Face Value: Remote facial expression analysis adds predictive power to perceived effectiveness for selecting anti-tobacco PSAs.

Perceived effectiveness (PE) is a validated tool for predicting the potential impact of anti-tobacco public service announcements (PSAs). We set out to evaluate the added predictive value of facial expression analysis when combined with PE in a remote (online) survey. Each of 302 tobacco users watched 3 PSAs and allowed transmission of webcam videos from which metrics for "attention" (head position) and "facial action units" (FAU) were computed. The participants completed scales for their subjective emotions, willingness to share on social media, and intention to quit smoking using the Tobacco Free Florida website. Based on PE, both ready to quit (RTQ) and not ready (NR) respondents favored the same PSAs but RTQs assigned higher PE scores. Negative PSAs ("sad" or "frightening") were more compelling overall but RTQs also favored surprising ads and were more willing to share them on social media. Logistic regression showed that the combination of Attention + FAU+ PE (AUC = .816, p < .0001) outperformed single factors or factor combinations in distinguishing RTQ from NR. This study demonstrates that on-line assessment of facial expressions enhances the predictive value of PE and can be deployed on large remote samples.

Advances in plant virus evolution: translating evolutionary insights into better disease management.

Recent studies in plant virus evolution are revealing that genetic structure and behavior of virus and viroid populations can explain important pathogenic properties of these agents, such as host resistance breakdown, disease severity, and host shifting, among others. Genetic variation is essential for the survival of organisms. The exploration of how these subcellular parasites generate and maintain a certain frequency of mutations at the intra- and inter-host levels is revealing novel molecular virus-plant interactions. They emphasize the role of host environment in the dynamic genetic composition of virus populations. Functional genomics has identified host factors that are transcriptionally altered after virus infections. The analyses of these data by means of systems biology approaches are uncovering critical plant genes specifically targeted by viruses during host adaptation. Also, a next-generation resequencing approach of a whole virus genome is opening new avenues to study virus recombination and the relationships between intra-host virus composition and pathogenesis. Altogether, the analyzed data indicate that systematic disruption of some specific parameters of evolving virus populations could lead to more efficient ways of disease prevention, eradication, or tolerable virus-plant coexistence.

Newly Discovered Natural Hosts of Tomato chlorosis virus in Costa Rica.

Tomato chlorosis virus (ToCV) is an emerging whitefly-transmitted crinivirus (2). In Costa Rica in 2007, ToCV was detected in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants causing symptoms of severe yellowing and foliar chlorosis (1). To identify alternative hosts that may serve as virus reservoirs, 78 samples were collected from multiple species of common weeds growing adjacent to tomato nurseries in the Cartago Province, where ToCV was previously identified, during the autumn of 2008 and summer of 2009. The weeds were collected on the basis of the presence of whiteflies and/or symptoms of interveinal chlorosis, but not all samples were symptomatic for infection by ToCV. Total RNA was extracted from leaf tissue with TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed with the Qtaq One-Step qRT-PCR SYBR Kit (Clontech Laboratories, Mountain View, CA) and primers specific for the ToCV HSP70h gene (3). A 123-bp DNA fragment was amplified in five weeds, which were identified taxonomically as Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolacaceae), Plantago major (Plantaginaceae), a Brassica sp. (Brassicaceae) (two samples), and a single plant of Cucurbita moschata (Cucurbitaceae) growing next to those weeds. The amplified DNA fragments were sequenced and BLAST analysis showed 100% nucleotide sequence identity with the HSP70h gene of the Florida ToCV isolate (GenBank Accession No. AY903448). To confirm the presence of ToCV in these six weed samples, conventional RT-PCR reactions were performed using primers specific for the ToCV CPm and p22 genes as described previously (1). Nucleotide sequence analysis of the amplified DNA fragments verified their identity as ToCV, with 100% sequence identity to the CPm of the ToCV isolate of Florida (Accession No. AY903448) and the p22 gene of the Cartago, Costa Rican isolate (Accession No. FJ809714). Although the number of samples analyzed is not sufficient to allow a determination of the role of weed reservoirs in ToCV epidemics in Costa Rican tomato crops, this report on the wider natural host range of ToCV in Costa Rica may lead to a better understanding of the epidemiology of this virus and be useful in the development of disease management strategies. To our knowledge this is the first report of these weeds as natural hosts of ToCV. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) M. I. Font et al. Plant Dis. 88:82, 2004. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008.

Plant production of veterinary vaccines and therapeutics.

Plant-derived biologicals for use in animal health are becoming an increasingly important target for research into alternative, improved methods for disease control. Although there are no commercial products on the market yet, the development and testing of oral, plant-based vaccines is now beyond the proof-of-principle stage. Vaccines, such as those developed for porcine transmissible gastroenteritis virus, have the potential to stimulate both mucosal and systemic, as well as, lactogenic immunity as has already been seen in target animal trials. Plants are a promising production system, but they must compete with existing vaccines and protein production platforms. In addition, regulatory hurdles will need to be overcome, and industry and public acceptance of the technology are important in establishing successful products.

First Report of Tomato chlorosis virus in Tomato in Costa Rica.

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5'-ATGGATCTCACTGGTTGCTTGC-3') and ToCV-p22-R (5'-TTATATATCACTCCCAAAGAAA-3') specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5'-TCTGGCAGTACCCGTTCGTGA-3') and ToCVCPmR (5'-TACCGGCAGTCGTCCCATACC-3') designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5'-GGCGGTACTTTCGACACTTCTT-3') and ToCVHSP70R (5'-ATTAACGCGCAAAACCATCTG-3') designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica.

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5' GAGCGCCGCACAAGTCATC 3' and CYHSPR 5' TACCGCCACCAAAGTCATACATTA 3') of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5' GGCTGGCAACATGGAAACTGA 3' and MYVR 5' CTGAAAAGGCGATGAACTA TTGTG 3') were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

Characterization of a tomato protein kinase gene induced by infection by Potato spindle tuber viroid.

Viroids--covalently closed, circular RNA molecules in the size range of 250 to 450 nucleotides-are the smallest known infectious agents and cause a number of diseases of crop plants. Viroids do not encode proteins and replicate within the nucleus without a helper virus. In many cases, viroid infection results in symptoms of stunting, epinasty, and vein clearing. In our study of the molecular basis of the response of tomato cv. Rutgers to infection by Potato spindle tuber viroid (PSTVd), we have identified a specific protein kinase gene, pkv, that is transcriptionally activated in plants infected with either the intermediate or severe strain of PSTVd, at a lower level in plants inoculated with a mild strain, and not detectable in mock-inoculated plants. A full-length copy of the gene encoding the 55-kDa PKV (protein kinase viroid)-induced protein has been isolated and sequence analysis revealed significant homologies to cyclic nucleotide-dependent protein kinases. Although the sequence motifs in the catalytic domain suggest that it is a serine/threonine protein kinase, the recombinant PKV protein autophosphorylates in vitro on serine and tyrosine residues, suggesting that it is a putative member of the class of dual-specificity protein kinases.

Fibroblast growth factors from bovine pituitary and human placenta and their functions in the maturation of porcine granulosa cells in vitro.

Both acidic and basic fibroblast growth factors (FGFs) are present in pituitary, as demonstrated by Affigel-heparin affinity chromatography and immunoblot analysis. Unlike in the pituitary, only basic FGF appears to be present in human placenta. The purification of these growth factors from bovine pituitary and human placenta has been described. Immunoblot analysis using polyclonal antibodies specific for either basic FGF or both acidic and basic FGF have verified the results of purification. We have determined a novel function of acidic and basic FGF in the maturation of porcine granulosa cells in vitro. Basic FGF (1.0 ng/ml), purified from bovine pituitary functioned as a potent inhibitor of LH/hCG receptor induction (91 +/- 1.2%; P less than 0.0001), and progesterone secretion (45 +/- 2.9%; P less than 0.0001), two key steps in the maturation of granulosa cells. Human placental basic FGF demonstrated comparable inhibition characteristics. Bovine pituitary acidic FGF (50 ng/ml) appear to function as a relatively weak inhibitor (63.5 +/- 5.1% for LH/hCG receptor induction; 50 +/- 1.8% for progesterone secretion). Consequently, our analysis indicates that FGF may play an important role(s) in the maturation of ovarian granulosa cells.

Mechanism of viroid pathogenesis: differential activation of the interferon-induced, double-stranded RNA-activated, M(r) 68,000 protein kinase by viroid strains of varying pathogenicity.

Purified potato spindle tuber viroid (PSTVd) was added to an in vitro assay system containing purified interferon-induced, dsRNA-activated protein kinase (P68). Viroid RNA activated (phosphorylated) the enzyme, although with less efficiency than did the synthetic, perfectly matched poly I-poly C. In binding experiments, RNA transcripts of the intermediate strain of PSTVd were shown to specifically bind to a P68-antibody complex. Activation of the enzyme by a strain of PSTVd that results in severe symptoms in infected tomato plants was at least ten-fold that by the mild strain. Activation by a strain that results in intermediate symptoms was quantitatively similar to activation by the severe strain. To our knowledge, this is the first demonstration of a differential effect of viroid strains inducing different levels of pathology on any biochemical or metabolic system investigated. This differential effect suggests that activation of a plant enzyme homologous to mammalian P68 protein kinase may represent the triggering event in viroid pathogenesis. Differential activation of P68 is surprising, because the primary structures of the mild and severe PSTVd strains analyzed differ by only a two-nucleotide inversion (UUC-->CUU) in the lower portion of the 'pathogenicity' region of the molecules. This change, according to thermodynamic calculations, should have only a minor effect on the secondary structure of the viroid molecule. Binding assays indicated that PSTVd specifically binds to P68.

Genetic variability of genomic RNA 2 of four tobacco rattle tobravirus isolates from potato fields in the Northwestern United States.

Sequence analysis of RNA 2 of four Tobacco rattle virus (TRV) isolates collected from potato fields in Oregon (OR2, Umt1), Washington (BM), and Colorado (Cot2) revealed significant homologies to the ORY isolate from North America. Phylogenetic analysis based on a comparison of nucleotide (nt) and amino acid (aa) sequences with other members of the genus Tobravirus indicates that the North American isolates cluster as a distinct group. All of the RNAs are predicted to contain open reading frames (ORFs) potentially encoding the coat protein (CP, ORF 2a) and 37.6 kDa (ORF 2b) ORFs. In addition, they all contain a region of similarity to the 3' terminus of RNA 1 of ORY, including a truncated portion of the 16 kDa cistron from the 3' end of RNA 1. Three of the isolates, which are nematode transmissible, OR2, BM, and Cot2, also contain a third putative ORF (ORF 2c) which encodes a protein of 33.6 kDa. The fourth isolate, Umt1, which is not nematode transmissible, is the most divergent of the isolates as it encodes a truncated version of ORF 2c. The ORF 2c deletion in Umt1 may contribute to its inability to be transmitted by the vector. The results reported in this article indicate again that the TRV genome is flexible. Interestingly, although both isolates Umt1 and Cot2 were mechanically transmitted to tobacco from potato, only Umt1 exhibits the deletion in RNA 2. TRV Isolate Umt1, therefore, appears to be another example of rapid adaptation of the TRV genome to non-field conditions.

Childhood depression and risk of suicide: a preliminary report of a longitudinal study.

In the course of locating a sample of 427 adults who were assessed as children or adolescents with either major depressive disorder, mixed anxiety states, or no psychiatric disorder (normal controls), we found seven cases of suicide. Of the original sample, we located 159 of the 204 subjects with major depressive disorder (78%), 37 of the 66 subjects with anxiety disorders (56%), and 85 of the 177 normal controls (48%). All seven suicides occurred exclusively among the 159 children located from the major depressive disorder group, yielding a rate of 4.4% over approximately 10 years. Psychological autopsy was conducted in the seven suicide victims to assess the psychological status since the initial assessment and at the time of death. Although the onset of the first depressive episode in these victims was around puberty, the suicides usually did not occur until late adolescence or early adulthood. At least five of the seven subjects had recurrent depressive symptoms and were clinically depressed at the time of death. These preliminary findings suggest that major depressive disorder in childhood has significant mortality by suicide.

Chemiluminescent detection of potato and pome fruit viroids by digoxigenin-labeled dot blot and tissue blot hybridization.

A chemiluminescent molecular hybridization protocol was compared to 32P autoradiography for detecting potato spindle tuber viroid (PSTVd) and apple scar skin group viroids (ASSVd). Labeled cRNA probes for PSTVd and ASSVd were synthesized by SP6 RNA polymerase transcription using digoxigenin-11-UTP or alpha-[32P]UTP. Dot blot hybridization of purified viroids and sap extracts from infected plants showed that chemiluminescent detection using digoxigenin-labeled probes was as sensitive as autoradiography using 32P probes. A minimum of 2.0-2.5 pg purified viroid was detected. ASSVd could be detected in as little as 0.4 ng of total nucleic acid extract from infected tissue or in sap extracts diluted to 10(-3) with healthy extracts. Tissue blots of PSTVd-infected potato tubers and tomato roots, stems and leaves and ASSVd-infected apple fruit, stems and petioles, gave positive reactions when hybridized with the digoxigenin probe. No reaction with similar tissues from healthy plants was observed.

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

The effect of caffeine on the accommodative response/accommodative stimulus function and on the response AC/A ratio.

Using a phoro-accommodometer, accommodation and convergence responses were measured for 17 experimental subjects before and after they ingested 200 mg caffeine. For 16 control subjects accommodation and convergence responses were determined at two test sessions separated by 45 min. For the experimental group, the accommodative response/accommodative stimulus (Ar/As) slope increased 0.05 D/D after ingestion of caffeine, and the response AC/A ratio decreased 3.05 delta/D. The y-intercept of the convergence response/accommodative response increased by 3.7 delta in the experimental group. These changes were statistically significant. For the control group, the differences in Ar/As slope, response AC/A ratio, and convergence response/accommodative response y-intercept between first and second test sessions were not statistically significant.

Effect of a pharmacist-education initiative on ketorolac use and costs in a Medicaid program.

The effects of a pharmacist-education initiative on the use and costs of ketorolac in a state Medicaid program are reviewed. An intervention letter describing changes in the manufacturer's prescribing guidelines for ketorolac and providing suggestions for interacting with physicians regarding the use of ketorolac was sent to 150 of the 301 pharmacies that participate in New Mexico's Medicaid program. The remaining 151 pharmacies served as a control group. Ketorolac claims records for three months before and after the intervention were reviewed. The mean quantity of ketorolac tablets, total days' supply, and number of prescriptions filled per pharmacy per month were calculated for both periods. The number of prescriptions not filled as a result of the intervention as well as the number that could have been avoided, the number of cases of peptic ulceration (ketorolac's major adverse effect) that would be avoided, and the associated cost savings if all the state's Medicaid pharmacies had been included in the intervention were estimated. A total of 167 pharmacies (90 intervention and 77 control) dispensed ketorolac for Medicaid patients during the study period. Ketorolac dispensing rates declined during the postintervention period in both the intervention group and the control group, but the reduction was greater in the intervention group. It was predicted that if all pharmacies were included in an intervention, 135.6 fewer prescriptions for ketorolac would be filled each year; as a result, 1.14 cases of peptic ulceration would be avoided and net Medicaid costs would be reduced by $1638. Sending educational letters to pharmacists was associated with a modest reduction in ketorolac use in a state Medicaid program; a net reduction in Medicaid costs if the intervention were extended to all pharmacies that participate in the state's Medicaid program was projected.

Role of Maize rayado fino virus in the Etiology of "Red Stunt" Disease in Brazil.

Corn production in several areas of Brazil recently has been seriously afflicted by a disease commonly referred to as "red stunt," characterized by stunting and leaf reddening. Early observations that a phytoplasma was associated with the disease were confirmed through molecular analysis, which revealed the presence of maize bushy stunt phytoplasma (MBS) (1). Another disease of corn, corn stunt, is considered to be caused by one or more of a complex of MBS, corn stunt spiroplasma (CSS), and Maize rayado fino virus (MRFV), which can all be transmitted simultaneously by their leafhopper vector Dalbulus maidis (Delong & Wolcott). The contributions of CSS and MRFV to the recently described "red stunt" disease in Brazil are unknown. A virus serologically related to MRFV, Brazilian corn streak virus, was first identified in Sao Paulo State, Brazil, in the early 1970s; serological studies indicated that isolates of Brazilian corn streak virus were related to, but distinguishable from, MRFV isolates from other Latin American countries (4). Therefore, there was a high probability that MRFV would be found in maize tissues collected from plants exhibiting symptoms of "red stunt" disease. Maize leaf samples exhibiting symptoms of "red stunt" disease were collected and preserved by drying from four Brazilian States during 1995 and 1996 (1). Total nucleic acid extracts were prepared from dried leaf tissue and aliquots of the extracts were spotted onto a nylon membrane, which subsequently was hybridized to an MRFV-specific cRNA probe (3). Of the 37 samples tested for the presence of MRFV by nucleic acid hybridization, 16 were positive for MRFV. It was present in some, but not all, samples that were positive for MBS (1). MBS was detected in six, and CSS was detected by polymerase chain reaction (PCR) (2) in 12 samples. In 8 of the 37 samples, both CSS and MRFV were present, 4 of 37 were positive for MBS and MRFV, and in 3 of 37 samples, all three pathogens were detected. Therefore, there is not a clear correlation between the presence of MRFV and the symptoms of "red stunt." The coat protein gene and adjacent 3' nontranslated region of MRFV were amplified from infected tissues by reverse transcription-polymerase chain reaction (RT-PCR) using MRFV-specific primers (3). Three cloned PCR products were sequenced (deposited at GenBank under accession nos. AF186177 to AF186179), which revealed that the nucleotide sequences of the Brazilian isolates were 98% sequence identical and shared 90 to 97% identity with other MRFV isolates (3). Phylogenetic analysis of the sequences revealed close relationships to MRFV isolates from Peru and Bolivia, which neighbor Brazil (3). The contribution of MRFV to the stunting and leaf reddening symptoms exhibited by maize plants with "red stunt" disease is unknown. Of the 37 samples examined in this study, MRFV was detected in 16. A more complete epidemiological study of the association of MBS, CSS, MRFV, and their insect vector with "red stunt" disease will provide information on the significance of these pathogens in the current disease outbreak. References: (1) I. P. Bedendo et al. Plant Dis. 81:957, 1997. (2) R. E. Davis and E. L. Dally (Abstr.), Phytopathology 88:S20, 1998. (3) R. W. Hammond et al. J. Gen. Virol. 78:3153, 1997. (4) E. W. Kitajima et al. Proc. Am. Phytopathol. Soc. 2:76, 1975.

Occurrence of citrus viroids in Costa Rica.

A survey for citrus viroids was conducted in the major citrus commercial growing areas in Costa Rica. Screening of 36 sweet orange and 12 lemon trees resulted in the detection of members of four of the five citrus viroid groups as determined by nucleic acid hybridization using specific RNA probes and polymerase chain reaction (PCR) using specific oligonucleotide primers. CEVd, CVd-IIa, CVD-IIb and CVd-III viroids were found to be widespread in the three main regions of commercial citrus production. CVd-Ib was only found in lemon in Nicoya.