RESUMO
Trehalose-6-phosphate (T6P) functions as a vital proxy for assessing carbohydrate status in plants. While class II T6P synthases (TPS) do not exhibit TPS activity, they are believed to play pivotal regulatory roles in trehalose metabolism. However, their precise functions in carbon metabolism and crop yield have remained largely unknown. Here, BnaC02.TPS8, a class II TPS gene, is shown to be specifically expressed in mature leaves and the developing pod walls of Brassica napus. Overexpression of BnaC02.TPS8 increased photosynthesis and the accumulation of sugars, starch, and biomass compared to wild type. Metabolomic analysis of BnaC02.TPS8 overexpressing lines and CRISPR/Cas9 mutants indicated that BnaC02.TPS8 enhanced the partitioning of photoassimilate into starch and sucrose, as opposed to glycolytic intermediates and organic acids, which might be associated with TPS activity. Furthermore, the overexpression of BnaC02.TPS8 not only increased seed yield but also enhanced seed oil accumulation and improved the oil fatty acid composition in B. napus under both high nitrogen (N) and low N conditions in the field. These results highlight the role of class II TPS in impacting photosynthesis and seed yield of B. napus, and BnaC02.TPS8 emerges as a promising target for improving B. napus seed yield.
Assuntos
Brassica napus , Glucosiltransferases , Brassica napus/genética , Brassica napus/metabolismo , Fotossíntese , Sementes/genética , Sementes/metabolismo , Amido/metabolismoRESUMO
Many bacteria have hemerythrin (Hr) proteins that bind O2, including Pseudomonas aeruginosa, in which microoxia-induced Hr (Mhr) provide fitness advantages under microoxic conditions. Mhr has a 23 amino-acid extension at its C-terminus relative to a well-characterized Hr from Methylococcus capsulatus, and similar extensions are also found in Hrs from other bacteria. The last 11 amino acids of this extended, C-terminal tail are highly conserved in gammaproteobacteria and predicted to form a helix with positively charged and hydrophobic faces. In cellular fractionation assays, wild-type (WT) Mhr was found in both membrane and cytosolic fractions, while a MhrW143* variant lacking the last 11 residues was largely in the cytosol and did not complement Mhr function in competition assays. MhrL112Y, a variant that has a much longer-lived O2-bound form, was fully functional and had a similar localization pattern to that of WT Mhr. Both MhrW143* and MhrL112Y had secondary structures, stabilities, and O2-binding kinetics similar to those of WT Mhr. Fluorescence studies revealed that the C-terminal tail, and particularly the fragment corresponding to its last 11 residues, was sufficient and necessary for association with lipid vesicles. Molecular dynamics simulations and subsequent cellular analysis of Mhr variants have demonstrated that conserved, positively charged residues in the tail are important for Mhr interactions with negatively charged membranes and the contribution of this protein to competitive fitness. Together, these data suggest that peripheral interactions of Mhr with membranes are guided by the C-terminal tail and are independent of O2-binding.
Assuntos
Membrana Celular , Hemeritrina , Pseudomonas aeruginosa , Pseudomonas aeruginosa/metabolismo , Pseudomonas aeruginosa/genética , Hemeritrina/metabolismo , Hemeritrina/química , Hemeritrina/genética , Membrana Celular/metabolismo , Proteínas de Bactérias/metabolismo , Proteínas de Bactérias/química , Proteínas de Bactérias/genética , Sequência de Aminoácidos , Sequência Conservada , Oxigênio/metabolismoRESUMO
MAIN CONCLUSION: Overexpression of BnaC02.TPS8 increased low N and high sucrose-induced anthocyanin accumulation. Anthocyanin plays a crucial role in safeguarding photosynthetic tissues against high light, UV radiation, and oxidative stress. Their accumulation is triggered by low nitrogen (N) stress and elevated sucrose levels in Arabidopsis. Trehalose-6-phosphate (T6P) serves as a pivotal signaling molecule, sensing sucrose availability, and carbon (C) metabolism. However, the mechanisms governing the regulation of T6P synthase (TPS) genes responsible for anthocyanin accumulation under conditions of low N and high sucrose remain elusive. In a previous study, we demonstrated the positive impact of a cytoplasm-localized class II TPS protein 'BnaC02.TPS8' on photosynthesis and seed yield improvement in Brassica napus. The present research delves into the biological role of BnaC02.TPS8 in response to low N and high sucrose. Ectopic overexpression of BnaC02.TPS8 in Arabidopsis seedlings resulted in elevated shoot T6P levels under N-sufficient conditions, as well as an increased carbon-to-nitrogen (C/N) ratio, sucrose accumulation, and starch storage under low N conditions. Overexpression of BnaC02.TPS8 in Arabidopsis heightened sensitivity to low N stress and high sucrose levels, accompanied by increased anthocyanin accumulation and upregulation of genes involved in flavonoid biosynthesis and regulation. Metabolic profiling revealed increased levels of intermediate products of carbon metabolism, as well as anthocyanin and flavonoid derivatives in BnaC02.TPS8-overexpressing Arabidopsis plants under low N conditions. Furthermore, yeast two-hybrid (Y2H) and bimolecular fluorescence complementation (BiFC) analyses demonstrated that BnaC02.TPS8 interacts with both BnaC08.TPS9 and BnaA01.TPS10. These findings contribute to our understanding of how TPS8-mediated anthocyanin accumulation is modulated under low N and high sucrose conditions.
Assuntos
Arabidopsis , Brassica napus , Fosfatos Açúcares , Trealose , Antocianinas , Arabidopsis/genética , Brassica napus/genética , Carbono , Flavonoides , Nitrogênio , Trealose/análogos & derivados , Técnicas do Sistema de Duplo-HíbridoRESUMO
Oilseed rape (Brassica napus) is one of the most important oil crops in the world and shows sensitivity to low phosphorus (P) availability. In many soils, organic P (Po) is the main component of the soil P pool. Po must be mineralised to Pi through phosphatases, and then taken up by plants. However, the relationship between root-secreted acid phosphatases (APase) and root morphology traits, two important P-acquisition strategies in response to P deficiency, is unclear among B. napus genotypes. This study aimed to understand their relationship and how they affect P acquisition, which is crucial for the sustainable utilisation of agricultural P resources. This study showed significant genotypic variations in root-secreted APase activity per unit root fresh weight (SAP) and total root-secreted APase activity per plant (total SAP) among 350 B. napus genotypes. Seed yield was positively correlated with total SAP but not significantly correlated with SAP. Six root traits of 18 B. napus genotypes with contrasting root biomass were compared under normal Pi, low Pi and Po. Genotypes with longer total root length (TRL) reduced SAP, but those with shorter TRL increased SAP under P deficiency. Additionally, TRL was important in P-acquisition under three P treatments, and total SAP was also important in P-acquisition under Po treatment. In conclusion, trade-offs existed between the two P-acquisition strategies among B. napus genotypes under P-deficient conditions. Total SAP was an important root trait under Po conditions. These results might help to breed B. napus with greater P-acquisition ability under low P availability conditions.
Assuntos
Brassica napus , Fósforo , Brassica napus/genética , Fosfatase Ácida/genética , Fenótipo , Genótipo , SoloRESUMO
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
RESUMO
BACKGROUND: Individuals from minority groups have historically faced social injustices. Those from underrepresented groups have been less likely to access both healthcare services and higher education. Little is known about the experiences of underrepresented students during their undergraduate studies in osteopathy in the UK. The aim of this project was to explore awareness of cultural diversity and beliefs about patients from underrepresented groups in current osteopathic educational environments and evaluate students' preparedness to manage patients from diverse groups. The project also aimed to investigate the educational experiences of students from underrepresented backgrounds during their training and their opinions on changes that could support better levels of recruitment and achievement. The findings were discussed with stakeholders in interactive workshops with the aim to develop recommendations for action and change. METHODS: A transformative action research paradigm informed this mixed methods project. It included: 1/ a survey of students from all seven osteopathic educational providers in the UK using the Multidimensional Cultural Humility Scale (MCHS); 2/ a series of focus groups with students from underrepresented groups (women, students with disabilities, students from minority ethnic backgrounds, and students identifying as LGBTQIA+); and 3/ a workshop forum to discuss findings. RESULTS: A total of 202 participants completed the MCHS and demographic questionnaire and seven focus groups were conducted. A model was developed to describe participants' training experiences comprising two main themes: institutional contextual obstacles (with four sub-themes) and underrepresented students' conceptual understanding of Equity, Diversity and Inclusion (EDI). Recommendations for change identified in the workshops were based on three topics: institutions, staff, and students. CONCLUSION: Our findings confirm conclusions from other institutions that staff education is urgently needed to create and maintain equitable, inclusive environments in osteopathic educational institutions in the UK to support all students, particularly those from underrepresented groups. Institutional EDI processes and policies also need to be clarified or modified to ensure their usefulness, accessibility, and implementation.
Assuntos
Diversidade Cultural , Grupos Focais , Grupos Minoritários , Medicina Osteopática , Humanos , Medicina Osteopática/educação , Feminino , Masculino , Reino Unido , Estudantes de Medicina/psicologia , Adulto , Inquéritos e Questionários , Adulto JovemRESUMO
BACKGROUND: The advent and continual improvement of high-throughput sequencing technologies has made immunoglobulin repertoire sequencing accessible and informative regardless of study species. However, to fully map dynamic changes in polyclonal responses precise framework and complementarity determining region annotation of rearranging genes is pivotal. Most sequence annotation tools are designed primarily for use with human and mouse antibody sequences which use databases with fixed species lists, applying very specific assumptions which select against unique structural characteristics. For this reason, data agnostic tools able to learn from presented data can be very useful with new species or with novel datasets. RESULTS: We have developed IgMAT, which utilises a reduced amino acid alphabet, that incorporates multiple HMM alignments into a single consensus to automatically annotate immunoglobulin sequences from most organisms. Additionally, the software allows the incorporation of user defined databases to better represent the species and/or antibody class of interest. To demonstrate the accuracy and utility of IgMAT, we present analysis of sequences extracted from structural data and immunoglobulin sequence datasets from several different species. CONCLUSIONS: IgMAT is fully open-sourced and freely available on GitHub ( https://github.com/TPI-Immunogenetics/igmat ) for download under GPLv3 license. It can be used as a CLI application or as a python module to be integrated in custom scripts.
Assuntos
Imunoglobulinas , Software , Animais , Camundongos , Humanos , Imunoglobulinas/genética , Bases de Dados FactuaisRESUMO
Hibiscus is native to southeast Asia but well suited to Colombia's arid soil and dry climates from the coast to the mountains of Bogotá. Viruses infecting hibiscus in Colombia are largely unexplored, with four viruses previously known: hibiscus chlorotic ringspot virus (HCRSV), hibiscus latent Fort Pierce virus (HLFPV), hibiscus latent Singapore virus (HLSV), and citrus leprosis virus C2 (CiLV-C2) (Padmanabhan et al., 2023). Mixed infections between these viruses were frequently detected. A recent virome analysis of a single hibiscus plant from Colombia revealed multiple viruses in mixed infection; : HCRSV, HLFPV, passion fruit green spot virus (PFGSV), a strain of physalis vein necrosis nepovirus, four novel carlavirus, one new potexvirus and a mitovirus. In addition, few smaller contigs of blunervirus and soymovirus were also identified in the high throughput sequencing (HTS) data, but their presence in the mixed infection could not be validated (A. Roy et al. 2023unpublish data). During Brevipalpus-transmitted virus (BTV) surveys, two asymptomatic and 15 hibiscus foliar samples showing green ringspots with central chlorotic spots in senescing areas, mosaic, and black or chlorotic spots were collected from six departments (states) in three geographical regions of Colombia: Tolima (n=4) and Cauca Valley (n=2) (Andean region), Meta (n=6) and Casanare (n=1) (Orinoquia region), and Quindío (n=1) and Risaralda (n=1) (coffee growing region). About 100 mg of 17 hibiscus leaf samples were separately processed for RNA isolation without DNase I treatment and tested for known BTVs, and for newly discovered hibiscus soymovirus (HSV; genus Soymovirus family Caulimoviridae) using PCR assays (Padmanabhan et al. 2023, Wang et al. 2023). To identify potential HSV infection in the samples, published SVF1/SVR1 and newly designed primer pairs (HSV-REP-F/-R and HSV-CPG-F/-R) were used to amplify the 430 nt transactivation (ORF-VI), 631 nt replicase (REP) and 401 nt coat protein gene (CPG), respectively (Supplementary 1). Of 17 samples tested, three from Tolima and one each from Meta and Quindío yielded all three expected size amplicons. Bi-directional sequencing followed by BLASTn analysis revealed 95-98% nt identity with the CPG, REP, and ORF-VI genes of HSV (OP757659). Ribo-depleted libraries were prepared using the RNA extracts of five HSV PCR positive samples. HTS yielded 11.6 to 50.3 million raw reads per sample library. Adapters were trimmed and filtered from the raw reads with Trimmomatic v0.39 and then assembled using SPAdes v3.15.5 (Padmanabhan et al., 2023). Contigs were blasted against the Arabidopsis proteome and a RefSeq-based viral protein database. Potential viral sequences were then blasted against the complete NCBI nr database. Assembled soymo contigs covered 99-100% of the HSV genome, with per-nucleotide read depths of 23.8 to 393. Contigs from the Tolima (Accessions; OR621030- OR621032 and Quindío samples (OR621033) covered 99-100% of the HSV genome and had >96-98% nt identity to Hawaiian isolate (OP757659) whereas the Meta sample contigs covered 78% of the genome with 9495% nt identity. HTS contigs shared >98-99% nt identities with their PCR amplicons. Along with HSV, other virus sequences (HCRSV, HLFPV, PFGSV, CiLV-C2, and mycoviruses) were variously detected from all five libraries. Due to mixed infection no symptom similarity was noticed among these 5 samples. The findings in hibiscus in Tolima, Meta and Quindío represent the first confirmed report of HSV infection in hibiscus in Colombia. The widespread distribution suggests the possibility of HSV dispersion via movement of planting material, and potential further spread to another hibiscus growing region.
RESUMO
BACKGROUND: People living with HIV experience higher rates of cognitive impairment (CI), and at younger ages, than the general population. These individuals report poor health-related quality of life (HRQL), however, interventions aimed at assisting people living with HIV to live well with CI do not currently exist and represent an important un-met need in this population. OBJECTIVE: This study aimed to identify the lived experience research priorities for improving HRQL and identify interventions to support priority areas. METHODS: A Research Advisory Group was established with 15 lived experience, academic, healthcare, and third sector professionals. Additionally, two semi-structured focus groups were undertaken, with health and third sector professionals and people living with HIV with CI. Participants were asked to rank factors impacting HRQL, identified in prior research, in terms of priority and intervention development. Findings were analysed using a combination of conventional and summative content analysis. Study findings were feedback to our Research Advisory Group. RESULTS: Five people living with HIV with CI, recruited through third sector agencies [Male 80%; median age 59 (range 56-78); White British 60%; homosexual 60%], and three healthcare and third sector participants (66% third sector professionals from two local HIV charities; 33% HIV-specific clinical psychologist) took part in two focus groups and ranked interventions targeting improvement in physical function, social connectedness, cognition and perceived control over cognitive health as priority areas. Findings were then fed back to the Research Advisory Group who recommended the development of an illness-specific cognitive rehabilitation programme and improved information provision as important avenues for intervention development. CONCLUSION: Given the absence of meaningful patient and public involvement, intervention, and support guidelines for people living with HIV with CI, this provides a roadmap for future research in this important and growing area of HIV clinical care.
Assuntos
Disfunção Cognitiva , Grupos Focais , Infecções por HIV , Qualidade de Vida , Humanos , Infecções por HIV/psicologia , Infecções por HIV/complicações , Qualidade de Vida/psicologia , Masculino , Pessoa de Meia-Idade , Disfunção Cognitiva/psicologia , Feminino , Idoso , PesquisaRESUMO
To maximise the throughput of novel, high-throughput phenotyping platforms, many researchers have utilised smaller pot sizes to increase the number of biological replicates that can be grown in spatially limited controlled environments. This may confound plant development through a process known as "pot binding", particularly in larger species including potato (Solanum tuberosum), and under water-restricted conditions. We aimed to investigate the water availability hypothesis of pot binding, which predicts that small pots have insufficient water holding capacities to prevent drought stress between irrigation periods, in potato. Two cultivars of potato were grown in small (5 L) and large (20 L) pots, were kept under polytunnel conditions, and were subjected to three irrigation frequencies: every other day, daily, and twice daily. Plants were phenotyped with two Phenospex PlantEye F500s and canopy and tuber fresh mass and dry matter were measured. Increasing irrigation frequency from every other day to daily was associated with a significant increase in fresh tuber yield, but only in large pots. This suggests a similar level of drought stress occurred between these treatments in the small pots, supporting the water availability hypothesis of pot binding. Further increasing irrigation frequency to twice daily was still not sufficient to increase yields in small pots but it caused an insignificant increase in yield in the larger pots, suggesting some pot binding may be occurring in large pots under daily irrigation. Canopy temperatures were significantly higher under each irrigation frequency in the small pots compared to large pots, which strongly supports the water availability hypothesis as higher canopy temperatures are a reliable indicator of drought stress in potato. Digital phenotyping was found to be less accurate for larger plants, probably due to a higher degree of self-shading. The research demonstrates the need to define the optimum pot size and irrigation protocols required to completely prevent pot binding and ensure drought treatments are not inadvertently applied to control plants.
RESUMO
Vacuolar Pi transporters (VPTs) have recently been identified as important regulators of cellular Pi status in Arabidopsis thaliana and Oryza sativa. In the oil crop Brassica napus, BnA09PHT5;1a and BnC09PHT5;1a are two homologs of AtPHT5;1, the vacuolar Pi influx transporter in Arabidopsis. Here, we show that Pi deficiency induces the transcription of both homologs of PHT5;1a genes in B. napus leaves. Brassica PHT5;1a double mutants (DM) had smaller shoots and higher cellular Pi concentrations than wild-type (WT, Westar 10), suggesting the potential role of BnPHT5;1a in modulating cellular Pi status in B. napus. A proteomic analysis was performed to estimate the role of BnPHT5;1a in Pi fluctuation. Results show that Pi deprivation disturbs the abundance of proteins in the physiological processes involved in carbohydrate metabolism, response to stimulus and stress in B. napus, while disruption of BnPHT5;1a genes may exacerbate these processes. Besides, the processes of cell redox homeostasis, lipid metabolic and proton transmembrane transport are supposed to be unbalanced in BnPHT5;1a DM under the -Pi condition. Noteworthy, disruption of BnPHT5;1a genes severely alters the abundance of proteins related to ATP biosynthesis, and proton/inorganic cation transmembrane under normal Pi condition, which might contribute to B. napus growth limitations. Additionally, seven new protein markers of Pi homeostasis are identified in B. napus. Taken together, this study characterizes the important regulatory role of BnPHT5;1a genes as vacuolar Pi influx transporters in Pi homeostasis in B. napus.
RESUMO
The third complementary-determining regions of the heavy-chain (CDR3H) variable regions (VH) of some cattle antibodies are highly extended, consisting of 48 or more residues. These `ultralong' CDR3Hs form ß-ribbon stalks that protrude from the surface of the antibody with a disulfide cross-linked knob region at their apex that dominates antigen interactions over the other CDR loops. The structure of the Fab fragment of a naturally paired bovine ultralong antibody (D08), identified by single B-cell sequencing, has been determined to 1.6â Å resolution. By swapping the D08 native light chain with that of an unrelated antigen-unknown ultralong antibody, it is shown that interactions between the CDR3s of the variable domains potentially affect the fine positioning of the ultralong CDR3H; however, comparison with other crystallographic structures shows that crystalline packing is also a major contributor. It is concluded that, on balance, the exact positioning of ultralong CDR3H loops is most likely to be due to the constraints of crystal packing.
Assuntos
Regiões Determinantes de Complementaridade , Fragmentos Fab das Imunoglobulinas , Cadeias Pesadas de Imunoglobulinas , Cadeias Leves de Imunoglobulina , Modelos Moleculares , Animais , Bovinos , Cadeias Pesadas de Imunoglobulinas/química , Cristalografia por Raios X , Cadeias Leves de Imunoglobulina/química , Cadeias Leves de Imunoglobulina/genética , Regiões Determinantes de Complementaridade/química , Fragmentos Fab das Imunoglobulinas/química , Sequência de Aminoácidos , Conformação ProteicaRESUMO
Hibiscus is not native to Colombia but well suited to its arid soil and dry climates. A single hibiscus plant from Risaralda, showing black spots on upper and lower sides of its leaves, was collected for virome analysis using meta-transcriptomic high-throughput sequencing technology. Bioinformatic analysis identified 12.5% of the total reads in the Ribo-Zero cDNA library which mapped to viral genomes. BLAST searches revealed the presence of carlavirus, potexvirus, and of known members of the genera Betacarmovirus, Cilevirus, Nepovirus, and Tobamovirus in the sample; confirmed by RT-PCR with virus-specific primers followed by amplicon sequencing. Furthermore, in silico analysis suggested the possibility of a novel soymovirus, and a new hibiscus strain of citrus leprosis virus C2 in the mixed infection. Both RNA dependent RNA polymerase and coat protein gene sequences of the potex and carla viruses shared less than 72% nucleotide and 80% amino acid identities with any alphaflexi- and betaflexi-virus sequences available in GenBank, identifying three novel carlavirus and one potexvirus species in the Hibiscus rosa-sinensis plant. The detection of physalis vein necrosis nepovirus and passion fruit green spot cilevirus in hibiscus are also new reports from Colombia. Overall, the meta-transcriptome analysis identified the complex virome associated with the black spot symptoms on hibiscus leaves and demonstrated the diversity of virus genera tolerated in the mixed infection of a single H. rosa-sinensis plant.
Assuntos
Coinfecção , Hibiscus , Vírus de RNA , Hibiscus/genética , Colômbia , Vírus de RNA/genética , Perfilação da Expressão GênicaRESUMO
Liver fibrosis is the excessive accumulation of extracellular matrix proteins that occurs in most types of chronic liver disease. At the cellular level, liver fibrosis is associated with the activation of hepatic stellate cells (HSCs) which transdifferentiate into a myofibroblast-like phenotype that is contractile, proliferative and profibrogenic. HSC transdifferentiation induces genome-wide changes in gene expression that enable the cell to adopt its profibrogenic functions. We have previously identified that the deubiquitinase ubiquitin C-terminal hydrolase 1 (UCHL1) is highly induced following HSC activation; however, the cellular targets of its deubiquitinating activity are poorly defined. Here, we describe a role for UCHL1 in regulating the levels and activity of hypoxia-inducible factor 1 (HIF1), an oxygen-sensitive transcription factor, during HSC activation and liver fibrosis. HIF1 is elevated during HSC activation and promotes the expression of profibrotic mediator HIF target genes. Increased HIF1α expression correlated with induction of UCHL1 mRNA and protein with HSC activation. Genetic deletion or chemical inhibition of UCHL1 impaired HIF activity through reduction of HIF1α levels. Furthermore, our mechanistic studies have shown that UCHL1 elevates HIF activity through specific cleavage of degradative ubiquitin chains, elevates levels of pro-fibrotic gene expression and increases proliferation rates. As we also show that UCHL1 inhibition blunts fibrogenesis in a pre-clinical 3D human liver slice model of fibrosis, these results demonstrate how small molecule inhibitors of DUBs can exert therapeutic effects through modulation of HIF transcription factors in liver disease. Furthermore, inhibition of HIF activity using UCHL1 inhibitors may represent a therapeutic opportunity with other HIF-related pathologies.
Assuntos
Células Estreladas do Fígado , Subunidade alfa do Fator 1 Induzível por Hipóxia , Cirrose Hepática , Ubiquitina Tiolesterase , Ubiquitina Tiolesterase/genética , Ubiquitina Tiolesterase/metabolismo , Cirrose Hepática/genética , Cirrose Hepática/patologia , Cirrose Hepática/metabolismo , Animais , Células Estreladas do Fígado/metabolismo , Células Estreladas do Fígado/patologia , Subunidade alfa do Fator 1 Induzível por Hipóxia/metabolismo , Subunidade alfa do Fator 1 Induzível por Hipóxia/genética , Camundongos , Humanos , Regulação da Expressão Gênica , Transdiferenciação Celular/genéticaRESUMO
Pseudomonas aeruginosa is an opportunistic pathogen that produces sessile communities known as biofilms that are highly resistant to antibiotic treatment. Limited information is available on the exact role of various components of the matrix in biofilm-associated antibiotic resistance. Here we show that the presence of extracellular polysaccharide reduced the extent of biofilm-associated antibiotic resistance for one class of antibiotics. Minimal bactericidal concentration (MBC) for planktonic and biofilm cells of P. aeruginosa PA14 was measured using a 96 well microtiter plate assay. The MBC of biofilm-grown ΔpelA mutant, which does not produce the Pel polysaccharide, was 4-fold higher for tobramycin and gentamicin, and unchanged for ΔbifA mutant, which overproduces Pel, when compared to the wild type. Biofilms of pelA mutants in two clinical isolates of P. aeruginosa showed 4- and 8-fold higher MBC for tobramycin as compared to wild type. There was no difference in the biofilm resistance of any of these strains when tested with fluoroquinolones. This work forms a basis for future studies revealing the mechanisms of biofilm-associated antibiotic resistance to aminoglycoside antibiotics by P. aeruginosa (AU)
No disponible