Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 37
Filtrar
1.
J Biol Chem ; 299(4): 103059, 2023 04.
Artigo em Inglês | MEDLINE | ID: mdl-36841479

RESUMO

Peroxisome proliferator-activated receptor γ (PPARγ) is a master regulator of adipocyte differentiation, glucolipid metabolism, and inflammation. Thiazolidinediones are PPARγ full agonists with potent insulin-sensitizing effects, whereas their oral usage is restricted because of unwanted side effects, including obesity and cardiovascular risks. Here, via virtual screening, microscale thermophoresis analysis, and molecular confirmation, we demonstrate that diosmin, a natural compound of wide and long-term clinical use, is a selective PPARγ modulator that binds to PPARγ and blocks PPARγ phosphorylation with weak transcriptional activity. Local diosmin administration in subcutaneous fat (inguinal white adipose tissue [iWAT]) improved insulin sensitivity and attenuated obesity via enhancing browning of white fat and energy expenditure. Besides, diosmin ameliorated inflammation in WAT and liver and reduced hepatic steatosis. Of note, we determined that iWAT local administration of diosmin did not exhibit obvious side effects. Taken together, the present study demonstrated that iWAT local delivery of diosmin protected mice from diet-induced insulin resistance, obesity, and fatty liver by blocking PPARγ phosphorylation, without apparent side effects, making it a potential therapeutic agent for the treatment of metabolic diseases.


Assuntos
Tecido Adiposo Marrom , Tecido Adiposo Branco , Diosmina , Fígado Gorduroso , Resistência à Insulina , PPAR gama , Animais , Camundongos , Tecido Adiposo Branco/efeitos dos fármacos , Tecido Adiposo Branco/metabolismo , Dieta Hiperlipídica , Diosmina/farmacologia , Diosmina/metabolismo , Diosmina/uso terapêutico , Fígado Gorduroso/metabolismo , Inflamação/metabolismo , Camundongos Endogâmicos C57BL , Obesidade/metabolismo , PPAR gama/metabolismo , Tecido Adiposo Marrom/metabolismo
2.
Ecotoxicol Environ Saf ; 270: 115865, 2024 Jan 15.
Artigo em Inglês | MEDLINE | ID: mdl-38134640

RESUMO

The improvement of crop resistance to insect using endophytic fungi is an environmentally friendly and sustainable strategy for agricultural pest control. Clarifying the efficacy and mechanism of endophytic fungi in improving crop resistance to pest offers the opportunity for biological control. In this study, changes in the transcriptome and defense compounds of wheat inoculated with endophytic fungal strains (i.e., YC and BB) were evaluated, and the efficacy of endophytic fungi in improving wheat resistance to Rhopalosiphum padi was studied. The results showed that the numbers of upregulated differentially-expressed genes (DEGs) in wheat plants inoculated with endophytic fungal strains YC and BB were higher than those of the downregulated DEGs, irrespective of R. padi infestation. Defense-related metabolic pathways, such as plant hormone signal transduction and secondary metabolite biosynthesis pathways were significantly enriched. Endophytic fungal strains YC and BB significantly increased jasmonic acid, DIMBOA (2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-one), total flavone, and tannin contents in wheat plants (P < 0.05) but decreased salicylic acid content. Variations in the contents of defense compounds were significantly correlated with decreased feeding, development, and reproduction of R. padi fed on wheat plants inoculated with strains YC and BB (|r| = 0.68-0.91, P < 0.05). The results suggested that endophytic fungi significantly decreased the feeding efficiency and population fitness [YC: (-11.13%) - (-22.07%); BB: (-10.98%) - (-22.20%)] of R. padi by altering the phytohormone pathway and secondary metabolite biosynthesis in wheat plants. This study helps in understanding of the efficacy of endophytic fungi in improving wheat resistance to insect and will be conducive to integrated pest management.


Assuntos
Aptidão Genética , Triticum , Reguladores de Crescimento de Plantas , Fungos/fisiologia
3.
J Sep Sci ; 46(8): e2200883, 2023 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-36820810

RESUMO

The Panxi area in Sichuan Province is the main area for the production of truffles in China, and several species of truffle are known to exist in this region. Nevertheless, it is unclear what the differences in chemical composition between the truffles are. Using an ultra-high-performance liquid chromatography quadrupole/orbitrap high-resolution mass spectrometry coupled with Compound Discoverer 3.0, we identified chemical components in three mainly known truffles from the Panxi region. Further analysis of chemical composition differences was conducted using principal component analysis, and orthogonal partial least squares discriminant analysis. Note that, 78.9% of the variance was uncovered by the principal component analysis model. As a result of the orthogonal partial least squares discriminant analysis model, the three species of truffles (Tuber pesudohimalayense, Tuber indicum, and Tuber sinense) from Panxi were better discriminated, with R2 X, R2 Y, and Q2 being 0.821, 0.993, and 0.947, respectively. In this study, 87 components were identified. T. pesudohimalayense contained significantly higher levels of nine different compounds than the other two species. Hence, it was possible to identify similarities and differences between three species of truffles from Panxi in terms of chemical composition. This can be used as a basis for quality control.


Assuntos
Espectrometria de Massas , China , Análise Discriminante
4.
J Asian Nat Prod Res ; 25(2): 147-155, 2023 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-35582859

RESUMO

Amestolkins A (1) and B (2), two previously undescribed phthalides sharing the same planar structure of (1, 5-dihydroxyhexyl)-7-hydroxyisobenzofuran-1(3H)-one were isolated from Talaromyces amestolkiae. Their absolute configurations were elucidated by comprehensive analyses of spectroscopic evidences in high-resolution electrospray mass spectra (HRESIMS) and nuclear magnetic resonance (NMR) combined with electronic circular dichroism (ECD) and NMR calculations. 1 and 2 showed anti-neuroinflammatory activity by inhibiting the gene expressions of proinflammatory factors including C-C motif chemokine ligand 2 (CCL-2), tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6), as well as attenuating the excretion of inducible nitric oxide synthase (iNOS) in BV-2 microglial cells at the concentration of 30 µM.


Assuntos
Talaromyces , Estrutura Molecular , Espectroscopia de Ressonância Magnética , Talaromyces/química
5.
Gac Med Mex ; 159(3): 255-261, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37494725

RESUMO

Diabetic cardiomyopathy (DCM) is a serious complication of diabetes caused by oxidative stress, inflammation, insulin resistance, myocardial fibrosis, and lipotoxicity; its nature is insidious, complex and difficult to treat. NLRP3 inflammasome triggers the maturation and release of pro-inflammatory cytokines, participates in pathophysiological processes such as insulin resistance and myocardial fibrosis, in addition to being closely related to the development and progression of diabetic cardiomyopathy. The development of inhibitors targeting specific aspects of inflammation suggests that NLRP3 inflammasome can be used to treat diabetic cardiomyopathy. This paper aims to summarize NLRP3 inflammasome mechanism and therapeutic targets in diabetic cardiomyopathy, and to provide new suggestions for the treatment of this disease.


La cardiomiopatía diabética es una complicación grave de la diabetes causada por estrés oxidativo, inflamación, resistencia a la insulina, fibrosis miocárdica y lipotoxicidad. Se trata de un padecimiento insidioso, complejo y difícil de tratar. El inflamasoma NLRP3 desencadena la maduración y liberación de citoquinas proinflamatorias, participa en procesos fisiopatológicos como la resistencia a la insulina y la fibrosis miocárdica, además de estar estrechamente relacionado con la aparición y progresión de la cardiomiopatía diabética. El desarrollo de inhibidores dirigidos a aspectos específicos de la inflamación sugiere que el inflamasoma NLRP3 puede utilizarse para tratar la cardiomiopatía diabética. Este artículo pretende resumir el mecanismo y las dianas terapéuticas del inflamasoma NLRP3 en la cardiomiopatía diabética, así como aportar nuevas sugerencias para el tratamiento de esta enfermedad.


Assuntos
Diabetes Mellitus Experimental , Cardiomiopatias Diabéticas , Resistência à Insulina , Animais , Humanos , Inflamassomos , Proteína 3 que Contém Domínio de Pirina da Família NLR , Cardiomiopatias Diabéticas/etiologia , Cardiomiopatias Diabéticas/complicações , Diabetes Mellitus Experimental/complicações , Diabetes Mellitus Experimental/tratamento farmacológico , Inflamação/etiologia , Fibrose
6.
J Nat Prod ; 85(6): 1474-1485, 2022 06 24.
Artigo em Inglês | MEDLINE | ID: mdl-35696541

RESUMO

Transcriptome analysis is shown to be an effective strategy to understand the potential function of natural products. Here, it is reported that 11 previously undescribed hydroanthraquinones [nigroquinones A-K (1-11)], along with eight known congeners, were isolated from Nigrospora sphaerica. Their structures were elucidated by interpreting spectroscopic and spectrometric data including high-resolution mass spectra and nuclear magnetic resonance. The absolute configurations of 1-11 were confirmed by electronic circular dichroism calculations. Transcriptome analysis revealed that 3 (isolated in the largest amount) might be anti-inflammatory. Assays based on LPS-induced RAW264.7 macrophages and zebrafish embryos confirmed that some of the isolated hydroanthraquinones attenuated the secretion of pro-inflammatory mediators in vitro and in vivo. Further Western blotting and immunofluorescence experiments indicated that 4 (which showed the most obvious nitric oxide inhibition) could suppress the expression of nuclear factor-kappa-B (NF-κB), phosphorylation of the inhibitor of NF-κB kinase and inhibit the transportation of NF-κB to the nucleus. Hence, the suppression of the NF-κB signaling pathway may be responsible for the anti-inflammatory effect. These results show that bioactivity evaluation on the basis of transcriptome analysis may be effective in the functional exploration of natural products.


Assuntos
Produtos Biológicos , NF-kappa B , Animais , Anti-Inflamatórios/farmacologia , Ascomicetos , Perfilação da Expressão Gênica , Lipopolissacarídeos/farmacologia , Camundongos , Óxido Nítrico , Óxido Nítrico Sintase Tipo II/metabolismo , Células RAW 264.7 , Peixe-Zebra
7.
Plant Dis ; 2022 Jun 19.
Artigo em Inglês | MEDLINE | ID: mdl-35722916

RESUMO

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

8.
J Nat Prod ; 84(12): 3044-3054, 2021 12 24.
Artigo em Inglês | MEDLINE | ID: mdl-34846889

RESUMO

Overexpression of various pro-inflammatory factors in microglial cells tends to induce neurodegenerative diseases, for which there is no effective therapy available. Aureonitol (1) and seven analogues, including six previously undescribed [elatumenol A-F (2-4, 6-8, respectively)], along with two new orsellinic acid esters [elatumone A and B (9 and 10)], were isolated from Chaetomium elatum. The structures of the compounds were established through comprehensive analysis of spectroscopic data, including high-resolution mass spectra and one- and two-dimensional NMR, and absolute configurations determined by the Mosher method, dimolybdenum tetraacetate-induced circular dichroism, and theoretical calculations including electronic circular dichroism and NMR. Metabolites 3, 4, 7, and 8 exhibited antineuroinflammatory activity by attenuating the production of inflammatory mediators, such as nitric oxide, interleukin-6, interleukin-1ß, tumor necrosis factor-α, and reactive oxygen species. Western blot results indicated 8 decreases the level of inducible nitric oxide synthase and cyclooxygenase-2 and suppresses the expression of Toll-like receptor 4 and nuclear factor kappa-B (NF-κB) as well as the phosphorylation of the inhibitor of NF-κB and p38 mitogen-activated protein kinases in lipopolysaccharide-activated BV-2 microglial cells.


Assuntos
Anti-Inflamatórios/farmacologia , Chaetomium/química , Furanos/farmacologia , Microglia/efeitos dos fármacos , Resorcinóis/farmacologia , Animais , Ésteres/química , Furanos/química , Lipopolissacarídeos/farmacologia , Camundongos , Óxido Nítrico/antagonistas & inibidores , Resorcinóis/química , Análise Espectral/métodos
9.
Chem Biodivers ; 18(10): e2100403, 2021 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-34370372

RESUMO

Three previously undescribed chlorophenyl glycosides, (2,4,6-trichloro-3-hydroxy-5-methoxyphenyl)methyl ß-D-glucopyranoside (1), (2,4-dichloro-3,5-dimethoxyphenyl)methyl 6-O-ß-D-glucopyranosyl-ß-D-glucopyranoside (2) and 4-chloro-3-methoxy-5-methylphenyl 6-O-(6-deoxy-ß-L-mannopyranosyl)-ß-D-glucopyranoside (3) were obtained from Lilium regale. The absolute configurations of these new finds were elucidated by comprehensive analyses of spectroscopic data combined with acid hydrolysis derivatization. (2,4-dichloro-3,5-dimethoxyphenyl)methyl 6-O-ß-D-glucopyranosyl-ß-D-glucopyranoside (2) can inhibit the proliferation of lung carcinoma A549 cells with an IC50 value of 29 µΜ.


Assuntos
Antineoplásicos Fitogênicos/farmacologia , Glicosídeos/farmacologia , Lilium/química , Raízes de Plantas/química , Células A549 , Antineoplásicos Fitogênicos/química , Antineoplásicos Fitogênicos/isolamento & purificação , Proliferação de Células/efeitos dos fármacos , Ensaios de Seleção de Medicamentos Antitumorais , Glicosídeos/química , Glicosídeos/isolamento & purificação , Humanos , Conformação Molecular , Células Tumorais Cultivadas
10.
Asia Pac J Clin Nutr ; 29(2): 253-261, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32674232

RESUMO

BACKGROUND AND OBJECTIVES: Several studies have shown that glutamine (Gln) may play an important role in energy metabolism, inflammatory reactions, and immune processes in patients with severe acute pancreatitis (SAP). Nevertheless, the results of individual randomized controlled trials (RCTs) on Gln nutrition support for SAP are contradictory. This systematic review and meta-analysis evaluated the clinical benefit of Gln-supported early enteral nutrition (G+EEN) in patients with SAP. METHODS AND STUDY DESIGN: Cochrane Library, PubMed, Embase, CNKI, Wan Fang, and Chinese Biomedical Literature Database were searched for relevant studies published before December 2018. RCTs of G+EEN versus standard early enteral nutrition (EEN) for SAP were selected, with both started within 48 h of admission. RESULTS: Seven clinical RCTs including a total of 433 patients (EEN group: 218 patients; G+EEN group: 215 patients) were included. Compared with EEN, G+EEN increased serum albumin (standard mean difference [SMD]=0.74; 95% confidence interval [CI], 0.33-1.15; p<0.01), reduced serum hypersensitive C-reactive protein (SMD=-1.62; 95% CI, -1.98 to -1.26; p<0.01) and risks of mortality risk (risk ratio= 0.38; 95% CI, 0.16-0.90; p=0.03) and multiple organ dysfunction syndrome (MODS)(risk ratio=0.37; 95% CI, 0.15-0.94; p<0.01), and shortened length of hospital stay (SMD=-1.19; 95% CI, -1.88 to 0.49; p<0.01); moreover, it did not significantly increase the incidence of infection-related complications, operative interventions, or APACHE II scores. CONCLUSIONS: G+EEN is beneficial in SAP management.


Assuntos
Nutrição Enteral , Glutamina/administração & dosagem , Pancreatite/terapia , Humanos
11.
Curr Microbiol ; 75(8): 1006-1010, 2018 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-29546587

RESUMO

Recently, several studies have indicated that the intestinal microbiota can be regulated by the individual attributes, and even the alternation of circadian rhythm. Inspired by this, we speculated that seasonal variation might also have some effect on the intestinal microbiota. A total of 11 Sprague-Dawley male rats, weighing 250-280 g, were divided into summer group (n = 5) and winter group (n = 6). Cages were individually ventilated at 20 ± 2 °C and 45-65% relative humidity with a circadian rhythm of 12/12 h. After 1 week of adaptively feeding, mucosal contents of jejunum, terminal ileum, and ascending colon were collected and analyzed by 16S rRNA Gene Amplicon Pyrosequencing. The results showed that intestinal microbiota of rats for the same strain were affected by season change under the same feeding condition and living environment. We should take seasonal factor into account in the future experimental design based on intestinal microbiome.


Assuntos
Bactérias/classificação , Colo Ascendente/microbiologia , Microbioma Gastrointestinal/genética , Íleo/microbiologia , Mucosa Intestinal/microbiologia , Jejuno/microbiologia , Estações do Ano , Animais , Bactérias/genética , Bactérias/isolamento & purificação , Sequência de Bases , DNA Bacteriano/genética , Masculino , RNA Ribossômico 16S/genética , Ratos , Ratos Sprague-Dawley , Análise de Sequência de DNA
12.
BMC Complement Altern Med ; 17(1): 288, 2017 Jun 02.
Artigo em Inglês | MEDLINE | ID: mdl-28577538

RESUMO

BACKGROUND: Dai-Huang-Fu-Zi-Tang (DHFZT) is a famous traditional Chinese prescription with intestinal obstruction, acute pancreatitis and cholecystalgia for thousands of years. Our previous work found that DHFZT could act against pulmonary and intestinal pathological injury in rats with severe acute pancreatitis (SAP). But the underlying mechanism has not been fully elucidated. The aim of present study was to investigate whether DHFZT could relieve pulmonary and intestinal injury by regulating aquaporins after SAP induced by sodium taurocholate in rats. METHODS: Forty of SD rats were used for dose dependant experiments of DHFZT.Accurate-mass Time-of-flight liquid chromatography-mass spectrometry was used for qualitative screening of chemical compositions of DHFZT. Twenty-four rats were randomly divided into 3 groups: sham group (n = 8), model group (SAP, n = 8), DHFZT group (SAP with DHFZT treatment, n = 8). SAP models were established by retrograde injections of 5% sodium taurocholate solutions into rat pancreaticobiliary ducts. Blood samples were taken at 0, 12, 24, 48 h post-operation for detecting serum amylase, lipase, endotoxin, TNF-α, IL-6 and IL-10. Protein expression and location of aquaporin (AQP)1, 5, 8 and 9 were assessed by immunohistochemistry, western blot and immunofluorescence respectively. RESULTS: The study showed that 27 kinds of chemical composition were identified, including 10 kinds in positive ion mode and 17 kinds in negative ion mode. The results showed that AQP1, AQP5 of lung, and AQP1, AQP5, AQP8 of intestine in model group were significantly lower than that of sham group (P < 0.05), and which were obviously reversed by treatment with DHFZT. In addition, protein levels of pro-inflammatory cytokines such as TNF-α, IL-6 and endotoxin in peripheral blood were significantly suppressed by DHFZT, and that anti-inflammatory cytokine like IL-10 was just opposite. Finally, we also noted that DHFZT reduced serum levels of amylase, lipase and endotoxin, and also improved edema and pathological scores of lung and intestine after SAP. CONCLUSIONS: DHFZT ameliorated the pulmonary and intestinal edema and injury induced by SAP via the upregulation of different AQPs in lung and intestine, and suppressed TNF-α, IL-6 expression and enhanced IL-10 expression.


Assuntos
Aquaporinas/genética , Medicamentos de Ervas Chinesas/administração & dosagem , Enteropatias/tratamento farmacológico , Lesão Pulmonar/tratamento farmacológico , Pancreatite/complicações , Animais , Aquaporinas/metabolismo , Humanos , Interleucina-10/genética , Interleucina-10/metabolismo , Interleucina-6/genética , Interleucina-6/metabolismo , Enteropatias/etiologia , Enteropatias/genética , Enteropatias/metabolismo , Mucosa Intestinal/metabolismo , Intestinos/lesões , Lesão Pulmonar/etiologia , Lesão Pulmonar/genética , Lesão Pulmonar/metabolismo , Masculino , Ratos , Ratos Sprague-Dawley
13.
Zhongguo Yi Liao Qi Xie Za Zhi ; 39(5): 341-3, 2015 Sep.
Artigo em Zh | MEDLINE | ID: mdl-26904876

RESUMO

From the perspective of portable monitoring devices,we use an analog front-end AFE4490 design a module of Non-invasive blood oxygen measurement, used to collect human pulse wave signal and peak (valley) value detection and then use the principles of non-invasive oximetry calculated oxygen saturation (SPO2). This design of noninvasive oximetry module has the characteristics of small size, low power consumption, and the results of test show that the measurement of oxygen saturation are correct.


Assuntos
Oximetria/instrumentação , Oximetria/métodos , Oxigênio/sangue , Frequência Cardíaca , Humanos
14.
Insights Imaging ; 15(1): 168, 2024 Jul 06.
Artigo em Inglês | MEDLINE | ID: mdl-38971908

RESUMO

OBJECTIVE: To determine the performance of intravoxel incoherent motion (IVIM) parameters and the extracellular volume fraction (ECV) in distinguishing between different subtypes of lung cancer and predicting lymph node metastasis (LNM) status in patients with non-small-cell lung cancer (NSCLC). METHODS: One hundred sixteen patients with lung cancer were prospectively recruited. IVIM, native, and postcontrast T1 mapping examinations were performed, and the T1 values were measured to calculate the ECV. The differences in IVIM parameters and ECV were compared between NSCLC and small-cell lung cancer (SCLC), adenocarcinoma (Adeno-Ca) and squamous cell carcinoma (SCC), and NSCLC without and with LNM. The assessment of each parameter's diagnostic performance was based on the area under the receiver operating characteristic curve (AUC). RESULTS: The apparent diffusion coefficient (ADC), true diffusion coefficient (D), and ECV values in SCLC were considerably lower compared with NSCLC (all p < 0.001, AUC > 0.887). The D value in SCC was substantially lower compared with Adeno-Ca (p < 0.001, AUC = 0.735). The perfusion fraction (f) and ECV values in LNM patients were markedly higher compared with those without LNM patients (p < 0.01, < 0.001, AUC > 0.708). CONCLUSION: IVIM parameters and ECV can serve as non-invasive biomarkers for assisting in the pathological classification and LNM status assessment of lung cancer patients. CRITICAL RELEVANCE STATEMENT: IVIM parameters and ECV demonstrated remarkable potential in distinguishing pulmonary carcinoma subtypes and predicting LNM status in NSCLC. KEY POINTS: Lung cancer is prevalent and differentiating subtype and invasiveness determine the treatment course. True diffusion coefficient and ECV showed promise for subtyping and determining lymph node status. These parameters could serve as non-invasive biomarkers to help determine personalized treatment strategies.

15.
Artigo em Inglês | MEDLINE | ID: mdl-38502620

RESUMO

As eusocial creatures, bees display unique macro collective behavior and local body dynamics that hold potential applications in various fields, such as computer animation, robotics, and social behavior. Unlike birds and fish, bees fly in a low-aligned zigzag pattern. Additionally, bees rely on visual cues for foraging and predator avoidance, exhibiting distinctive local body oscillations, such as body lifting, thrusting, and swaying. These inherent features pose significant challenges for realistic bee simulations in practical animation applications. In this paper, we present a bio-inspired model for bee simulations capable of replicating both macro collective behavior and local body dynamics of bees. Our approach utilizes a visually-driven system to simulate a bee's local body dynamics, incorporating obstacle perception and body rolling control for effective collision avoidance. Moreover, we develop an oscillation rule that captures the dynamics of the bee's local bodies, drawing on insights from biological research. Our model extends beyond simulating individual bees' dynamics; it can also represent bee swarms by integrating a fluid-based field with the bees' innate noise and zigzag motions. To fine-tune our model, we utilize pre-collected honeybee flight data. Through extensive simulations and comparative experiments, we demonstrate that our model can efficiently generate realistic low-aligned and inherently noisy bee swarms.

16.
Spectrochim Acta A Mol Biomol Spectrosc ; 311: 123990, 2024 Apr 15.
Artigo em Inglês | MEDLINE | ID: mdl-38340450

RESUMO

Pyrophosphoric acid (PPi) is a crucial indicator for monitoring adenosine triphosphate hydrolysis processes, and abnormal PPi levels in the human body seriously threaten human health. Thus the efficient detection of the concentration of PPi in the aqueous solution is important and urgent. This paper described the successful synthesis of a tetraphenylethylene (TPE) derivative, named as TPE-4B, which contained four chelate pyridinium groups exhibiting aggregation-induced emission characteristics. TPE-4B was explicitly developed for the selective and sensitive fluorescence detection of PPi in aqueous solutions, showing a fluorescence "turn-on" response, and the detection limit was 65 nM. The four chelate pyridinium moieties of TPE-4B exhibited robust electrostatic interactions and binding capacity towards PPi, leading to the formation of aggregations, which was confirmed by zeta potential, dynamic light scattering, and scanning electron microscopy. Compared with free TPE-4B in the aqueous solution, the zeta potential of aggregations decreased from 20.7 to 4.2 mV, the average diameter increased from 155 to 403 nm, and the morphology transformed from porous nanostructures into a block-like format. Leveraging these properties, TPE-4B is a promising candidate for a "turn-on" fluorescence sensor designed to detect PPi in the aqueous solution.

17.
Int J Biol Macromol ; 277(Pt 3): 134401, 2024 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-39097049

RESUMO

An imbalance between energy intake and energy expenditure predisposes obesity and its related metabolic diseases. Soluble dietary fiber has been shown to improve metabolic homeostasis mainly via microbiota reshaping. However, the application and metabolic effects of insoluble fiber are less understood. Herein, we employed nanotechnology to design citric acid-crosslinked carboxymethyl cellulose nanofibers (CL-CNF) with a robust capacity of expansion upon swelling. Supplementation with CL-CNF reduced food intake and delayed digestion rate in mice by occupying stomach. Besides, CL-CNF treatment mitigated diet-induced obesity and insulin resistance in mice with enhanced energy expenditure, as well as ameliorated inflammation in adipose tissue, intestine and liver and reduced hepatic steatosis, without any discernible signs of toxicity. Additionally, CL-CNF supplementation resulted in enrichment of probiotics such as Bifidobacterium and decreased in the relative abundances of deleterious microbiota expressing bile salt hydrolase, which led to increased levels of conjugated bile acids and inhibited intestinal FXR signaling to stimulate the release of GLP-1. Taken together, our findings demonstrate that CL-CNF administration protects mice from diet-induced obesity and metabolic dysfunction by reducing food intake, enhancing energy expenditure and remodeling gut microbiota, making it a potential therapeutic strategy against metabolic diseases.


Assuntos
Metabolismo Energético , Microbioma Gastrointestinal , Nanofibras , Obesidade , Animais , Nanofibras/química , Obesidade/metabolismo , Obesidade/prevenção & controle , Camundongos , Microbioma Gastrointestinal/efeitos dos fármacos , Metabolismo Energético/efeitos dos fármacos , Celulose/farmacologia , Celulose/química , Masculino , Resistência à Insulina , Camundongos Endogâmicos C57BL , Dieta Hiperlipídica/efeitos adversos , Solubilidade , Carboximetilcelulose Sódica/química , Carboximetilcelulose Sódica/farmacologia , Fibras na Dieta/farmacologia
18.
J Cancer ; 14(18): 3523-3531, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-38021155

RESUMO

Endometrial cancer (EC) is a common gynecologic malignancy, with a rising trend in related mortality rates. The assessment based on imaging examinations contributes to the preoperative staging and surgical management of EC. However, conventional imaging diagnosis has limitations such as low accuracy and subjectivity. Radiomics, utilizing advanced feature analysis from medical images, extracts more information, ultimately establishing associations between imaging features and disease phenotypes. In recent years, radiomic studies on EC have emerged, employing radiomic features combined with clinical characteristics to model and predict histopathological features, protein expression, and clinical prognosis. This article elaborates on the application of radiomics in EC research and discusses its implications.

19.
J Cancer Res Clin Oncol ; 149(16): 15275-15285, 2023 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-37594534

RESUMO

BACKGROUND: Different from other malignant gynecologic tumors, gestational trophoblastic neoplasms (GTNs) exhibit an exceptionally high cure rate primarily through chemotherapeutic interventions. However, there exists a small subset of refractory GTNs that do not respond to conventional chemotherapies. In such cases, the emergence of immunotherapies has demonstrated significant benefits in managing various challenging GTNs. PURPOSE: This article aims to provide a comprehensive and systematic review of the immune microenvironment and immunotherapeutic approaches for GTNs. The purpose is to identify potential biomarkers that could enhance disease management and summarize the available immunotherapies for ease of reference. METHODS: We reviewed the relevant literatures toward immunotherapies of GTNs from PubMed. CONCLUSION: Current immunotherapeutic strategies for GTNs mainly revolve around immune checkpoint inhibitors (ICIs) targeting programmed death receptor 1 (PD-1) and programmed cell death ligand 1 (PD-L1). Prominent examples include avelumab, pembrolizumab, and camrelizumab. However, existing researches into the underlying mechanisms are still limited.


Assuntos
Neoplasias dos Genitais Femininos , Doença Trofoblástica Gestacional , Neoplasias , Gravidez , Humanos , Feminino , Doença Trofoblástica Gestacional/terapia , Doença Trofoblástica Gestacional/patologia , Imunoterapia , Antígeno B7-H1 , Microambiente Tumoral
20.
J Cancer ; 14(16): 3108-3116, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37859821

RESUMO

Objective: The aim of this study is to determine whether dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI)-based quantitative parameters and the extracellular volume fraction (ECV) can differentiate small-cell lung cancer (SCLC) from non-small-cell lung cancer (NSCLC), squamous-cell carcinoma (SCC) from adenocarcinoma (Adeno-Ca), and NSCLC with lymph node metastasis from NSCLC without lymph node metastasis. Materials and methods: We prospectively enrolled patients with lung cancer (41 Adeno-Ca, 29 SCC, and 23 SCLC) who underwent DCE-MRI and enhanced T1 mapping prior to histopathological confirmation. Quantitative parameters based on DCE-MRI and ECV based on T1 mapping were compared between SCLC and NSCLC patients, between SCC and Adeno-Ca patients, and between NSCLC patients with and without lymph node metastasis. The area under the receiver-operating characteristic curve (AUC) was used to evaluate the diagnostic performance of each parameter. Spearman rank correlation was used to clarify the associations between ECV and DCE-MRI-derived parameters. Results: Ktrans, Kep, Ve, and ECV all performed well in differentiating SCLC from NSCLC (AUC > 0.729). Ktrans showed the best performance in differentiating SCC from Adeno-Ca (AUC = 0.836). ECV could differentiate NSCLCs with and without lymph node metastases (AUC = 0.764). ECV showed a significant positive correlation with both Ktrans and Ve. Conclusions: Ktrans is the most promising imaging parameter to differentiate SCLC from NSCLC, and Adeno-Ca from SCC. ECV was helpful in detecting lymph node metastasis in NSCLC. These imaging parameters may help guide the selection of lung cancer treatment.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA