IgG4-Related Disease: A Clinical Case Series From a Tertiary Care Center in India.

AIM: Immunoglobulin G4-related disease (IgG4-RD) is often an unrecognized, rare fibroinflammatory condition that can involve various organ systems. This study aimed to identify the different clinical patterns of this disease in a single center in North India. METHODS: Patients were diagnosed on the basis of published diagnostic criteria for IgG4-RD. Patients' presenting complaints; epidemiologic profiles; and laboratory, radiologic, and histologic findings along with the treatment and outcomes were collected and analyzed. RESULTS: In total, 70 patients were diagnosed with the disease. The female-to-male ratio was 0.94:1, and it increased with multiorgan involvement. The mean age of patients was 41.4 years, and the majority of the patients (65.7%) were younger than 50 years. Patients were diagnosed as possible (38.57%), probable (32.85%), and definite (28.57%) IgG4-RD. The incidence of the involvement of orbital and periorbital tissues was the highest (52.9%); however, 13% of the patients had multiple organ involvement. Patients with involvement of the retroperitoneal tissues and the lymph nodes were 8.5% and 5.7%, respectively. Increased serum IgG4 levels were found in 74.3% of the patients with single-organ involvement, whereas all patients with multiorgan involvement had increased IgG4 levels. The majority of patients (94.3%) required immunosuppressive medications along with corticosteroids. Azathioprine was the most commonly used (72.8%) immunosuppressive medication. Rituximab was used in 17.1% of the patients, of whom only one had multisystem involvement. CONCLUSIONS: This study depicts the most common patterns of organ involvement, along with the epidemiologic, laboratory, histologic, and radiologic data and response to treatment, in IgG4-RD, with a definite ophthalmology referral bias.

Antioxidants and vision health: facts and fiction.

A number of nutritional supplements containing antioxidants are advertised for better vision health. Do they benefit the average consumer? The literature was examined for the effectiveness of antioxidants for human eye health, and for the intricacies in collection of such evidence. The following diseases were considered: cataract, glaucoma, age-related macular degeneration (AMD), retinopathy, retinitis pigmentosa, eye infections, and uveitis. The literature indicates that antioxidant supplements plus lutein have a reasonable probability of retarding AMD. For glaucoma, such supplements were ineffectual in some studies but useful in others. In some studies, antioxidant rich fruits and vegetables were also useful for protection against glaucoma. For diabetic retinopathy, antioxidant supplements may have a small benefit, if any, but only as an adjunct to glycemic control. In very high-risk premature retinopathy and retinitis pigmentosa, antioxidant supplements may be beneficial but those with excess Vitamin E should be avoided. For cataract, there is no evidence for an advantage of such nutritional supplements. However, lubricant drops containing N-acetylcarnosine may be helpful in initial stages of the disease. For eye infections and other causes of uveitis, antioxidants have not been found useful. We recommend that a diet high in antioxidant rich foods should be developed as a habit from an early age. However, when initial signs of vision health deterioration are observed, the appropriate nutritional supplement products may be recommended but only to augment the primary medical treatments.

Isolated bilateral uveitis in child with hypereosinophilic syndrome.

The ocular involvement has rarely been described in hypereosinophilic syndrome (HES). We report an 8-year-old girl with HES and isolated bilateral uveitis as end-organ damage. Almost 20 months after detection of persistent asymptomatic eosinophilia, she developed complete loss of vision in right eye due to retinal detachment and decreased vision in left eye. We treated this organ-threatening condition with prednisolone and imatinib mesylate, although she was negative for FIP1L1-PDGRFA fusion gene. The vision in her left eye returned to normal. At present, the child is on alternate-day low-dose prednisolone and daily imatinib. Early recognition and aggressive treatment is essential in HES with ocular involvement to save vision. Imatinib is a useful adjuvant drug even in PDGRFA/FIP1L1-negative HES.

Thapsigargin decreases the Na(+)- Ca(2+) exchanger mediated Ca(2+) entry in pig coronary artery smooth muscle.

Na(+)- Ca(2+) exchanger (NCX) has been proposed to play a role in refilling the sarco/endoplasmic reticulum (SER) Ca(2+) pool along with the SER Ca(2+) pump (SERCA). Here, SERCA inhibitor thapsigargin was used to determine the effects of SER Ca(2+) depletion on NCX-SERCA interactions in smooth muscle cells cultured from pig coronary artery. The cells were Na(+)-loaded and then placed in either a Na(+)-containing or in a Na(+)-substituted solution. Subsequently, the difference in Ca(2+) entry between the two groups was examined and defined as the NCX mediated Ca(2+) entry. The NCX mediated Ca(2+) entry in the smooth muscle cells was monitored using two methods: Ca(2+)sensitive fluorescence dye Fluo-4 and radioactive Ca(2+). Ca(2+)-entry was greater in the Na(+)-substituted cells than in the Na(+)-containing cells when measured by either method. This difference was established to be NCX-mediated as it was sensitive to the NCX inhibitors. Thapsigargin diminished the NCX mediated Ca(2+) entry as determined by either method. Immunofluorescence confocal microscopy was used to determine the co-localization of NCX1 and subsarcolemmal SERCA2 in the cells incubated in the Na(+)-substituted solution with or without thapsigargin. SER Ca(2+) depletion with thapsigargin increased the co-localization between NCX1 and the subsarcolemmal SERCA2. Thus, inhibition of SERCA2 leads to blockade of constant Ca(2+) entry through NCX1 and also increases proximity between NCX1 and SERCA2. This blockade of Ca(2+) entry may protect the cells against Ca(2+)-overload during ischemia-reperfusion when SERCA2 is known to be damaged.

Sodium-calcium exchanger and lipid rafts in pig coronary artery smooth muscle.

Pig coronary artery smooth muscle expresses, among many other proteins, Na+-Ca²+-exchanger NCX1 and sarcoplasmic reticulum Ca²+ pump SERCA2. NCX1 has been proposed to play a role in refilling the sarcoplasmic reticulum Ca²+ pool suggesting a functional linkage between the two proteins. We hypothesized that this functional linkage may require close apposition of SERCA2 and NCX1 involving regions of plasma membrane like lipid rafts. Lipid rafts are specialized membrane microdomains that appear as platforms to co-localize proteins. To determine the distribution of NCX1, SERCA2 and lipid rafts, we isolated microsomes from the smooth muscle tissue, treated them with non-ionic detergent and obtained fractions of different densities by sucrose density gradient centrifugal flotation. We examined the distribution of NCX1; SERCA2; non-lipid raft plasma membrane marker transferrin receptor protein; lipid raft markers caveolin-1, flotillin-2, prion protein, GM1-gangliosides and cholesterol; and cytoskeletal markers clathrin, actin and myosin. Distribution of markers identified two subsets of lipid rafts that differ in their components. One subset is rich in caveolin-1 and flotillin-2 and the other in GM1-gangliosides, prion protein and cholesterol. NCX1 distribution correlated strongly with SERCA2, caveolin-1 and flotillin-2, less strongly with the other membrane markers and negatively with the cytoskeletal markers. These experiments were repeated with a non-detergent method of treating microsomes with sonication at high pH and similar results were obtained. These observations are consistent with the observed functional linkage between NCX1 and SERCA2 and suggest a role for NCX1 in supplying Ca²+ for refilling the sarcoplasmic reticulum.

Epidemiology, clinical profile, management, and outcome of COVID-19-associated rhino-orbital-cerebral mucormycosis in 2826 patients in India - Collaborative OPAI-IJO Study on Mucormycosis in COVID-19 (COSMIC), Report 1.

Purpose: COVID-19-associated rhino-orbital-cerebral mucormycosis (ROCM) has reached epidemic proportion during India's second wave of COVID-19 pandemic, with several risk factors being implicated in its pathogenesis. This study aimed to determine the patient demographics, risk factors including comorbidities, and medications used to treat COVID-19, presenting symptoms and signs, and the outcome of management. Methods: This was a retrospective, observational study of patients with COVID-19-associated ROCM managed or co-managed by ophthalmologists in India from January 1, 2020 to May 26, 2021. Results: Of the 2826 patients, the states of Gujarat (22%) and Maharashtra (21%) reported the highest number of ROCM. The mean age of patients was 51.9 years with a male preponderance (71%). While 57% of the patients needed oxygen support for COVID-19 infection, 87% of the patients were treated with corticosteroids, (21% for > 10 days). Diabetes mellitus (DM) was present in 78% of all patients. Most of the cases showed onset of symptoms of ROCM between day 10 and day 15 from the diagnosis of COVID-19, 56% developed within 14 days after COVID-19 diagnosis, while 44% had delayed onset beyond 14 days. Orbit was involved in 72% of patients, with stage 3c forming the bulk (27%). Overall treatment included intravenous amphotericin B in 73%, functional endoscopic sinus surgery (FESS)/paranasal sinus (PNS) debridement in 56%, orbital exenteration in 15%, and both FESS/PNS debridement and orbital exenteration in 17%. Intraorbital injection of amphotericin B was administered in 22%. At final follow-up, mortality was 14%. Disease stage >3b had poorer prognosis. Paranasal sinus debridement and orbital exenteration reduced the mortality rate from 52% to 39% in patients with stage 4 disease with intracranial extension (p < 0.05). Conclusion: : Corticosteroids and DM are the most important predisposing factors in the development of COVID-19-associated ROCM. COVID-19 patients must be followed up beyond recovery. Awareness of red flag symptoms and signs, high index of clinical suspicion, prompt diagnosis, and early initiation of treatment with amphotericin B, aggressive surgical debridement of the PNS, and orbital exenteration, where indicated, are essential for successful outcome.

Proximity of Na+ -Ca2+ -exchanger and sarco/endoplasmic reticulum Ca2+ pump in pig coronary artery smooth muscle: fluorescence microscopy.

Pig coronary artery smooth muscle expresses the Na(+)-Ca(2+)-exchanger NCX1 and the sarco/endoplasmic reticulum (SER) Ca(2+) pump SERCA2. NCX has been proposed to play a role in refilling the SER Ca(2+) pool. Caveolae may also direct Ca(2+) traffic during cell signaling. Here, we use immunofluorescence microscopy to determine if there is proximity between NCX1, SERCA2, and the caveolar protein caveolin-1. Stacks of images of cell surface domains were analyzed. Image stacks for one protein were analyzed for overlap with another protein, with and without randomization or image shifting. Within the resolution of light microscopy, there is significant overlap in the distributions of NCX1, SERCA2, and caveolin-1 but the three proteins are not always co-localized. The proximity between NCX1, SERCA2 is consistent with the assertion that NCX may supply Ca(2+) for refilling the SER but this relationship is only partial. Similarly, caveolae may direct traffic in some Ca(2+) signaling pathways but not others.

Functional linkage as a direction for studies in oxidative stress: alpha-adrenergic receptors.

The alpha-adrenergic receptors (adrenoceptors) are activated by the endogenous agonists epinephrine and norepinephrine. They are G protein-coupled receptors that may be broadly classified into alpha1 (subclasses alpha1A, alpha1B, alpha1D) and alpha2 (subclasses alpha2A, alpha2B, alpha2C). The alpha1-adrenoceptors act by binding to G(alpha)q subunits of the G proteins, causing activation of phospholipase C (PLC). PLC converts phosphatidylinositol 4,5-bisphosphate into inositol trisphosphate (IP3) and diacylglycerol (DAG), which have downstream effects on cytosolic Ca2+ concentration. The alpha2-adrenoceptors bind to G(alpha)i thus inhibiting adenylyl cyclase and decreasing cAMP levels. DAG alters protein kinase C activity and cAMP activates protein kinase A. The downstream pathways of the two receptors may also interact. Activation of alpha1- and alpha2-adrenoceptors in vascular smooth muscle results in vasoconstriction. However, the densities of individual receptor subclasses vary between vessel beds or between vessels of various sizes within the same bed. In vasculature, the densities of adrenoceptor subclasses differ between conduit arteries and arterioles. These differences, along with differences in coupling mechanisms, allow for fine regulation of arterial blood flow. This diversity is enhanced by interactions resulting from homo- and heterodimer formation of the receptors, metabolic pathways, and kinases. Reactive oxygen species generated in pathologies may alter alpha1- and alpha2-adrenoceptor cascades, change vascular contractility, or cause remodeling of blood vessels. This review emphasizes the need for understanding the functional linkage between alpha-adrenoceptor subtypes, coupling, cross talk, and oxidative stress in cardiovascular pathologies.

Correction of preexisting astigmatism by penetrating arcuate keratotomy in femtosecond laser-assisted cataract surgery.

Purpose: To evaluate the astigmatism correcting effect of penetrating arcuate keratotomy (AK) done during femtosecond laser-assisted cataract surgery (FLACS). Methods: In this nonrandomized prospective study, 80 eyes of 70 patients were studied. The study included patients who underwent combined FLACS and AK, with corneal astigmatism ranging from 0.4 to 1.5 diopters (D). Femtosecond laser-assisted penetrating arcuate keratotomies were created at 8 mm optical zone at 80% depth and were centered at the limbus. Keratometric astigmatism was measured prior to and 3 months post-surgery. Vector analysis was performed using Power vector analysis method. Results: The mean preoperative keratometric astigmatism without accounting for axis was 0.85 ± 0.27 D, which reduced significantly to 0.47 ± 0.27 D at 3-month follow-up. The mean astigmatism correction attained without accounting for axis was 0.38 ± 0.32 D. The vector corrected mean preoperative astigmatism was 0.85 ± 0.27 D which reduced significantly to 0.50 ± 0.31 D postoperatively (P < 0.001, 95% CI). Vector corrected mean astigmatism correction attained was 0.35 ± 0.38 D. There were no significant intraoperative or postoperative complications. Conclusion: Preexisting astigmatism can be tackled effectively with penetrating AK during FLACS although under correction is observed with present nomograms. Further refinements may achieve better correction.

All India Ophthalmological Society - Oculoplastics Association of India consensus statement on preferred practices in oculoplasty and lacrimal surgery during the COVID-19 pandemic.

Oculoplastic surgeries encompass both emergency surgeries for traumatic conditions and infectious disorders as well as elective aesthetic procedures. The COVID-19 pandemic has brought about a drastic change in this practice. Given the highly infectious nature of the disease as well as the global scarcity of medical resources; it is only prudent to treat only emergent conditions during the pandemic as we incorporate evidence-based screening and protective measures into our practices. This manuscript is a compilation of evidence-based guidelines for surgical procedures that oculoplastic surgeons can employ during the COVID-19 pandemic. These guidelines also serve as the basic framework upon which further recommendations may be based on in the future, as elective surgeries start being performed on a regular basis.

Sodium-calcium exchange mediated contraction in left anterior descending and left ventricular branch arteries.

We tested the hypothesis that the de-endothelialized artery rings from the left anterior descending (LAD) coronary artery and its left ventricular branch (LVB) differ in their contractile responses to Na(+)-Ca(2+)-exchanger (NCX) mediated Ca(2+)-entry, muscarinic receptor activation with carbachol, and sarco/endoplasmic reticulum Ca(2+) pump (SERCA) inhibition with thapsigargin. In LVB, the force of contraction (in N/g tissue) produced by the NCX mediated Ca(2+)-entry (17.5 +/- 1.4) and carbachol (18 +/- 1.5) was only slightly smaller than that due to membrane depolarization with KCl (24.0 +/- 1.0). In contrast, in LAD the force of contraction produced with NCX (8.7 +/- 0.7) and carbachol (6.1 +/- 1.1) was much smaller than with KCl (15.7 +/- 0.7). Thapsigargin also contracted LVB with greater force than LAD. When isolated microsomes were used, the binding to the muscarinic receptor antagonist quinuclidinyl benzilate was greater in LVB than in LAD. Microsomes were also used for Western blots. The intensities of signals for both SERCA and NCX were greater in LVB than in LAD. These biochemical observations were consistent with the contractile experiments. Thus, it appears that the differences between LAD and the resistance arteries may begin as early as LVB.

Functional linkage of Na+-Ca2+-exchanger to sarco/endoplasmic reticulum Ca2+ pump in coronary artery: comparison of smooth muscle and endothelial cells.

An increase in cytosolic Ca(2+) concentration in coronary artery smooth muscle causes a contraction but in endothelium it causes relaxation. Na(+)-Ca(2+)-exchanger (NCX) may play a role in Ca(2+) dynamics in both the cell types. Here, the NCX-mediated (45)Ca(2+) uptake was compared in Na(+)-loaded pig coronary artery smooth muscle and endothelial cells. In both the cell types, this uptake was inhibited by KB-R7943, SEA 0400 and by monensin, but not by cariporide. Prior loading of the cells with the Ca(2+) chelator BAPTA increased the NCX-mediated (45)Ca(2+) uptake in smooth muscle but not in endothelial cells. In the presence or absence of BAPTA loading, the Na(+)-mediated (45)Ca(2+) uptake was greater in endothelial than in smooth muscle cells. In smooth muscle cells without BAPTA loading, thapsigargin diminished the NCX-mediated (45)Ca(2+) entry. This effect was not observed in endothelial cells or in either cell type after BAPTA loading. The results in the smooth muscle cells are consistent with a limited diffusional space model in which the NCX-mediated (45)Ca(2+) uptake was enhanced by chelation of cytosolic Ca(2+) or by its sequestration by the sarco/endoplasmic reticulum Ca(2+) pump (SERCA). They suggest a functional linkage between NCX and SERCA in the smooth muscle but not in the endothelial cells. The concept of a linkage between NCX and SERCA in smooth muscle was also confirmed by similar distribution of NCX and SERCA2 proteins when detergent-treated microsomes were fractionated by flotation on sucrose density gradients. Thus, the coronary artery smooth muscle and endothelial cells differ not only in the relative activities of NCX but also in its functional linkage to SERCA.

Characterization of SERCA2b Ca2+-Mg2+ ATPase mRNA decay by nuclear proteins.

Gene expression is controlled at several levels including mRNA decay. Sarco/endoplasmic reticulum Ca2+-Mg2+-ATPase isoform 2b (SERCA2b) is central to Ca2+ signalling and homeostasis in several tissues. SERCA2b mRNA decay involves interactions between cis-acting elements in its 3'-region and trans-acting nuclear protein factors. In the presence of the protein factors, the synthetic capped and polyadenylated RNA fragment 2b1 (3444-3753) decays faster than other SERCA2b 3'-region fragments. Here we determined the minimum cis-acting destabilizing element in the decay and its interactions with the nuclear protein factors. The in vitro decay required ATP hydrolysis and Mg2+ but not Ca2+. The decay was directional from 3' to 5', and involved a novel 35b GC rich domain designated 2b1-4 corresponding to 3521-3555. The decay of 2b1 RNA was decreased by (a) competition with 2b1-4, (b) mutation of 2b1 to delete 2b1-4, and (c) depleting the extracts of destabilizing trans-acting factors using immobilized 2b1-4. To determine the minimal destabilizing elements 2b1-4 was divided into 7b domains A-E. Deleting AB, BC, CD or DE inactivated the destabilizing cis-acting element but deleting A, B, C, D or E had no effect. In electrophoresis mobility shift assays the nuclear protein extracts retarded the mobility of labeled uncapped 2b1 RNA without a poly A+ tail. A positive co-operativity in the interactions was shown in protein concentration dependence of the shift and in the competition of 2b1-4 in inhibiting the mobility of 2b1 RNA. Based on further experiments, the domain CDE (3535-3555) was sufficient to compete with 2b1 RNA for the protein binding. Consistent with this competition, excess CDE RNA retarded the in vitro decay of 2b1 RNA. Thus the RNA decay required ATP hydrolysis and Mg2+ but not Ca2+, the minimum binding domain was in the sequence 3535-3555, and the decay may involve a multimeric protein complex.

Morning glory anomaly with bilateral choroidal colobomas in a patient with Goldenhar's syndrome.

A child with Goldenhar's syndrome, bilateral choroidal colobomas, and a morning glory anomaly of the optic disk in one eye is described. Bilateral posterior segment anomalies associated with Goldenhar's syndrome are rare. An association between the morning glory anomaly and Goldenhar's syndrome has not been previously reported.

Control of protein expression through mRNA stability in calcium signalling.

Specific sequences (cis-acting elements) in the 3'-untranslated region (UTR) of RNA, together with stabilizing and destabilizing proteins (trans-acting factors), determine the mRNA stability, and consequently, the level of expression of several proteins. Such interactions were discovered initially for short-lived mRNAs encoding cytokines and early genes like c-jun and c-myc. However, they may also determine the fate of more stable mRNAs in a tissue and disease-dependent manner. The interactions between the cis-acting elements and the trans-acting factors may also be modulated by Ca(2+) either directly or via a control of the phosphorylation status of the trans-acting factors. We focus initially on the basic concepts in mRNA stability with the trans-acting factors AUF1 (destabilizing) and HuR (stabilizing). Sarco/endoplasmic reticulum Ca(2+) pumps, SERCA2a (cardiac and slow twitch muscles) and SERCA2b (most cells including smooth muscle cells), are pivotal in Ca(2+) mobilization during signal transduction. SERCA2a and SERCA2b proteins are encoded by relatively stable mRNAs that contain cis-acting stability determinants in their 3'-regions. We present several pathways where 3'-UTR mediated mRNA decay is key to Ca(2+) signalling: SERCA2a and beta-adrenergic receptors in heart failure, renin-angiotensin system, and parathyroid hormones. Other examples discussed include cytokines vascular endothelial growth factor, endothelin and endothelial nitric oxide synthase. Roles of Ca(2+) and Ca(2+)-binding proteins in mRNA stability are also discussed. We anticipate that these novel modes of control of protein expression will form an emerging area of research that may explore the central role of Ca(2+) in cell function during development and in disease.

Ca2+-mediated ascorbate release from coronary artery endothelial cells.

1.--The addition of Ca(2+) ionophore A23187 or ATP to freshly isolated or cultured pig coronary artery endothelial cells (PCEC) potentiated the release of ascorbate (Asc). Cultured PCEC were used to characterize the Ca(2+)-mediated release. An increase in Ca(2+)-mediated Asc release was observed from PCEC preincubated with Asc, Asc-2-phosphate or dehydroascorbic acid (DHAA). 2.--The effects of various ATP analogs and inhibition by suramin were consistent with the ATP-induced release being mediated by P2Y2-like receptors. 3.--ATP-stimulated Asc release was Ca(2+)-mediated because (a) ATP analogs that increased Asc release also elevated cytosolic [Ca(2+)], (b) Ca(2+) ionophore A23187 and cyclopiazonic acid stimulated the Asc release, (c) removing extracellular Ca(2+) and chelating intracellular Ca(2+)inhibited the ATP-induced release, and (d) inositol-selective phospholipase C inhibitor U73122 also inhibited this release. 4.--Accumulation of Asc by PCEC was examined at Asc concentrations of 10 microM (Na(+)-Asc symporter not saturated) and 5 mM (Na(+)-Asc symporter saturated). At 10 microM Asc, A23187 and ATP caused an inhibition of Asc accumulation but at 5 mM Asc, both the agents caused a stimulation. Substituting gluconate for chloride did not affect the basal Asc uptake but it abolished the effects of A23187. 5.--PCEC but not pig coronary artery smooth muscle cells show a Ca(2+)- mediated Asc release pathway that may be activated by agents such as ATP.

Hypotonic shock stimulates ascorbate release from coronary artery endothelial cells by a Ca2+ -independent pathway.

In endothelial cells, anion channels open upon osmotic swelling during shear stress and hypotonic shock. Therefore, we examined the effects of hypotonic shock on release of the antioxidant anion ascorbate from pig coronary artery endothelial cells. Hypotonic shock potentiated ascorbate release from freshly isolated or cultured pig coronary artery endothelial cells; subsequently cultured endothelial cells were used. The hypotonic shock-induced increase in Asc release was rapid, depended on the degree of hypotonic shock, and not due to membrane leakiness. Stimulating P2Y2 like receptors in endothelial cells with ATP causes ascorbate release via a Ca2+ -mediated pathway. Hypotonic shock-induced release differed from the Ca2+-mediated Asc release because: (a) the increase in release with hypotonic shock was additive to that with ATP or A23187 (Ca2+ -ionophore), (b) apyrase, suramin or removing extracellular Ca2+ did not affect the hypotonic shock-stimulated release, (c) anion channel blockers inhibited the release by the two pathways differently, and (d) hypotonic shock increased the ascorbate release from endothelial cells and cultured smooth muscle cells whereas the Ca2+ -mediated ascorbate release occurred only in endothelial cells. Accumulation of ascorbate by endothelial cells was examined at extracellular ascorbate concentrations of 10 (Na+ -ascorbate symporter not saturated) and 5000 microM (Na+ -ascorbate symporter saturated). Hypotonic shock and A23187 decreased ascorbate accumulation at 10 microM ascorbate but increased it at 5000 microM. The effects of the two treatments were additive and also differed from each other with substitution of gluconate for extracellular chloride. Thus, ascorbate release from endothelial cells can be potentiated by two distinct pathways - hypotonic shock mediated and ATP/Ca2+ stimulated.

Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins.

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

Role of third extracellular domain of plasma membrane Ca2+-Mg2+-ATPase based on the novel inhibitor caloxin 3A1.

The plasma membrane Ca2+ pump (PMCA) is a Ca2+-Mg2+-ATPase that expels Ca2+ from cells to help them maintain low concentrations of cytosolic Ca2+ ([Ca2+]i). It contains five putative extracellular domains (PEDs). Earlier we had reported that binding to PED2 leads to PMCA inhibition. Mutagenesis of residues in transmembrane domain 6 leads to loss of PMCA activity. PED3 connects transmembrane domains 5 and 6. PED3 is only five amino acid residues long. By screening a phage display library, we obtained a peptide sequence that binds this target. After examining a number of peptides related to this original sequence, we selected one that inhibits the PMCA pump (caloxin 3A1). Caloxin 3A1 inhibits PMCA but not the sarcoplasmic reticulum Ca2+-pump. Caloxin 3A1 did not inhibit formation of the 140 kDa acylphosphate intermediate from ATP or its degradation. Thus, PEDs play a role in the reaction cycle of PMCA even though sites for binding to the substrates Ca2+ and Mg-ATP2-, and the activator calmodulin are all in the cytosolic domains of PMCA. In endothelial cells exposed to low concentration of a Ca2+-ionophore, caloxin 3A1 caused a further increase in [Ca2+]i proving its ability to inhibit PMCA pump extracellularly. Thus, even though PED3 is the shortest PED, it plays key role in the PMCA function.