RESUMO
Recepteur d'origine nantais (RON) receptor tyrosine kinase and its ligand, serum macrophage-stimulating protein (MSP), play important roles in inflammation, cell growth, migration, and epithelial to mesenchymal transition during tumor development. The binding of mature MSPαß (disulfide-linked α- and ß-chains) to RON ectodomain modulates receptor dimerization, followed by autophosphorylation of tyrosines in the cytoplasmic receptor kinase domains. Receptor recognition is mediated by binding of MSP ß-chain (MSPß) to the RON Sema. Here we report the structure of RON Sema-PSI-IPT1 (SPI1) domains in complex with MSPß at 3.0 Å resolution. The MSPß serine protease-like ß-barrel uses the degenerate serine protease active site to recognize blades 2, 3, and 4 of the ß-propeller fold of RON Sema. Despite the sequence homology between RON and MET receptor tyrosine kinase and between MSP and hepatocyte growth factor, it is well established that there is no cross-reactivity between the two receptor-ligand systems. Comparison of the structure of RON SPI1 in complex with MSPß and that of MET receptor tyrosine kinase Sema-PSI in complex with hepatocyte growth factor ß-chain reveals the receptor-ligand selectivity determinants. Analytical ultracentrifugation studies of the SPI1-MSPß interaction confirm the formation of a 1:1 complex. SPI1 and MSPαß also associate primarily as a 1:1 complex with a binding affinity similar to that of SPI1-MSPß. In addition, the SPI1-MSPαß ultracentrifuge studies reveal a low abundance 2:2 complex with â¼ 10-fold lower binding affinity compared with the 1:1 species. These results support the hypothesis that the α-chain of MSPαß mediates RON dimerization.
Assuntos
Fator de Crescimento de Hepatócito/química , Fator de Crescimento de Hepatócito/metabolismo , Proteínas Proto-Oncogênicas/química , Proteínas Proto-Oncogênicas/metabolismo , Receptores Proteína Tirosina Quinases/química , Receptores Proteína Tirosina Quinases/metabolismo , Sequência de Aminoácidos , Cristalografia por Raios X , Humanos , Ligantes , Modelos Moleculares , Dados de Sequência Molecular , Ligação Proteica , Estrutura Terciária de Proteína , Proteínas Proto-Oncogênicas c-met/metabolismo , Alinhamento de Sequência , Soluções , Relação Estrutura-Atividade , UltracentrifugaçãoRESUMO
Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 µM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.
Assuntos
DNA/química , Multimerização Proteica/fisiologia , Elementos de Resposta/fisiologia , Transativadores/química , Proteínas Supressoras de Tumor/química , DNA/genética , DNA/metabolismo , Humanos , Mutação Puntual , Ligação Proteica , Estabilidade Proteica , Estrutura Quaternária de Proteína , Estrutura Secundária de Proteína , Estrutura Terciária de Proteína , Transativadores/genética , Transativadores/metabolismo , Fatores de Transcrição , Proteína Supressora de Tumor p53/química , Proteína Supressora de Tumor p53/genética , Proteína Supressora de Tumor p53/metabolismo , Proteínas Supressoras de Tumor/genética , Proteínas Supressoras de Tumor/metabolismoRESUMO
We show that changes in the nucleotide sequence alter the DNA conformation in the crystal structures of p63 DNA-binding domain (p63DBD) bound to its response element. The conformation of a 22-bp canonical response element containing an AT spacer between the two half-sites is unaltered compared with that containing a TA spacer, exhibiting superhelical trajectory. In contrast, a GC spacers abolishes the DNA superhelical trajectory and exhibits less bent DNA, suggesting that increased GC content accompanies increased double helix rigidity. A 19-bp DNA, representing an AT-rich response element with overlapping half-sites, maintains superhelical trajectory and reveals two interacting p63DBD dimers crossing one another at 120°. p63DBD binding assays to response elements of increasing length complement the structural studies. We propose that DNA deformation may affect promoter activity, that the ability of p63DBD to bind to superhelical DNA suggests that it is capable of binding to nucleosomes, and that overlapping response elements may provide a mechanism to distinguish between p63 and p53 promoters.
Assuntos
DNA Super-Helicoidal/química , Conformação de Ácido Nucleico , Multimerização Proteica , Elementos de Resposta , Fatores de Transcrição/química , Proteínas Supressoras de Tumor/química , Cristalografia por Raios X , DNA Super-Helicoidal/metabolismo , Humanos , Estrutura Quaternária de Proteína , Fatores de Transcrição/metabolismo , Proteínas Supressoras de Tumor/metabolismoRESUMO
High throughput genome wide associations studies (GWAS) are now identifying a large number of genome loci related to risk of common human disease. Each such locus presents a challenge in identifying the relevant underlying mechanism. Here we report the experimental characterization of a proposed causal single nucleotide polymorphism (SNP) in a locus related to risk of Crohn's disease and ulcerative colitis. The SNP lies in the MST1 gene encoding Macrophage Stimulating Protein (MSP), and results in an R689C amino acid substitution within the ß-chain of MSP (MSPß). MSP binding to the RON receptor tyrosine kinase activates signaling pathways involved in the inflammatory response. We have purified wild-type and mutant MSPß proteins and compared biochemical and biophysical properties that might impact the MSP/RON signaling pathway. Surface plasmon resonance (SPR) binding studies showed that MSPß R689C affinity to RON is approximately 10-fold lower than that of the wild-type MSPß and differential scanning fluorimetry (DSF) showed that the thermal stability of the mutant MSPß was slightly lower than that of wild-type MSPß, by 1.6 K. The substitution was found not to impair the specific Arg483-Val484 peptide bond cleavage by matriptase-1, required for MSP activation, and mass spectrometry of tryptic fragments of the mutated protein showed that the free thiol introduced by the R689C mutation did not form an aberrant disulfide bond. Together, the studies indicate that the missense SNP impairs MSP function by reducing its affinity to RON and perhaps through a secondary effect on in vivo concentration arising from reduced thermodynamic stability, resulting in down-regulation of the MSP/RON signaling pathway.
Assuntos
Doença de Crohn/genética , Fator de Crescimento de Hepatócito/genética , Polimorfismo de Nucleotídeo Único , Proteínas Proto-Oncogênicas/genética , Receptores Proteína Tirosina Quinases/metabolismo , Substituição de Aminoácidos , Colite Ulcerativa , Regulação para Baixo , Fator de Crescimento de Hepatócito/metabolismo , Humanos , Proteínas Mutantes/metabolismo , Ligação Proteica/genética , Estabilidade Proteica , Proteínas Proto-Oncogênicas/metabolismo , Transdução de Sinais/genéticaRESUMO
Plasminogen activator inhibitor type 1 (PAI-1) is a serine protease inhibitor (serpin) in which the reactive center loop (RCL) spontaneously inserts into a central beta-sheet, beta-sheet A, resulting in inactive inhibitor. Available x-ray crystallographic studies of PAI-1 in an active conformation relied on the use of stabilizing mutations. Recently it has become evident that these structural models do not adequately explain the behavior of wild-type PAI-1 (wtPAI-1) in solution. To probe the structure of native wtPAI-1, we used three conformationally sensitive ligands: the physiologic cofactor, vitronectin; a monoclonal antibody, 33B8, that binds preferentially to RCL-inserted forms of PAI-1; and RCL-mimicking peptides that insert into beta-sheet A. From patterns of interaction with wtPAI-1 and the stable mutant, 14-1B, we propose a model of the native conformation of wtPAI-1 in which the bottom of the central sheet is closed, whereas the top of the beta-sheet A is open to allow partial insertion of the RCL. Because the incorporation of RCL-mimicking peptides into wtPAI-1 is accelerated by vitronectin, we further propose that vitronectin alters the conformation of the RCL to allow increased accessibility to beta-sheet A, yielding a structural hypothesis that is contradictory to the current structural model of PAI-1 in solution and its interaction with vitronectin.
Assuntos
Inibidor 1 de Ativador de Plasminogênio/química , Anticorpos Monoclonais/química , Humanos , Cinética , Ligantes , Modelos Biológicos , Conformação Molecular , Mutação , Peptídeos/química , Inibidor 1 de Ativador de Plasminogênio/metabolismo , Conformação Proteica , Estrutura Secundária de Proteína , Estrutura Terciária de Proteína , Ressonância de Plasmônio de Superfície , Fatores de Tempo , Vitronectina/químicaRESUMO
The serine proteinase inhibitor, plasminogen activator inhibitor type-1 (PAI-1), binds to the adhesion protein vitronectin with high affinity at a site that is located directly adjacent to the vitronectin RGD integrin binding sequence. The binding of PAI-1 to vitronectin sterically blocks integrin access to this site and completely inhibits the binding of purified integrins to vitronectin; however, its inhibition of endothelial and smooth muscle cell adhesion to vitronectin is at most 50-75%. Because PAI-1 binds vitronectin with approximately 10-100-fold higher affinity than purified integrins, we have analyzed the mechanism whereby these cells are able to overcome this obstacle. Our studies exclude proteolytic removal of PAI-1 from vitronectin as the mechanism, and show instead that cell adhesion in the presence of PAI-1 is dependent on integrin-cytoskeleton engagement. Disrupting endothelial or smooth muscle cell actin polymerization and/or focal adhesion assembly reduces cell adhesion to vitronectin in the presence of PAI-1 to levels similar to that observed for the binding of purified integrins to vitronectin. Furthermore, endothelial cell, but not smooth muscle cell adhesion to vitronectin in the presence of PAI-1 requires both polymerized microtubules and actin, further demonstrating the importance of the cytoskeleton for integrin-mediated adhesion. Finally, we show that cell adhesion in the presence of PAI-1 leads to colocalization of PAI-1 with the integrins alphavbeta3 and alphavbeta5 at the cell-matrix interface.
Assuntos
Citoesqueleto/metabolismo , Células Endoteliais/metabolismo , Integrina alfaVbeta3/metabolismo , Integrinas/metabolismo , Miócitos de Músculo Liso/metabolismo , Receptores de Vitronectina/metabolismo , Vitronectina/metabolismo , Actinas/metabolismo , Animais , Adesão Celular/fisiologia , Células Endoteliais/citologia , Humanos , Miócitos de Músculo Liso/citologia , Inibidor 1 de Ativador de Plasminogênio/metabolismo , Ligação ProteicaRESUMO
The inactivation of plasminogen activator inhibitor-1 (PAI-1) by the small molecule PAI-1 inhibitor PAI-039 (tiplaxtinin) has been investigated using enzymatic analysis, direct binding studies, site-directed mutagenesis, and molecular modeling studies. Previously PAI-039 has been shown to exhibit in vivo activity in various animal models, but the mechanism of inhibition is unknown. PAI-039 bound specifically to the active conformation of PAI-1 and exhibited reversible inactivation of PAI-1 in vitro. SDS-PAGE indicated that PAI-039 inactivated PAI-1 predominantly through induction of PAI-1 substrate behavior. Preincubation of PAI-1 with vitronectin, but not bovine serum albumin, blocked PAI-039 activity while analysis of the reciprocal experiment demonstrated that preincubation of PAI-1 with PAI-039 blocked the binding of PAI-1 to vitronectin. Together, these data suggest that the site of interaction of the drug on PAI-1 is inaccessible when PAI-1 is bound to vitronectin and may overlap with the PAI-1 vitronectin binding domain. This was confirmed by site-directed mutagenesis and molecular modeling studies, which suggest that the binding epitope for PAI-039 is localized adjacent to the previously identified interaction site for vitronectin. Thus, these studies provide a detailed characterization of the mechanism of inhibition of PAI-1 by PAI-039 against free, but not vitronectin-bound PAI-1, suggesting for the first time a novel pool of PAI-1 exists that is vulnerable to inhibition by inactivators that bind at the vitronectin binding site.
Assuntos
Inibidor 1 de Ativador de Plasminogênio/química , Sítios de Ligação , Relação Dose-Resposta a Droga , Glicosilação , Humanos , Ácidos Indolacéticos/farmacologia , Concentração Inibidora 50 , Cinética , Modelos Moleculares , Mutagênese Sítio-Dirigida , Inibidor 1 de Ativador de Plasminogênio/metabolismo , Ligação Proteica , Estrutura Terciária de Proteína , Ressonância de Plasmônio de Superfície , Fatores de Tempo , Vitronectina/químicaRESUMO
Apolipoprotein E (apoE) associates with lipoproteins and mediates their interaction with members of the LDL receptor family. ApoE exists as three common isoforms that have important distinct functional and biological properties. Two apoE isoforms, apoE3 and apoE4, are recognized by the LDL receptor, whereas apoE2 binds poorly to this receptor and is associated with type III hyperlipidemia. In addition, the apoE4 isoform is associated with the common late-onset familial and sporadic forms of Alzheimer's disease. Although the interaction of apoE with the LDL receptor is well characterized, the specificity of other members of this receptor family for apoE is poorly understood. In the current investigation, we have characterized the binding of apoE to the VLDL receptor and the LDL receptor-related protein (LRP). Our results indicate that like the LDL receptor, LRP prefers lipid-bound forms of apoE, but in contrast to the LDL receptor, both LRP and the VLDL receptor recognize all apoE isoforms. Interestingly, the VLDL receptor does not require the association of apoE with lipid for optimal recognition and avidly binds lipid-free apoE. It is likely that this receptor-dependent specificity for various apoE isoforms and for lipid-free versus lipid-bound forms of apoE is physiologically significant and is connected to distinct functions for these receptors.
Assuntos
Apolipoproteínas E/metabolismo , Proteína-1 Relacionada a Receptor de Lipoproteína de Baixa Densidade/metabolismo , Receptores de LDL/metabolismo , Apolipoproteína E3 , Apolipoproteína E4 , Sítios de Ligação , Linhagem Celular , Clonagem Molecular , Humanos , Metabolismo dos Lipídeos , Fragmentos de Peptídeos/metabolismo , Mapeamento de Interação de Proteínas , Ressonância de Plasmônio de SuperfícieRESUMO
The mechanism for the conversion of plasminogen activator inhibitor-1 (PAI-1) from the active to the latent conformation is not well understood. Recently, a monoclonal antibody, 33B8, was described that rapidly converts PAI-1 to the latent conformation (Verhamme, I., Kvassman, J. O., Day, D., Debrock, S., Vleugels, N., Declerck, P. J., and Shore, J. D. (1999) J. Biol. Chem. 274, 17511-17517). In an attempt to understand this interaction, and more broadly to understand the mechanism of the natural transition of PAI-1 to the latent conformation, we have used random mutagenesis to identify the 33B8 epitope in PAI-1. This site involves at least 8 amino acids scattered over more than two-thirds of the linear sequence that form a compact epitope on the PAI-1 three-dimensional structure. Surface plasmon resonance studies indicate a high affinity interaction between latent PAI-1 and 33B8 that is approximately 100-fold higher than comparable binding to active PAI-1. Structural modeling results together with surface plasmon resonance analysis of parental and site-directed PAI-1 mutants with disrupted 33B8 binding suggest the existence of a specific PAI-1 intermediate structure that is stabilized by 33B8 binding. These analyses strongly suggest that this intermediate form of PAI-1 has a partial insertion of the reactive center loop into beta-sheet A, and together, these data have significant implications for the general serpin mechanism of proteinase inhibition.
Assuntos
Inibidor 1 de Ativador de Plasminogênio/química , Serpinas/fisiologia , Animais , Anticorpos Monoclonais/imunologia , Mapeamento de Epitopos , Camundongos , Modelos Moleculares , Mutagênese Sítio-Dirigida , Inibidor 1 de Ativador de Plasminogênio/imunologia , Conformação Proteica , Análise de Sequência de DNA , Ressonância de Plasmônio de SuperfícieRESUMO
Plasminogen activator inhibitor-1 is the main physiological regulator of tissue-type plasminogen activator in normal plasma. In addition to its critical function in fibrinolysis, plasminogen activator inhibitor-1 has been implicated in roles in other physiological and pathophysiological processes. To investigate structure-function aspects of mouse plasminogen activator inhibitor-1, the recombinant protein was expressed in Escherichia coli and purified. Five variant recombinant murine proteins (R76E, Q123K, R346A, R101A, and Q123K/R101A) were also generated using site-directed mutagenesis. The variant (R346A) was found to be defective in its inhibitory activity against tissue plasminogen activator relative to its wild-type counterpart. Enzyme-linked immunosorbent assay and surface plasmon resonance experiments demonstrated reduced vitronectin-binding affinity of the (Q123K) variant (K(D) = 1800 nm) relative to the wild-type protein (K(D) = 5.4 nm). Kinetic analyses indicated that the (Q123K) variant had a slower association (k(on) = 2.92 x 10(4) m(-1) s(-1)) to, and a faster dissociation from, vitronectin (k(off) = 5.3 x 10(-2) s(-1)), (wild-type k(on) = 1.03 x 10(6) m(-1) s(-1) and k(off) = 5.27 x 10(-3) s(-1)). The Q123K/R101A variant demonstrated an even lower vitronectin-binding ability. Low density lipoprotein receptor-related protein binding was decreased for the (R76E) variant. It was also demonstrated that the plasminogen activator inhibitor-1/vitronectin complex decreased the interaction of plasminogen activator inhibitor-1 with low density lipoprotein receptor-related protein. These results indicate that the complex interactions traditionally associated with different plasminogen activator inhibitor-1 functions apply to the murine system, thus showing a commonality of subtle functions among different species and evolutionary conservation of this protein. Further, this study provides additional evidence that the human hemostasis system can be studied effectively in the mouse, which is a great asset for investigations with gene-altered mice.
Assuntos
Inibidor 1 de Ativador de Plasminogênio/química , Animais , Western Blotting , Sequência Conservada , Relação Dose-Resposta a Droga , Eletroforese em Gel de Poliacrilamida , Ensaio de Imunoadsorção Enzimática , Escherichia coli/metabolismo , Vetores Genéticos , Humanos , Cinética , Proteína-1 Relacionada a Receptor de Lipoproteína de Baixa Densidade/metabolismo , Camundongos , Camundongos Transgênicos , Mutagênese Sítio-Dirigida , Ligação Proteica , Estrutura Terciária de Proteína , Proteínas Recombinantes/química , Relação Estrutura-Atividade , Ressonância de Plasmônio de Superfície , Temperatura , Fatores de Tempo , Distribuição Tecidual , Ativador de Plasminogênio Tecidual/metabolismo , Vitronectina/metabolismoRESUMO
The low density lipoprotein receptor-related protein (LRP) functions in the catabolism of numerous ligands including proteinases, proteinase inhibitor complexes, and lipoproteins. In the current study we provide evidence indicating an expanded role for LRP in modulating cellular signaling events. Our results show that platelet-derived growth factor (PDGF) BB induces a transient tyrosine phosphorylation of the LRP cytoplasmic domain in a process dependent on PDGF receptor activation and c-Src family kinase activity. Other growth factors, including basic fibroblast growth factor, epidermal growth factor, insulin-like growth factor-1, were unable to mediate tyrosine phosphorylation of LRP. The basis for this selectivity may result from the ability of LRP to bind PDGFBB, because surface plasmon resonance experiments demonstrated that only PDGF, and not basic fibroblast growth factor, epidermal growth factor, or insulin-like growth factor-1, bound to purified LRP immobilized on a sensor chip. The use of LRP mini-receptor mutants as well as in vitro phosphorylation studies demonstrated that the tyrosine located within the second NPXY motif found in the LRP cytoplasmic domain is the primary site of tyrosine phosphorylation by Src and Src family kinases. Co-immunoprecipitation experiments revealed that PDGF-mediated tyrosine phosphorylation of LRPs cytoplasmic domain results in increased association of the adaptor protein Shc with LRP and that Shc recognizes the second NPXY motif within LRPs cytoplasmic domain. In the accompanying paper, Boucher et al. (Boucher, P., Liu, P. V., Gotthardt, M., Hiesberger, T., Anderson, R. G. W., and Herz, J. (2002) J. Biol. Chem. 275, 15507-15513) reveal that LRP is found in caveolae along with the PDGF receptor. Together, these studies suggest that LRP functions as a co-receptor that modulates signal transduction pathways initiated by the PDGF receptor.
Assuntos
Proteínas Relacionadas a Receptor de LDL/metabolismo , Fosfotirosina/metabolismo , Fator de Crescimento Derivado de Plaquetas/farmacologia , Receptores do Fator de Crescimento Derivado de Plaquetas/fisiologia , Sequência de Aminoácidos , Animais , Anticorpos Monoclonais/farmacologia , Becaplermina , Ligação Competitiva , Células COS , Proteína Tirosina Quinase CSK , Chlorocebus aethiops , Fator de Crescimento Epidérmico/farmacologia , Fator 2 de Crescimento de Fibroblastos/farmacologia , Humanos , Fator de Crescimento Insulin-Like I/farmacologia , Cinética , Proteínas Relacionadas a Receptor de LDL/química , Proteínas Relacionadas a Receptor de LDL/genética , Fosfatidilinositol 3-Quinases/metabolismo , Fosforilação , Fator de Crescimento Derivado de Plaquetas/farmacocinética , Subunidades Proteicas , Proteínas Tirosina Quinases/metabolismo , Proteínas Proto-Oncogênicas c-sis , Coelhos , Proteínas Recombinantes/química , Proteínas Recombinantes/metabolismo , Ressonância de Plasmônio de Superfície , Transfecção , Quinases da Família srcRESUMO
Neutrophil elastase and cathepsin G are abundant intracellular neutrophil proteinases that have an important role in destroying ingested particles. However, when neutrophils degranulate, these proteinases are released and can cause irreparable damage by degrading host connective tissue proteins. Despite abundant endogenous inhibitors, these proteinases are protected from inhibition because of their ability to bind to anionic surfaces. Plasminogen activator inhibitor type-1 (PAI-1), which is not an inhibitor of these proteinases, possesses properties that could make it an effective inhibitor of neutrophil proteinases if its specificity could be redirected. PAI-1 efficiently inhibits surface-sequestered proteinases, and it efficiently mediates rapid cellular clearance of PAI-1-proteinase complexes. Therefore, we examined whether PAI-1 could be engineered to inhibit and clear neutrophil elastase and cathepsin G. By introducing specific mutations in the reactive center loop of wild-type PAI-1, we generated PAI-1 mutants that are effective inhibitors of both proteinases. Kinetic analysis shows that the inhibition of neutrophil proteinases by these PAI-1 mutants is not affected by the sequestration of neutrophil elastase and cathepsin G onto surfaces. In addition, complexes of these proteinases and PAI-1 mutants are endocytosed and degraded by lung epithelial cells more efficiently than either the neutrophil proteinases alone or in complex with their physiological inhibitors, alpha1-proteinase inhibitor and alpha1-antichymotrypsin. Finally, the PAI-1 mutants were more effective in reducing the neutrophil elastase and cathepsin G activities in an in vivo model of lung inflammation than were their physiological inhibitors.