Increase in Ocular Syphilis Cases at Ophthalmologic Reference Center, France, 2012-2015.

We describe the frequency, demographic and clinical features, and visual outcomes of ocular syphilis infections observed during 2012-2015 at a tertiary reference center in Paris, France. Twenty-one cases (29 eyes) were identified. The occurrence of ocular syphilis increased from 1 case in 2012 to 5 cases in 2013, 6 cases in 2014, and 9 cases in 2015 (2.22-25.21/1,000 individual patients/year for the period). Among case-patients, an annual 20%-33% were co-infected with HIV. Seventy-six percent of ocular syphilis infections occurred in men who have sex with men. Seventy-five percent of case-patients had a good final visual outcome (best-corrected visual acuity >0.3 logMAR score). Visual outcome was worse for HIV-positive patients than for HIV-negative patients (p = 0.0139). At follow-up, the best visual outcomes were observed in patients whose mean time from first ocular symptom to consultation was 15 days (SD +19 days).

Modeling approach to characterize intraocular doripenem pharmacokinetics after intravenous administration to rabbits, with tentative extrapolation to humans.

The aim of this study was to determine the penetration of doripenem administered intravenously into the rabbit aqueous and vitreous humors. Nineteen New Zealand White rabbits received a 20-mg dose of doripenem intravenously over 60 min. Specimens of aqueous humor, vitreous humor, and blood were obtained 30 min (n = 5), 1 h (n = 5), 2 h (n = 5), and 3 h (n = 4) after the beginning of the infusion and analyzed by high-performance liquid chromatography (HPLC). A pharmacokinetic (PK) model was developed to fit the experimental data. Doripenem concentrations in aqueous humor were lower than those in plasma ultrafiltrates at all sampling times, with an average aqueous humor-to-plasma ultrafiltrate area under the concentration-time curve ratio estimated as 8.3%. A pharmacokinetic model with peripheral elimination described the data adequately and was tentatively used to predict concentration-versus-time profiles and pharmacokinetic-pharmacodynamic (PK-PD) target attainment in patients under various dosing regimens. In conclusion, systematically administered doripenem does not seem to be a promising approach for the treatment of intraocular infections, especially since it could not be detected in the vitreous humor. However, this study has provided an opportunity to develop a new PK modeling approach to characterize the intraocular distribution of doripenem administered intravenously to rabbits, with tentative extrapolation to humans.

New strategy for rapid diagnosis and characterization of keratomycosis.

PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.

Cytokines, chemokines and growth factors profile in human aqueous humor in idiopathic uveitis.

To investigate which cytokines, chemokines and growth factors are involved in the immunopathogenesis of idiopathic uveitis, and whether cytokine profiles are associated with. Serum and aqueous humor (AH) samples of 75 patients with idiopathic uveitis were analyzed by multiplex immunoassay. Infectious controls consisted of 16 patients with ocular toxoplasmosis all confirmed by intraocular fluid analyses. Noninfectious controls consisted of 7 patients with Behçet disease related uveitis and 15 patients with sarcoidosis related uveitis. The control group consisted of AH and serum samples from 47 noninflammatory control patients with age-related cataract. In each sample, 27 immune mediators ± IL-21 and IL-23 were measured. In idiopathic uveitis, 13 of the 29 mediators, including most proinflammatory and vascular mediators such as IL-6, IL-8, IL-12, G-CSF, GM-CSF, MCP-1, IP-10, TNF-α and VEGF, were significantly elevated in the aqueous humor when compared to all controls. Moreover, IL-17, IP-10, and IL-21, were significantly elevated in the serum when compared to all controls. We clustered 4 subgroups of idiopathic uveitis using a statistical analysis of hierarchical unsupervised classification, characterized by the order of magnitude of concentrations of intraocular cytokines. The pathogenesis of idiopathic uveitis is characterized by the presence of predominantly proinflammatory cytokines and chemokines and vascular endothelial growth factor with high expression levels as compared to other causes of uveitis. There are indications for obvious Th-1/ IL21-Th17 pathways but also IL9-Th9 and increased IFN-γ-inducing cytokine (IL12) and IFN-γ-inducible CXC chemokine (IP-10). The combined data suggest that immune mediator expression is different among idiopathic uveitis. This study suggests various clusters among the idiopathic uveitis group rather than one specific uveitis entity.

Real-time polymerase chain reaction and intraocular antibody production for the diagnosis of viral versus toxoplasmic infectious posterior uveitis.

PURPOSE: The aim of this work was to determine the diagnostic performance of real-time polymerase chain reaction (RT-PCR) and to assess intraocular specific antibody secretion (Goldmann-Witmer coefficient) on samples from patients with signs of posterior uveitis presumably of infectious origin and to target the use of these two biologic tests in the diagnostic of Toxoplasma/viral Herpesviridae posterior uveitis by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humour and/or vitreous fluid were collected from patients suspected of having posterior uveitis of infectious origin at presentation (140 samples). The diagnosis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and for detection of Herpesviridae and Toxoplasma gondii genomes with RT-PCR. Forty-one patients had final diagnosis of uveitis of non-Toxoplasma/non-viral origin and 35 among them constituted the control group. The main outcome measures were sensitivity, specificity, and positive and negative predictive values (PPV and NPV). RESULTS: When pre-intraocular testing indication was compared with final diagnosis, GWC was a more sensitive and specific method than RT-PCR, and was successful in detecting T. gondii, especially if the patient is immunocompetent and the testing is carried out later in the disease course, up to 15 months. For viral Herpesviridae uveitis, the sensitivity and PPV of PCR evaluation was higher than detected with GWC with respectively 46% compared with 20% for sensitivity and 85% versus 60% for PPV. In either viral retinitis or toxoplasmosis infection, RT-PCR results were positive from 24 h, although GWC was not significant until 1 week after the onset of signs. In toxoplasmosis patients, positive RT-PCR results were statistically correlated with the chorioretinitis area (more than three disc areas; p = 0.002), with the age older than 50 (p = 0.0034) and with a clinical anterior inflammation (Tyndall ≥1/2+) and panuveitis; (p = 0.0001). CONCLUSIONS: For the diagnosis of viral or toxoplasmosis-associated intraocular inflammation, the usefulness of laboratory diagnosis tools (RT-PCR and GWC) depends on parameters other than the sensitivity of the tests. Certain patient characteristics such as the age of the patients, immune status, duration since the onset of symptoms, retinitis area, predominant site and extent of inflammation within the eye should orientate the rational for the choice of laboratory testing in analysis of intraocular fluids.

Cytoprotective Effects of Natural Highly Bio-Available Vegetable Derivatives on Human-Derived Retinal Cells.

Retinal pigment epithelial cells are crucial for retina maintenance, making their cytoprotection an excellent way to prevent or slow down retinal degeneration. In addition, oxidative stress, inflammation, apoptosis, neovascularization, and/or autophagy are key pathways involved in degenerative mechanisms. Therefore, here we studied the effects of curcumin, lutein, and/or resveratrol on human retinal pigment epithelial cells (ARPE-19). Cells were incubated with individual or combined agent(s) before induction of (a) H2O2-induced oxidative stress, (b) staurosporin-induced apoptosis, (c) CoCl2-induced hypoxia, or (d) a LED-autophagy perturbator. Metabolic activity, cellular survival, caspase 3/7 activity (casp3/7), cell morphology, VEGF levels, and autophagy process were assessed. H2O2 provoked a reduction in cell survival, whereas curcumin reduced metabolic activity which was not associated with cell death. Cell death induced by H2O2 was significantly reduced after pre-treatment with curcumin and lutein, but not resveratrol. Staurosporin increased caspase-3/7 activity (689%) and decreased cell survival by 32%. Curcumin or lutein protected cells from death induced by staurosporin. Curcumin, lutein, and resveratrol were ineffective on the increase of caspase 3/7 induced by staurosporin. Pre-treatment with curcumin or lutein prevented LED-induced blockage of autophagy flux. Basal-VEGF release was significantly reduced by lutein. Therefore, lutein and curcumin showed beneficial protective effects on human-derived retinal cells against several insults.

A Comparison of the Dexamethasone Implant (Ozurdex®) and Inferior Fornix-Based Sub-Tenon Triamcinolone Acetonide for Treatment of Inflammatory Ocular Diseases.

PURPOSE: To evaluate the efficacy and safety of dexamethasone (DEX) implant compared with inferior fornix-based sub-Tenon triamcinolone injection (PSTA) for treatment of uveitis. METHODS: A total of 48 eyes received DEX and 49 eyes received PSTA as the first treatment. RESULTS: A total of 31 eyes were implanted with DEX relapsed (64.5%) after the first injection, while 32 eyes were injected with PSTA as the first treatment relapsed (65.3%). Kaplan-Meier estimated survival to overall relapse after the first injection was a mean 20 months± 3.6 months for DEX (median,7) and 14 months± 1.9 months (median,9) for the PSTA (P = 0.505). Of 49 eyes receiving the PSTA implant as the first treatment, inflammation persisted in 14.3% after the first injection but persisted in none after the DEX injection (P = 0.005). CONCLUSIONS: DEX implantation achieved a higher rate of disease control in the initial 12 weeks postinjection with a relative equivalence in the duration of effect and relapse rates when compared with PSTA.

Efficacy and safety of short duration azithromycin eye drops versus azithromycin single oral dose for the treatment of trachoma in children: a randomised, controlled, double-masked clinical trial.

AIMS: Efficacy and safety of a short-duration treatment of azithromycin 1.5% eye drops versus oral azithromycin to treat active trachoma. METHODS: Randomised, controlled, double-masked, double-dummy, non-inferiority explanatory study including 670 children from Guinea Conakry and Pakistan if: 1-10 years old; active trachoma (TF+TI0 or TF+TI+ on simplified World Health Organisation (WHO) scale). Three groups received either: azithromycin 1.5% eye drops twice daily for 2 days, for 3 days or azithromycin single 20 mg/kg oral dose. Patients' contacts were treated whenever possible. Clinical evaluation was performed using a binocular loupe. Primary efficacy variable was the cure (no active trachoma (TF0)) at day 60. Non-inferiority margin for difference between cure rates was 10%. RESULTS: Cure rate in per protocol set was as follows: 93.0%, 96.3% and 96.6% in 2-day group 3-day group, and oral treatment group, respectively. Azithromycin 1.5% groups were non-inferior to oral azithromycin. The intend to treat (ITT) analysis supported the results. Clinical re-emergence rate was low: 4.2%. Ocular tolerance was similar for all groups. No treatment related adverse events were reported. Logistic regression analyses found prognostic factors such as: country (p<0.001) and trachoma severity (p = 0.003). CONCLUSIONS: In active trachoma, azithromycin eye drops twice daily for 2 or 3 days are as efficient as the WHO's reference treatment and represent an innovative alternative to oral azithromycin.

3-day treatment with azithromycin 1.5% eye drops versus 7-day treatment with tobramycin 0.3% for purulent bacterial conjunctivitis: multicentre, randomised and controlled trial in adults and children.

AIM: To compare the efficacy and safety of Azyter, azithromycin 1.5% eye drops, for 3 days with tobramycin 0.3% for 7 days to treat purulent bacterial conjunctivitis. METHODS: This was a multicentre, randomised, investigator-masked study including 1043 children and adults with purulent bacterial conjunctivitis. Patients received either azithromycin 1.5% twice-daily for 3 days or tobramycin 0.3%, 1 drop every two hours for 2 days, then four times daily for 5 days. Clinical signs were evaluated and cultures obtained at D0, D3 and D9 (where D refers to "day"). Primary variable was the clinical cure at the Test-of-Cure (TOC)-visit (D9+/-1), for patients with D0-positive cultures. The cure was defined as: bulbar conjunctival injection and discharge scores of 0. RESULTS: Among 471 patients with D0-positivity in the per protocol set, 87.8% of the azithromycin 1.5% group and 89.4% of the tobramycin group were clinically cured at the TOC-visit. Azithromycin was non-inferior to tobramycin for clinical and bacteriological cure. Clinical cure was significantly higher with azithromycin 1.5% at D3. The safety profile of azithromycin was satisfactory with a good patient and investigator's acceptability. CONCLUSIONS: Azithromycin 1.5% for 3 days was as effective and as safe as tobramycin for 7 days. Furthermore, more azithromycin than tobramycin patients presented an early clinical cure at Day 3. Due to its twice daily dosing regimen for 3 days, azithromycin represents a step forward in the management of purulent bacterial conjunctivitis, especially in children.

Clinical and microbiological diagnosis of trachoma in children living in rural areas in the district of Attock, Punjab, Pakistan.

BACKGROUND: Trachoma is a sight-threatening process triggered by infection of the conjunctiva with Chlamydiae. When this infection becomes chronic and is associated with poverty it triggers trachoma, the prime cause of infectious blindness in the world. Since the 1958 report indicating that the highest incidence of trachoma in Pakistan was found in the province of Punjab, no new trials have been published. In the present study, we assessed the prevalence of trachoma in 3968 children living in 11 rural villages in the district of Attock, Punjab, Pakistan. The children with trachoma were sampled to detect C. trachomatis by PCR. METHODS: Children in rural villages in the district of Attock were examined for trachoma in February 2004. Samples were obtained by scraping, and DNA was extracted (MagnaPure-LC Robot) and amplified to detect C. trachomatis (Amplicor-Roche). The quality of sampling was assessed by quantifying the number of cells by real-time PCR. RESULTS: The prevalence of trachoma was 3.7% (0 to 6.2%). PCR was positive in 20% of samples from trachomatous children and the number of cells was always > 100/sample. The income levels, illiteracy, use of latrines, water supply, and the presence of animals close to dwellings were similar in all the villages. In Sujjenda, the prevalence was doubled in the warmest season. CONCLUSIONS: Trachoma was diagnosed in 3.7% of the children aged < 10 years. The low rates for positive PCR may be due to loss of the plasmid, the involvement of other Chlamydiae, or their absence in chronic infections. The results obtained here underestimate the prevalence of trachoma because most of the mothers (and babies) were not tested in the district of Attock.

Social Sciences for the Prevention of Blindness.

Organizations working for the elimination of Chlamydia-triggered blindness (trachoma) follow the WHO SAFE strategy (surgery for trichiasis, antibiotics, face washing and environmental changes) with the aim to achieve a minimum of 80% of children with clean faces in endemic communities, mass treatment covering the whole district with trachoma rates of 10% or more and surveillance plans. Trachoma recurrence that is common after implementing the SAFE strategy 3, 5 or even 7 times evidence that the cognitive processes requiring assimilation and integration of knowledge did not register with parents, caretakers and children. Moreover, repeated awareness campaigns to improve hygiene did not systematically produce irreversible changes of behavior in neglected populations. In view of this evidence, the rational behind mass drug administration as the mainstay of preventable blindness elimination demands a wider scope than simple mathematical models. The reluctance to see disappointing outcomes that leads to repeated interventions may suggest from a sociologic point of view that the strategies are products of those evaluating the activities of those who fund them and vice versa. A similar articulation emerges for reciprocal interactions between researchers and those judging the pertinence and quality of their work. So far, the lack of autocritic elimination strategy approaches may expose inbred circles that did not properly grasp the fact that antibiotics, trichiasis surgery and education limited to improvement of hygiene are inefficient if not associated with long-term basic educational actions in schools.

Dificultades en la detección de genomas del Nuevo Coronavirus 2 (SARS COV-2) / SARS Coronavirus 2 (SARS CoV 2) genome detection pitfalls

El manejo de las infecciones virales respiratorias, tanto a nivel nacional como a nivel mundial, requiere resultados científicos de calidad. La reacción en cadena de la polimerasa de transcriptasa inversa (rRT-PCR, por su sigla en inglés) es considerada el "patrón de oro" para detectar el genoma del nuevo coronavirus 2 (SARS-CoV-2), agente causal de la enfermedad por el nuevo coronavirus (COVID-19) sobre todo en la fase aguda de la infección. Su uso es controvertido fuera de un contexto de exposición viral. El objetivo del presente trabajo es analizar escollos encontrados durante la detección del genoma del SARS-CoV-2 que pueden producir resultados falsos. Los falsos negativos de rRT-PCR pueden deberse al momento y la eficacia de la toma de la muestra, la congelación, el almacenamiento y la descongelación, y a la inactivación térmica de la virulencia. Además, las señales retardadas de los controles internos invalidan la negatividad. Por otra parte, las muestras con escaso material biológico llevan a conclusiones negativas falsas, por lo que determinar un umbral (número mínimo de células epiteliales) contribuirá a reducirlas. Sin embargo, la mayoría de los kits detectan ADN humano, pero no fueron calibrados para cuantificar carga celular. Los ácidos ribonucleicos nucleares (ARN) virales adheridos a guantes, tubos y gorros, -entre otros elementos-, son fuente de falsos positivos. Las farmacopeas sugieren que la contaminación externa se controle en series de 100 muestras con al menos una representatividad del 10%. Si se extrapola esta aproximación al laboratorio de análisis clínicos, en lugar de uno se deberían procesar al menos 10 controles negativos contiguos a 10 positivos cada 100 pruebas. Mejorar la detección por rRT-PCR implica un aumento de al menos 20% en el costo de los reactivos, por lo que se necesitan recursos adicionales.

Dificultades en la detección de genomas del nuevo coronavirus 2 (SARS CoV-2) / Pandemic and social inequiality: the popular neighborhoods of the Buenos Aires suburbs in preventive social isolation

RESUMEN El manejo de las infecciones virales respiratorias, tanto a nivel nacional como a nivel mundial, requiere resultados científicos de calidad. La reacción en cadena de la polimerasa de transcriptasa inversa (rRT-PCR, por su sigla en inglés) es considerada el "patrón de oro" para detectar el genoma del nuevo coronavirus 2 (SARS-CoV-2), agente causal de la enfermedad por el nuevo coronavirus (COVID-19) sobre todo en la fase aguda de la infección. Su uso es controvertido fuera de un contexto de exposición viral. El objetivo del presente trabajo es analizar escollos encontrados durante la detección del genoma del SARS-CoV-2 que pueden producir resultados falsos. Los falsos negativos de rRT-PCR pueden deberse al momento y la eficacia de la toma de la muestra, la congelación, el almacenamiento y la descongelación, y a la inactivación térmica de la virulencia. Además, las señales retardadas de los controles internos invalidan la negatividad. Por otra parte, las muestras con escaso material biológico llevan a conclusiones negativas falsas, por lo que determinar un umbral (número mínimo de células epiteliales) contribuirá a reducirlas. Sin embargo, la mayoría de los kits detectan ADN humano, pero no fueron calibrados para cuantificar carga celular. Los ácidos ribonucleicos nucleares (ARN) virales adheridos a guantes, tubos y gorros, -entre otros elementos-, son fuente de falsos positivos. Las farmacopeas sugieren que la contaminación externa se controle en series de 100 muestras con al menos una representatividad del 10%. Si se extrapola esta aproximación al laboratorio de análisis clínicos, en lugar de uno se deberían procesar al menos 10 controles negativos contiguos a 10 positivos cada 100 pruebas. Mejorar la detección por rRT-PCR implica un aumento de al menos 20% en el costo de los reactivos, por lo que se necesitan recursos adicionales.

ABSTRACT Emerging respiratory viral infections like the severe coronavirus disease (CoVID 19) caused by novel coronavirus 2 (SARS-CoV-2) require quality results for science-based responses. The reverse transcriptase polymerase chain reaction (rRT-PCR) is considered the gold standard for detecting SARS-CoV-2 (particularly in the acute phase of infection). The aim of the present work was to analyze pitfalls during the search of viral genomes. False negative conclusions are result of sampling timing, performances of swabbing, storage, and thawing and heat-infectivity inactivation. Samples with low biologic material also lead to false negatives. Qualitative controls to detect the presence of human DNA are available in several kits but they were not calibrated for quantification of human cell loads. Moreover, negativity cannot be reported for samples with delayed signals for the internal control (due to deficiency in extraction and/or retro transcription and/or or to the presence of rRT-PCR inhibitors). The viral RNA that may have stick on gloves, on tubes, caps, etc. may produce false positives. The International Pharmacopoeias recommend for external contamination to test at least 10% of the samples. Couples of 10 negative contiguous to 10 positive controls randomly distributed should be therefore included in each series of 100 rRT-PCR tests. These improvements increase the cost of each determination (at least by 20% only for the reactants) and require additional resources.

The limits of medical interventions for the elimination of preventable blindness.

BACKGROUND: Health authorities are working toward the global elimination of trachoma by the year 2020 with actions focused on the World Health Organization SAFE strategy (surgery of trichiasis, antibiotics, face washing and environmental changes) with emphasis on hygienist approaches for education. OBJECTIVES: The present survey was performed to assess the sustainability of the SAFE strategy 3 years after trachoma was eliminated from 6 villages. METHODS: In February 2013 a rapid trachoma assessment was conducted in 6 villages of Kolofata's district, Extreme north Region, Cameroon, where trachoma was eliminated in 2010. A total of 300 children (1-10 years) from 6 villages were examined by trained staff. RESULTS: The prevalence of active trachoma (children aged > 1 and < 10 years) in 2013 was 15% and in at least 25% was observed absence of face washing and flies in their eyes and nose. Income level, quality of roads, hygiene, and illiteracy were similar in all the villages; they did not change between 2010 and 2013 and could not be analyzed as independent risk factors. DISCUSSION: The heterogeneity of methods described for clinical trials makes it inappropriate to conduct meta-analysis for the present and for other SAFE-related trials. The results obtained after implementation the SAFE strategy (recurrence) reveal that the causes (infectious agents and dirtiness) and effects (illness) were not connected by illiterate people living under conditions of extreme poverty. So far, antibiotics, surgery and hygiene education are insufficient for the sustainability of trachoma elimination and highlight that hypothetic-deductive processes seem not operational after implementing the awareness campaigns. Trachoma recurrence detected in 2013 in sedentary populations of Kolofata receiving efficacious treatments against Chlamydia sp. suggest that the elimination goals will be delayed if strategies are limited to medical actions. Restricting efforts to repeated pharmacological and surgical interventions for people infected with susceptible bacteria could be understood as the hidden side of a passive attitude toward basic education actions.

Enzymatic treatment of specimens before DNA extraction directly influences molecular detection of infectious agents.

INTRODUCTION: Biological samples, pharmaceuticals or food contain proteins, lipids, polymers, ammoniums and macromolecules that alter the detection of infectious agents by DNA amplification techniques (PCR). Moreover the targeted DNA has to be released from the complex cell walls and the compact nucleoprotein matrixes and cleared from potential inhibitors. The goal of the present work was to assess the efficiency of enzymatic pretreatments on infectious agents to make DNA available for further extraction and amplification. METHODS: Staphylococcus epidermidis, Streptococcus mitis, Propionibacterium acnes, Escherichia coli, Pseudomonas aeruginosa, Candida albicans, Aspergillus niger and Fusarium solani were mixed with an internal control virus and treated with: 1) proteinase K; 2) lyticase and 3) lyticase followed by proteinase K. DNAs was manually extracted using the QIAmp DNA Mini kit or the MagNA Pure Compact automate. DNA extraction yields and the inhibitors were assessed with a phocid Herpesvirus. Bacterial detection was performed using TaqMan real-time PCR and yeasts and filamentous Fungi with HRM (real-time PCR followed by high-resolution melting analysis). RESULTS: Viral DNA was released, extracted and detected using manual and automatic methods without pre enzymatic treatments. Either the manual or the automatic DNA extraction systems did not meet the sensitivity expectations if enzymatic treatments were not performed before: lyticase for Fungi and Proteinase K for Bacteria. The addition of lyticase and proteinase K did not improve results. For Fungi the detection after lyticase was higher than for Proteinase K, for which melting analysis did not allow fungal specification. DISCUSSION: Columns and magnetic beads allowed collecting DNA and separate PCR inhibitors. Detection rates cannot be related to DNA-avidity of beads or to elution but to the lack of proteolysis.

Kinetics of expansion of human limbal epithelial progenitor cells in primary culture of explants without feeders.

The aims of this study were to determine whether human limbal explant cultures without feeder cells result in expansion of epithelial progenitors and to estimate the optimal expansion time for progenitor cells. Limbal explants from ten human corneas were cultured for 7, 9, 11, 14, 18, and 21 days. Limbal explants from two corneas were enzymatically dissociated or directly cultured for 14 days. Progenitor cells were characterized by their ability to form colonies, by immunocytochemistry, and by quantitative real-time polymerase chain reaction. Colonies were identified after 9, 11, 14, and 18 days of culture, but not after 21 days. The number of colonies per explant was significantly higher after 14 days than after 9 and 21 days. The mean percentage of seeded cells giving rise to clones was 4.03% after 14 days of culture and 0.36% for non-cultured dissociated limbal epithelial cells. The number of cells giving rise to clones per cornea significantly increased from an average of 2275 for non-cultured cells to 24266 for cells cultured for 14 days. Immunocytochemical analysis detected positive staining for cytokeratin (CK) 3, CK5/6/8/10/13/18, CK19, vimentin, p63, and p63α, in both cultures and clones. CK3 expression increased significantly with culture time. Transcript expression was observed for CK3, CK19, vimentin, and Delta N p63α at each culture time point, both in cultures and clones. The optimal culture time for limbal explants in cholera toxin-free Green medium without feeder cells was 14 days leading to the expansion of progenitors.

Donor tissue selection for anterior lamellar keratoplasty.

PURPOSE: To assess the influence of donor characteristics on the outcome of anterior lamellar keratoplasty (ALK) and to evaluate whether corneal donor tissue considered unsuitable for penetrating or posterior lamellar keratoplasty due to poor endothelial condition may be safely used for ALK. METHODS: Institutional setting. One hundred sixty-six consecutive ALK (166 patients) performed for optical indication in eyes with corneal diseases not involving the corneal endothelium. The main outcome measures were graft survival, early (0-12 months postoperatively) and late (after 12 months) annual endothelial cell loss, and postoperative logarithm of the minimum angle of resolution visual acuity. RESULTS: The average and extreme values of donor tissue characteristics were: donor age, 70.6 years (range, 28-88 years); organ culture time, 20.9 days (range, 12-35 days); graft endothelial cell density before transplantation, 2047 cells per millimeters (range, 100-3300 cells/mm2); and deswelling time, 2.0 days (range, 1-4 days). The average follow-up time of patients was 48.1 ± 24.8 months (mean ± SD). None of the donor characteristics significantly influenced graft survival or postoperative endothelial cell loss (early and late phase). Donor age >80 years was associated with lower postoperative visual acuity at all postoperative points in time (P < 0.05). At 3 years, the mean logarithm of the minimum angle of resolution visual acuity was 0.44 (20/55) for grafts from donors older than 80 years and 0.25 (20/35) for younger donors. This result was shown to be significant both in univariate and in multivariate analysis. CONCLUSIONS: Grafts from elderly donors should be discarded before ALK. Conversely, donor tissue with poor endothelial cell density (<2000 cells/mm2) is suitable for ALK.

Findings in detection of Herpesviridae by polymerase chain reaction and intraocular antibody production in a case series of anterior uveitis.

PURPOSE: To target the use of two biologic tests in the diagnostic of viral Herpesviridae anterior uveitis (AC) by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humor samples were collected from 42 patients suspected of having AU of infectious origin at presentation. The diagnosis of infectious uveitis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and/or detection of Herpesviridae genomes with PCR. The data were compared with data of 16 uveitis control samples used to calculate the specificity of the tests. RESULTS: Sixteen out of 42 eyes (38%) had a final diagnosis of anterior segment infectious uveitis of viral origin (Herpesviridae) confirmed by PCR positive result (5/14 eyes; 14 of the 16 eyes were tested by PCR) and/or specific intraocular antibody synthesis (14/16 eyes). CONCLUSIONS: While the GWC is progressively less often performed, these findings suggest that it still has a role in AU suspected of herpesvirus etiology.

Association of anti-herpes simplex virus IgG in tears and serum with clinical presentation in patients with presumed herpetic simplex keratitis.

PURPOSE: To assess the clinical relevance of tear anti-herpes simplex virus (HSV) antibody measurement for the diagnosis of herpes simplex keratitis. METHODS: Records of 364 patients clinically suspect of HSV-related keratitis who had tear anti-HSV IgG assessment (tear-quantified anti-HSV IgG/filtrated IgG ratio) in our institution between January 2000 and August 2008 were retrospectively analyzed. Patients were classified into 4 groups as follows: group 1, anti-HSV IgG negative in serum and tears; group 2, anti-HSV IgG negative in tears and positive in serum; group 3, anti-HSV IgG nonsignificantly positive in tears and positive in serum; and group 4, anti-HSV IgG significantly positive in serum and tears. Randomly selected patient charts from each group were reviewed for clinical data. RESULTS: The prevalence of anti-HSV IgG in blood increased with age from >70% before 20 years to 95% after 70 years. The prevalence of anti-HSV IgG in tears increased with age from 20% before 20 years to >50% after 70 years. The presence (either significant or not) of anti-HSV IgG in tears was significantly associated with decreased corneal sensation, presence of stromal opacities, and with neurotrophic keratitis. Logistic regression showed no significant association between age and clinical signs except for herpetic ulcers and herpetic necrotizing keratitis. CONCLUSIONS: Tear production of anti-HSV IgG increases with age, and it is associated with sequelae of herpes simplex keratitis. Conversely, it is poorly associated with clinical signs of acute herpes simplex keratitis.

Rapid detection and simultaneous molecular profile characterization of Acanthamoeba infections.

Diagnosis of Acanthamoeba by microscopic examination, culture, and polymerase chain reactions (PCRs) has several limitations (sensitivity, specificity, lack of detection of several strains, cost of testing for discrimination among strains). We developed a new high-resolution melting real-time PCR (HRM) to detect and characterize Acanthamoeba infections. HRM performances were evaluated with strains from the American Type Culture Collection (ATCC) and with 20 corneal scrapings. The DNA extracted from specimens were amplified, detected, and characterized in 1 run using 2 original primers diluted in a solution containing an intercalating dye. Detection and molecular characterization of Acanthamoeba infections could be achieved in less than 2.5 h with a dramatic reduction in cost of reactants (postamplification procedures and radioactive or fluorescent-labeled molecular probes were unnecessary). HRM detection limits were 0.1 cyst/µL or less (including genotypes T5 and T11), and its sensitivity and specificity were higher than other molecular tests. For the tested strains from the ATCC, the HRM drafted 4 different profiles: Type I (genotypes T2 and T4), Type II (T5 and T7), Type III (T8), and Type IV (T1, T3, T6, T9, T11, T12, and T13).