RESUMO
A novel Ho(3+)Yb(3+)-codoped PbF(2) mid-IR laser crystal was successfully grown and analyzed. Enhanced emission at 2.86 µm was observed from the crystal under excitation of a common 970 nm laser diode for the first time. The effect of Yb(3+) codoping on the 2.86 µm photoluminescence of Ho(3+) was investigated. In comparison to Ho(3+)-singly doped PbF(2) crystal, the Ho(3+)/Yb(3+)-codoped PbF(2) crystal possessed comparable quantum efficiency (88.8%), and fluorescence branching ratio (20.52%) along with a larger calculated emission cross section (1.90×10(-20) cm(2)) corresponding to the laser transition (5)I(6)â(5)I(7) of Ho(3+). It was found that the introduced Yb(3+) enhanced the 2.86 µm emission by depopulating the Ho(3+):(5)I(7) level. The energy transfer (ET) efficiency from Yb(3+):(2)F(5/2) to Ho(3+):(5)I(6) is as high as 96.7%, indicating that Yb(3+) ion is an effective sensitizer for Ho(3+) ion in PbF(2) crystal. These results suggest that Ho(3+)/Yb(3+)-codoped PbF(2) crystal may become an attractive host for developing solid state lasers at around 2.86 µm under a conventional 970 nm LD pump.
RESUMO
A novel Dy(3+)/Yb(3+) co-doped PbF2 mid-IR laser crystal was successfully grown using the vertical Bridgman method. Efficient emission at around 3 µm from the crystal was observed under excitation of a conventional 970 nm laser diode (LD). The energy transfer efficiency from Yb(3+) to Dy(3+) in Dy(3+)/Yb(3+):PbF2 crystal is as high as (97.7±0.3)%. It is also found that the Dy(3+)/Yb(3+):PbF2 crystal possesses long fluorescence lifetime (15.4±0.2) ms, high quantum efficiency (95.0±0.3)%, and large emission cross section (1.37±0.11)×10(-20) cm2 corresponding to the stimulated emission of Dy(3+):(6)H(13/2)â(6)H(15/2) transition. Additionally, the phonon energy of the crystal was analyzed by the Raman spectrum. These results indicate that Dy(3+)/Yb(3+):PbF2 crystal may become a promising material for 3 µm solid state lasers under a conventional 970 nm LD pump.
RESUMO
High optical quality (Tb((1-x))Ce(x))3Ga5O12 (TCGG) single crystal has been grown by the Czochralski method. The optical and magneto-optical properties of the TCGG are analyzed in detail and the Verdet constant (V) of TCGG is compared with that of undoped terbium gallium garnet (TGG) crystal. TCGG presents a very high transmittance, particularly in the visible-near infrared (VIS-NIR) region, and its V is obviously larger than that of TGG in the VIS-NIR region. The figure of merit and optical features point out the superior characteristics of TCGG with respect to TGG.
RESUMO
A Ho³âº-doped PbF2 mid-IR laser crystal was successfully grown using the vertical Bridgman method. An intense 2.8 µm emission in Ho:PbF2 crystal was observed for the first time. By analyzing the absorption and emission measurements of the Ho:PbF2 crystal with the Judd-Ofelt theory, the intensity parameters Ω(2,4,6), exited state lifetimes, branching ratios, and emission cross-sections were calculated. It is found that the Ho:PbF2 crystal has high fluorescence branching ratio (20.99%), large emission cross section (1.44×10⻲° cm²), long fluorescence lifetime (5.4 ms), and high quantum efficiency (88.4%) corresponding to the stimulated emission of Ho³âº: 5I6â5I7 transition. The structure of Ho:PbF2 crystal was also analyzed by the Raman spectrum, and it was found that the Ho:PbF2 crystal possesses low phonon energy of 257 cm⻹. We propose that the Ho:PbF2 crystal may be a promising material for 2.8 µm laser applications.
Assuntos
Fluoretos , Hólmio , Lasers de Estado Sólido , Chumbo , Cristalização , Fenômenos Ópticos , Espectrometria de Fluorescência , Espectrofotometria InfravermelhoRESUMO
Magnetic nanoparticles (MNPs) have found extensive application in the biomedical domain due to their enhanced biocompatibility, minimal toxicity, and strong magnetic responsiveness. MNPs exhibit great potential as nanomaterials in various biomedical applications, including disease detection and cancer therapy. Typically, MNPs consist of a magnetic core surrounded by surface modification coatings, such as inorganic materials, organic molecules, and polymers, forming a nucleoshell structure that mitigates nanoparticle agglomeration and enhances targeting capabilities. Consequently, MNPs exhibit magnetic responsiveness in vivo for transportation and therapeutic effects, such as enhancing medical imaging resolution and localized heating at the site of injury. MNPs are utilized for specimen purification through targeted binding and magnetic separation in vitro, thereby optimizing efficiency and expediting the process. This review delves into the distinctive functional characteristics of MNPs as well as the diverse bioactive molecules employed in their surface coatings and their corresponding functionalities. Additionally, the advancement of MNPs in various applications is outlined. Additionally, we discuss the advancements of magnetic nanoparticles in medical imaging, disease treatment, and in vitro assays, and we anticipate the future development prospects and obstacles in this field. The objective is to furnish readers with a thorough comprehension of the recent practical utilization of MNPs in biomedical disciplines.
RESUMO
Microparticle-enhanced cultivation was used to enhance the production of exopolysaccharides (EPSs) from Antrodia cinnamomea. The structure and antibacterial activity of two EPSs produced by A. cinnamomea treated with Al2O3 [EPS-Al (crude) and EPS-Al-p (purified)] and without Al2O3 [EPS-C (crude) and EPS-C-p (purified)] were compared. It was observed that the addition of 4 g/L Al2O3 at 0 h resulted in the highest EPS yield of 1.46 g/L, possible attributed to the enhanced permeability of the cell membrane. The structural analysis revealed that EPS-C-p and EPS-Al-p had different structures. EPS-C-p was hyperbranched and spherical with a Mw of 10.8 kDa, while EPS-Al-p was irregular and linear with a Mw of 12.5 kDa. The proportion of Man in EPS-Al-p decreased, while those of Gal and Glc increased when compared to EPS-C-p. The total molar ratios of 6-Glcp and 4-Glcp in EPS-Al-p are 1.45 times that of EPS-C-p. Moreover, EPSs could alter bacterial cell morphology, causing intracellular substance leakage and growth inhibition, with EPS-Al having a stronger antibacterial activity than EPS-C. In conclusion, A. cinnamomea treated with Al2O3 could produce more EPSs, changing monosaccharide composition and glycosidic linkage profile, which could exert stronger antibacterial activity than that produced by untreated A. cinnamomea.
Assuntos
Antrodia , Polyporales , Humanos , Polyporales/metabolismo , Monossacarídeos/análise , Antrodia/química , Polissacarídeos Bacterianos/químicaRESUMO
Most psoriasis-related genes or loci identified by GWAS represent common clusters and are located in noncoding regions of the human genome, providing only limited evidence for the roles of rare coding variants in psoriasis. Two exome-wide case-control genotyping data sets (11,245 cases and 11,177 controls) were obtained from our previous study. Quality controls were established for each data set, and the markers remaining in each set were annotated using ANNOVAR. Gene-based analysis was performed on the annotation results. A total of 250 and 35 genes in the Exome_Fine and Exome_Asian array cohorts, respectively, exceeded the threshold (P < 4.43 × 10-6). Merged gene-based analysis was then conducted on the same set of SNPs from seven genes common to both arrays, and the chi-square test was used to confirm all gene-based results. Ultimately, four susceptibility genes were identified: BBS7 (Pcombine = 1.38 × 10-29), GSTCD (Pcombine = 8.35 × 10-47), LIPK (Pcombine = 1.02 × 10-19), and PPP4R3B (Pcombine = 1.79 × 10-33). This study identified four susceptibility genes for psoriasis via a gene-based method using rare variants, contributing to our understanding of the pathogenesis of psoriasis.
Assuntos
Etnicidade , Estudo de Associação Genômica Ampla/métodos , Polimorfismo de Nucleotídeo Único , Psoríase/genética , China/epidemiologia , Exoma , Feminino , Marcadores Genéticos/genética , Predisposição Genética para Doença , Genótipo , Humanos , Masculino , Psoríase/etnologia , Psoríase/metabolismoRESUMO
BACKGROUND: This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. METHODS: Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ 2- and Fisher's tests were used to analyze the genotype-phenotype correlations. RESULTS: (1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype-phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021). CONCLUSIONS: This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.
RESUMO
OBJECTIVE: The IKBKE has been proven to be associated with systemic lupus erythematosus (SLE) in a genome-wide association study (GWAS) conducted by our group. The objective of the recent study is to investigate the contribution of IKBKE functional variants (rs2297550) to SLE. METHODS: We detected the regulatory effect of rs2297550 on IKBKE expression by expression quantitative trait loci (eQTL) study. Then, we investigated the differences of IKBKE mRNA expression levels in peripheral blood mononuclear cells (PBMCs) between 135 SLE patients and 130 healthy controls using quantitative real-time PCR (qRT-PCR). We further analyzed the association of SLE clinical characteristics with IKBKE mRNA expression and rs2297550 polymorphisms. RESULTS: The results of eQTL indicated the genotype "GG" of single-nucleotide polymorphism (SNP) rs2297550 was associated with lower expression levels of IKBKE (P = 0.022) in normal controls. Compared with the healthy control group, the expression levels of IKBKE mRNA in patients with SLE were significantly decreased (P = 2.32 × 10-12). In clinical characteristics, we found that IKBKE mRNA expression levels were associated with vasculitis (P = 0.015) and increased C-reactive protein (CRP) (P = 0.021) in SLE patients. CONCLUSION: In this study, we not only detected that the variant rs2297550 of IKBKE may be closely related to SLE, but also proposed functional hypotheses for the association signals. Key Points ⢠The rs2297550 is located in a region with transcriptional regulatory function and may regulate the expression of IKBKE via these regulatory elements. ⢠The genotype "GG" of SNP rs2297550 was associated with lower expression levels of IKBKE. ⢠The expression of IKBKE mRNA was decreased in SLE patients compared with healthy controls. ⢠IKBKE contributes to the clinical characteristics of SLE.
Assuntos
Estudo de Associação Genômica Ampla , Lúpus Eritematoso Sistêmico , Estudos de Casos e Controles , Predisposição Genética para Doença , Humanos , Quinase I-kappa B/genética , Leucócitos Mononucleares , Lúpus Eritematoso Sistêmico/genética , Polimorfismo de Nucleotídeo ÚnicoRESUMO
Lysine 2-hydroxyisobutyrylation is a newly discovered posttranslational modification. Although this modification is an important type of protein acylation, its role in psoriasis remains unstudied. We compared lesional and nonlesional psoriasis skin samples from 45 psoriasis patients. The result showed that this highly conserved modification was found in large quantities in both normal and diseased dermal tissues. However, there were a number of clear and significant differences between normal and diseased skin tissue. By comparing, lysine 2-hydroxyisobutyrylation was upregulated at 94 sites in 72 proteins and downregulated at 51 sites in 44 proteins in lesional skin. In particular, the sites with the most significant downregulation of lysine 2-hydroxyisobutyrylation were found in S100A9 (ratioâ¯=â¯0.140, p-valueâ¯=â¯.000371), while the most upregulated site was found in tenascin (ratioâ¯=â¯3.082, p-valueâ¯=â¯.0307). Loci associated with psoriasis, including FUBP1, SERPINB2 and S100A9, also exhibited significant regulation. Analyses of proteome data revealed that SERPINB2 and S100A9 were differentially expressed proteins. And bioinformatics analysis suggest that the P13K-Akt signaling pathway was more enriched with lysine 2-hydroxyisobutyrylation in lesional psoriasis skin. Our study revealed that lysine 2-hydroxyisobutyrylation is broadly present in psoriasis skin, suggesting that this modification plays a role in psoriasis pathogenesis. SIGNIFICANCE: A newly discovered protein posttranslational modification, lysine 2-hydroxyisobutyrylation, has been found to occur in a wide variety of organisms and to participate in some important metabolic processes. In this study, lysine 2-hydroxyisobutyrylation in lesional psoriasis skin and nonlesional psoriasis skin was quantified and compared for the first time. We found a number of differentially modified proteins and sites in our comparisons. Interestingly, some of the identified proteins and pathways with significantly different modifications, such as S100A9 and the PI3K-Akt signaling pathway, have been previously reported to be associated with psoriasis. We hope that this research will provide new insights into psoriasis.