that oocytes are less crowded than E. coli cells, lead to the conclusion that chemical interactions are more important than hard-core repulsions under physiological conditions, a conclusion also gleaned from studies of protein stability in cells. Our studies have implications for understanding how promiscuous-and specific-interactions coherently evolve for a protein to properly function in the crowded cellular environment.

A Difference between In Vitro and In-Cell Protein Dimer Formation.

The high concentration of macromolecules in cells affects the stability of proteins and protein complexes via hard repulsions and chemical interactions, yet few studies have focused on chemical interactions. We characterized the domain-swapped dimer of the B1 domain of protein G in buffer and Escherichia coli cells by using heteronuclear, multidimensional nuclear magnetic resonance spectroscopy. In buffer, the monomer is a partially folded molten globule, but that species is not observed in cells. Experiments using urea suggest that the monomer is unfolded in cells, but again, the molten-globule form of the monomer is absent. The data suggest that attractive chemical interactions in the cytoplasm unfold the molten globule. We conclude that the intracellular environment not only modulates the stability of protein complexes but also can change the species present, reinforcing the idea that chemical interactions are more important than hard repulsions in cells.

NbPsbO1 Interacts Specifically with the Bamboo Mosaic Virus (BaMV) Subgenomic RNA (sgRNA) Promoter and Is Required for Efficient BaMV sgRNA Transcription.

Many positive-strand (+) RNA viruses produce subgenomic RNAs (sgRNAs) in the infection cycle through the combined activities of viral replicase and host proteins. However, knowledge about host proteins involved in direct sgRNA promoter recognition is limited. Here, in the partially purified replicase complexes from Bamboo mosaic virus (BaMV)-infected tissue, we have identified the Nicotiana benthamiana photosystem II oxygen-evolving complex protein, NbPsbO1, which specifically interacted with the promoter of sgRNA but not that of genomic RNA (gRNA). Silencing of NbPsbO1 expression suppressed BaMV accumulation in N. benthamiana protoplasts without affecting viral gRNA replication. Overexpression of wild-type NbPsbO1 stimulated BaMV sgRNA accumulation. Fluorescent microscopy examination revealed that the fluorescence associated with NbPsbO1 was redistributed from chloroplast granal thylakoids to stroma in BaMV-infected cells. Overexpression of a mislocalized mutant of NbPsbO1, dTPPsbO1-T7, inhibited BaMV RNA accumulation in N. benthamiana, whereas overexpression of an NbPsbO1 derivative, sPsbO1-T7, designed to be targeted to chloroplast stroma, upregulated the sgRNA level. Furthermore, depletion of NbPsbO1 in BaMV RdRp preparation significantly inhibited sgRNA synthesis in vitro but exerted no effect on (+) or (-) gRNA synthesis, which indicates that NbPsbO1 is required for efficient sgRNA synthesis. These results reveal a novel role for NbPsbO1 in the selective enhancement of BaMV sgRNA transcription, most likely via direct interaction with the sgRNA promoter. IMPORTANCE Production of subgenomic RNAs (sgRNAs) for efficient translation of downstream viral proteins is one of the major strategies adapted for viruses that contain a multicistronic RNA genome. Both viral genomic RNA (gRNA) replication and sgRNA transcription rely on the combined activities of viral replicase and host proteins, which recognize promoter regions for the initiation of RNA synthesis. However, compared to the cis-acting elements involved in the regulation of sgRNA synthesis, the host factors involved in sgRNA promoter recognition mostly remain to be elucidated. Here, we found a chloroplast protein, NbPsbO1, which specifically interacts with Bamboo mosaic virus (BaMV) sgRNA promoter. We showed that NbPsbO1 is relocated to the BaMV replication site in BaMV-infected cells and demonstrated that NbPsbO1 is required for efficient BaMV sgRNA transcription but exerts no effect on gRNA replication. This study provides a new insight into the regulating mechanism of viral gRNA and sgRNA synthesis.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Rheostatic Control of Protein Expression Using Tuner Cells.

We assessed the ability of two strains of Escherichia coli, BL21 (DE3) and Tuner (DE3), to express a variant of the B1 domain of protein G, which forms a side-by-side dimer, by using fluorine-labeling and 19F nuclear magnetic resonance spectroscopy. BL21 cells express the protein in a binary, all-or-none, manner, where more cells express the protein at a high level with an increasing inducer concentration. Tuner cells express the protein in a rheostatic manner, where expression increases across all cells with an increasing inducer concentration.

Effects of Length and Loop Composition on Structural Diversity and Similarity of (G3TG3NmG3TG3) G-Quadruplexes.

A G-rich sequence containing three loops to connect four G-tracts with each ≥2 guanines can possibly form G-quadruplex structures. Given that all G-quadruplex structures comprise the stacking of G-quartets, the loop sequence plays a major role on their folding topology and thermal stability. Here circular dichroism, NMR, and PAGE are used to study the effect of loop length and base composition in the middle loop, and a single base difference in loop 1 and 3 on G-quadruplex formation of (G3HG3NmG3HG3) sequences with and without flanking nucleotides, where H is T, A, or C and N is T, A, C, or G. In addition, melting curve for G-quadruplex unfolding was used to provide relatively thermal stability of G-quadruplex structure after the addition of K+ overnight. We further studied the effects of K+ concentration on their stability and found structural changes in several sequences. Such (G3HG3NmG3HG3) configuration can be found in a number of native DNA sequences. The study of structural diversity and similarity from these sequences may allow us to establish the correlation between model sequences and native sequences. Moreover, several sequences upon interaction with a G-quadruplex ligand, BMVC, show similar spectral change, implying that structural similarity is crucial for drug development.

Effects of Acute Aerobic and Resistance Exercise on Cognitive Function and Salivary Cortisol Responses.

This study aimed to determine the comparative effectiveness of aerobic vs. resistance exercise on cognitive function. In addition, salivary cortisol responses, as an indicator of arousal-related neuroendocrine responses, were assessed as a potential mechanism underlying the effects of these 2 modes of acute exercise on cognition. Forty-two young adults were recruited and performed the Stroop task after 1 session of aerobic exercise, resistance exercise, and a sedentary condition performed on separate days. Saliva samples were collected at baseline and immediately and 30 min after treatment conditions. Acute exercise, regardless of exercise modality, improved multiple aspects of cognitive function as reflected by the Stroop task. Cortisol responses were higher after both modes of acute exercise compared with the sedentary condition and were higher at baseline and 30 min afterward compared with immediately after treatment conditions. These findings suggest that acute exercise of moderate intensity facilitates cognitive function, and, although salivary cortisol is influenced by acute exercise, levels were not related to improvements in cognition.

Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation.

DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (hTERT), is overexpressed in ∼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the hTERT gene can down-regulate its expression. However, DNA methylation in the first exon can prevent CTCF binding in most cancers, but the molecular mechanism is unknown. The NMR analysis showed that a stretch of guanine-rich sequence in the first exon of hTERT and located within the CTCF-binding region can form two secondary structures, a hairpin and a quadruplex. A key finding was that the methylation of cytosine at the specific CpG dinucleotides will participate in quartet formation, causing the shift of the equilibrium from the hairpin structure to the quadruplex structure. Of further importance was the finding that the quadruplex formation disrupts CTCF protein binding, which results in an increase in hTERT gene expression. Our results not only identify quadruplex formation in the first exon promoted by CpG dinucleotide methylation as a regulator of hTERT expression but also provide a possible mechanistic insight into the regulation of gene expression via secondary DNA structures.

Cultivation of auricular chondrocytes in poly(ethylene glycol)/poly(ε-caprolactone) hydrogel for tracheal cartilage tissue engineering in a rabbit model.

Tissue engineering has the potential to overcome the limitations of tracheal reconstruction. To tissue-engineer a tracheal cartilage, auricular chondrocytes were encapsulated in a photocurable poly(ethylene glycol)/poly(ε-caprolactone) (PEG/PCL) hydrogel. Chondrogenic genes, including Sox9, Acan and Col2a1, were up-regulated in auricular chondrocytes after 2 weeks of in vitro cultivation in the PEG/PCL hydrogel. Co-cultivation of 70 % auricular chondrocytes and 30 % bone marrow mesenchymal stem cells (BMSCs) accelerated the chondrogenic genes' expression in the PEG/PCL hydrogel. Cartilaginous matrix markers, including proteoglycans and collagen type II, were detected in the chondrocytes-encapsulated PEG/PCL hydrogel after 4 weeks of in vitro cultivation. The higher expression level of cartilaginous matrix markers was observed in the PEG/PCL hydrogel with co-cultivation of 70 % chondrocytes and 30 % BMSCs. After 4 weeks of ectopic cultivation in rabbits, the cylindrical PEG/PCL structure was sustained with the use of a luminal silicon stent. However, without the stent, the construct collapsed under a compression force. No fibrosis or vessel ingrowth were found in the PEG/PCL hydrogel after 4 weeks of ectopic cultivation, whereas the auricular chondrocytes showed proteoglycans' accumulation and collagen type II production. Rabbit auricular chondrocytes could survive and retain chondrogenic ability in the PEG/PCL hydrogel under both in vitro and in vivo conditions. While the PEG/PCL hydrogel did not show sufficient mechanical properties for supporting the cylindrical shape of the construct, the high chondrogenesis level of chondrocytes in the PEG/PCL hydrogel displayed the potential of this material for tracheal tissue engineering.

Comparison of vibration rolling, nonvibration rolling, and static stretching as a warm-up exercise on flexibility, joint proprioception, muscle strength, and balance in young adults.

Warm-up is an essential component for optimizing performance before an exercise session. This study investigated that the immediate effects of vibration rolling (VR), nonvibration rolling (NVR), and static stretching as a part of a warm-up regimen on the flexibility, knee joint proprioception, muscle strength, and dynamic balance of the lower extremity in young adults. Compared with the preintervention, VR induced the range of motion of knee flexion and extension significantly increased by 2.5% and 6%, respectively, and isokinetic peak torque and dynamic balance for muscle strength and dynamic balance increased by 33%-35% and 1.5%, respectively. In the three conditions, most outcomes between VR and NVR were comparable; however, the participants had a significantly higher knee joint reposition error after NVR than after VR, indicating that NVR would have a hampering knee joint proprioception effect. In particular, compared with static stretching, VR significantly increased the quadriceps muscle strength by 2-fold and dynamic balance by 1.8-fold. These findings suggest that athletic professionals may take VR into account for designing more efficient and effective preperformance routine to improve exercise performances. VR has high potential to translate into an on-field practical application.

A G-Quadruplex Structure in the Promoter Region of CLIC4 Functions as a Regulatory Element for Gene Expression.

The differential transcriptional expression of CLIC4 between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of CLIC4. To better understand how this gene is regulated, the promoter region of CLIC4 was analyzed. We found that a high GC content near the transcriptional start site (TSS) might form an alternative G-quadruplex (G4) structure. Nuclear magnetic resonance spectroscopy (NMR) confirmed their formation in vitro. The reporter assay showed that one of the G4 structures exerted a regulatory role in gene transcription. When the G4-forming sequence was mutated to disrupt the G4 structure, the transcription activity dropped. To examine whether this G4 structure actually has an influence on gene transcription in the chromosome, we utilized the CRISPR/Cas9 system to edit the G4-forming sequence within the CLIC4 promoter in the cell genome. The pop-in/pop-out strategy was adopted to isolate the precisely-edited A375 cell clone. In CRISPR-modified A375 cell clones whose G4 was disrupted, there was a decrease in the endogenous CLIC4 messenger RNA (mRNA) expression level. In conclusion, we found that the G4 structure in the CLIC4 promoter might play an important role in regulating the level of transcription.

Binding of Small Molecules to G-quadruplex DNA in Cells Revealed by Fluorescence Lifetime Imaging Microscopy of o-BMVC Foci.

G-quadruplex (G4) structures have recently received increasing attention as a potential target for cancer research. We used time-gated fluorescence lifetime imaging microscopy (FLIM) with a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), to measure the number of o-BMVC foci, which may represent G4 foci, in cells as a common signature to distinguish cancer cells from normal cells. Here, the decrease in the number of o-BMVC foci in the pretreatment of cancer cells with TMPyP4, BRACO-19 and BMVC4 suggested that they directly bind to G4s in cells. In contrast, the increase in the number of o-BMVC foci in the pretreatment of cells with PDS and Hoechst 33258 (H33258) suggested that they do not inhabit the binding site of o-BMVC to G4s in cells. After the H33258 was removed, the gradual decrease of H33258-induced G4 foci may be due to DNA repair. The purpose of this work is to introduce o-BMVC foci as an indicator not only to verify the direct binding of potential G4 ligands to G4 structures but also to examine the possible effect of some DNA binding ligands on DNA integrity by monitoring the number of G4 foci in cells.

Effects of Taping on Achilles Tendon Protection and Kendo Performance.

CONTEXT: It has been reported that there is a high rate of Achilles tendon injury among kendo athletes. For protection and to support the area, kendo athletes habitually use taping during practice or games. OBJECTIVE: To investigate the effect of various taping techniques on injury prevention and functional performance in kendo athletes. DESIGN: Case-control study. SETTING: Laboratory. PARTICIPANTS: 15 University Kendo Team athletes with at least 2 y kendo experience. MAIN OUTCOME MEASURES: Athletes completed 5 stepping backwards and striking cycles under 4 taping conditions: no taping, athletic taping of ankle joint (AT-Ankle), athletic taping of Achilles tendon (AT-Achilles), and Kinesio-Tex taping of Achilles tendon (KT-Achilles). Jump distance, lower limb angular motion, left foot-ground contact time, Achilles tendon force (ATF), and soleus and medial gastrocnemius muscle activities were measured. RESULTS: Lowest peak ATF was found in AT-Achilles during heel-down phase, with statistically significant difference from KT-Achilles peak force. Significant decline of soleus muscle electromyography amplitude was also found when compared to no taping during heel-down phase and other conditions during pushing phase. Conversely, KT-Achilles showed significant decrease in foot-ground contact time compared with no taping and greater ankle range of motion than in AT-Ankle. CONCLUSION: To protect the Achilles tendon, AT-Achilles taping is recommended since it tends to decrease ATF. Conversely, to enhance athlete performance, we recommend KT-Achilles taping to speed up kendo striking motion. However, the Achilles tendon must withstand greatest forces concurrently. This finding implies that AT-Achilles taping can protect the injured Achilles tendon and KT-Achilles taping can enhance performance on the kendo striking motion.

The Association of Type D personality with Heart Rate Variability and Lipid Profiles Among Patients with Coronary Artery Disease.

PURPOSE: Characteristics of the distressed (Type D) personality include negative affectivity (NA) and social inhibition (SI), which are associated with an increased risk of major adverse cardiac events and mortality among patients with coronary artery disease (CAD). The aims of this study were to examine: (1) the correlation of NA and SI with psychological characteristics, heart rate variability (HRV) indices, and lipids profiles and (2) the differences in psychological characteristics, HRV indices, and lipid profiles between patients with CAD with Type D personality and those with non-Type D personality. METHOD: A cross-sectional study was conducted on 168 patients with CAD. The Taiwanese 14-item Type D Scale, Chinese Hostility Inventory-Short Form, Beck Depression Inventory-II, Beck Anxiety Inventory, and Anger Rumination Scale were administered to all of the participants. The raw signals of electrocardiograms were recorded over a 5-min baseline resting period and then transformed to HRV indices representing short-term cardiac autonomic activations. Lipid profiles were acquired from patients' medical records. RESULTS: NA was positively correlated with hostility, depression, anxiety, and anger rumination. With respect to pathophysiological mechanisms for CAD with Type D personality, NA was negatively correlated with standard deviation of all normal-to-normal intervals (SDNN) and total power of HRV and positively correlated with total cholesterol. SI was positively correlated with suppressive hostility behavior and anger rumination; however, SI was not significantly correlated with expressive hostility behavior, or HRV indices and lipid profiles. CONCLUSION: Pathophysiological mechanisms leading to higher rates of adverse outcomes in CAD in individuals with Type D personalities may involve cardiac autonomic imbalance and lipid dysregulation.

Exercise Modality Is Differentially Associated with Neurocognition in Older Adults.

This study explored the effects of exercise modality and type of fitness index on cognitive function in the older adults as assessed via behavioral and neuroelectrical approaches. Sixty older adults were assigned to an aerobic exercise, a coordination exercise, or a control group based on their previous exercise experience. The participants completed congruent and incongruent trials of a modified Stroop Test, during which, event-related potentials were recorded. The participants also completed multiple physical tests that assessed health- and skill-related fitness. Our findings suggest that, in general, both aerobic and coordination exercise, as well as higher scores on health- and skill-related fitness indices, are positively associated with better performance of various cognitive functions in the elderly population. The mechanisms underlying these relationships may be differentially related to specific neuroelectrical processes involved in neurocognitive control.

Multicomponent Exercise Intervention and Metacognition in Obese Preadolescents: A Randomized Controlled Study.

This study examines the effect of a 12-week multicomponent exercise intervention on metacognition among preadolescents with obesity. Seventy-five preadolescents were randomly assigned to either a multicomponent exercise group or a reading control group. An exercise intervention consisting of a jumping rope was utilized to develop multifaceted fitness features, with each session lasting for 75 min and three sessions being conducted per week for 12 weeks. Results revealed significant interactions between group and time point for cardiovascular fitness, muscular endurance, flexibility, and power, as well as for Tower of London task measures, including total move score, total executive time, and total planning-solving time, with better postintervention performances achieved by the exercise group. Positive correlations between the physical fitness and metacognition measurements were also observed. These findings suggest that the multicomponent exercise benefits metacognition in obese preadolescents, with exercise-associated changes in multifaceted fitness features mediating the relationship between exercise and metacognition.

Acute Effects of Foam Rolling, Static Stretching, and Dynamic Stretching During Warm-ups on Muscular Flexibility and Strength in Young Adults.

CONTEXT: Foam rolling has been proposed to improve muscle function, performance, and joint range of motion (ROM). However, whether a foam rolling protocol can be adopted as a warm-up to improve flexibility and muscle strength is unclear. OBJECTIVES: To examine and compare the acute effects of foam rolling, static stretching, and dynamic stretching used as part of a warm-up on flexibility and muscle strength of knee flexion and extension. DESIGN: Crossover study. SETTING: University research laboratory. PARTICIPANTS: 15 male and 15 female college students (age 21.43 ± 1.48 y, weight 65.13 ± 12.29 kg, height 166.90 ± 6.99 cm). MAIN OUTCOME MEASURES: Isokinetic peak torque was measured during knee extension and flexion at an angular velocity of 60°/second. Flexibility of the quadriceps was assessed by the modified Thomas test, while flexibility of the hamstrings was assessed using the sit-and-reach test. The 3 interventions were performed by all participants in random order on 3 days separated by 48-72 hours. RESULTS: The flexibility test scores improved significantly more after foam rolling as compared with static and dynamic stretching. With regard to muscle strength, only knee extension peak torque (pre vs. postintervention) improved significantly after the dynamic stretching and foam rolling, but not after static stretching. Knee flexion peak torque remained unchanged. CONCLUSIONS: Foam rolling is more effective than static and dynamic stretching in acutely increasing flexibility of the quadriceps and hamstrings without hampering muscle strength, and may be recommended as part of a warm-up in healthy young adults.

Fibrotic-like changes in degenerate human intervertebral discs revealed by quantitative proteomic analysis.

OBJECTIVE: Intervertebral disc degeneration (IDD) can lead to symptomatic conditions including sciatica and back pain. The purpose of this study is to understand the extracellular matrix (ECM) changes in disc biology through comparative proteomic analysis of degenerated and non-degenerated human intervertebral disc (IVD) tissues of different ages. DESIGN: Seven non-degenerated (11-46 years of age) and seven degenerated (16-53 years of age) annulus fibrosus (AF) and nucleus pulposus (NP) samples were used. Proteins were extracted using guanidine hydrochloride, separated from large proteoglycans (PGs) by caesium chloride (CsCl) density gradient ultracentrifugation, and identified using liquid chromatography (LC) coupled with tandem mass spectrometry (MS/MS). For quantitative comparison, proteins were labeled with iTRAQ reagents. Collagen fibrils in the NP were assessed using scanning electron microscopy (SEM). RESULTS: In the AF, quantitative analysis revealed increased levels of HTRA1, COMP and CILP in degeneration when compared with samples from older individuals. Fibronectin showed increment with age and degeneration. In the NP, more CILP and CILP2 were present in degenerated samples of younger individuals. Reduced protein solubility was observed in degenerated and older non-degenerated samples correlated with an accumulation of type I collagen in the insoluble fibers. Characterization of collagen fibrils in the NP revealed smaller mean fibril diameters and decreased porosity in the degenerated samples. CONCLUSIONS: Our study identified distinct matrix changes associated with aging and degeneration in the intervertebral discs (IVDs). The nature of the ECM changes, together with observed decreased in solubility and changes in fibril diameter is consistent with a fibrotic-like environment.