VP1 codon deoptimization and high-fidelity substitutions in 3D polymerase as potential vaccine strategies for eliciting immune responses against enterovirus A71.

Enterovirus A71 (EV-A71) can induce severe neurological complications and even fatal encephalitis in children, and it has caused several large outbreaks in Taiwan since 1998. We previously generated VP1 codon-deoptimized (VP1-CD) reverse genetics (rg) EV-A71 viruses (rgEV-A71s) that harbor a high-fidelity (HF) 3D polymerase. These VP1-CD-HF rgEV-A71s showed lower replication kinetics in vitro and decreased virulence in an Institute of Cancer Research (ICR) mouse model of EV-A71 infection, while still retaining their antigenicity in comparison to the wild-type virus. In this study, we aimed to further investigate the humoral and cellular immune responses elicited by VP1-CD-HF rgEV-A71s to assess the potential efficacy of these EV-A71 vaccine candidates. Following intraperitoneal (i.p.) injection of VP1-CD-HF rgEV-A71s in mice, we observed a robust induction of EV-A71-specific neutralizing IgG antibodies in the antisera after 21 days. Splenocytes isolated from VP1-CD-HF rgEV-A71s-immunized mice exhibited enhanced proliferative activities and cytokine production (IL-2, IFN-γ, IL-4, IL-6, and TNF-α) upon re-stimulation with VP1-CD-HF rgEV-A71, as compared to control mice treated with adjuvant only. Importantly, administration of antisera from VP1-CD-HF rgEV-A71s-immunized mice protected against lethal EV-A71 challenge in neonatal mice. These findings highlight that our generated VP1-CD-HF rgEV-A71 viruses are capable of inducing both cellular and humoral immune responses, supporting their potential as next-generation EV-A71 vaccines for combating EV-A71 infection.IMPORTANCEEV-A71 can cause severe neurological diseases and cause death in young children. Here, we report the development of synthetic rgEV-A71s with the combination of codon deoptimization and high-fidelity (HF) substitutions that generate genetically stable reverse genetics (rg) viruses as potential attenuated vaccine candidates. Our work provides insight into the development of low-virulence candidate vaccines through a series of viral genetic editing for maintaining antigenicity and genome stability and suggests a strategy for the development of an innovative next-generation vaccine against EV-A71.

Long Non-Coding RNA H19 Leads to Upregulation of γ-Globin Gene Expression during Erythroid Differentiation.

Long noncoding RNAs (lncRNAs) are important because they are involved in a variety of life activities and have many downstream targets. Moreover, there is also increasing evidence that some lncRNAs play important roles in the expression and regulation of γ-globin genes. In our previous study, we analyzed genetic material from nucleated red blood cells (NRBCs) extracted from premature and full-term umbilical cord blood samples. Through RNA sequencing (RNA-Seq) analysis, lncRNA H19 emerged as a differentially expressed transcript between the two blood types. While this discovery provided insight into H19, previous studies had not investigated its effect on the γ-globin gene. Therefore, the focus of our study was to explore the impact of H19 on the γ-globin gene. In this study, we discovered that overexpressing H19 led to a decrease in HBG mRNA levels during erythroid differentiation in K562 cells. Conversely, in CD34+ hematopoietic stem cells and human umbilical cord blood-derived erythroid progenitor (HUDEP-2) cells, HBG expression increased. Additionally, we observed that H19 was primarily located in the nucleus of K562 cells, while in HUDEP-2 cells, H19 was present predominantly in the cytoplasm. These findings suggest a significant upregulation of HBG due to H19 overexpression. Notably, cytoplasmic localization in HUDEP-2 cells hints at its potential role as a competing endogenous RNA (ceRNA), regulating γ-globin expression by targeting microRNA/mRNA interactions.

Evaluating the Clinical Utility of a Long-Read Sequencing-Based Approach in Prenatal Diagnosis of Thalassemia.

BACKGROUND: The aim is to evaluate the clinical utility of a long-read sequencing-based approach termed comprehensive analysis of thalassemia alleles (CATSA) in prenatal diagnosis of thalassemia. METHODS: A total of 278 fetuses from at-risk pregnancies identified in thalassemia carrier screening by PCR-based methods were recruited from 9 hospitals, and PCR-based methods were employed for prenatal diagnosis. CATSA was performed retrospectively and blindly for all 278 fetuses. RESULTS: Among the 278 fetuses, 263 (94.6%) had concordant results and 15 (5.4%) had discordant results between the 2 methods. Of the 15 fetuses, 4 had discordant thalassemia variants within the PCR detection range and 11 had additional variants identified by CATSA. Independent PCR and Sanger sequencing confirmed the CATSA results. In total, CATSA and PCR-based methods correctly detected 206 and 191 fetuses with variants, respectively. Thus, CATSA yielded a 7.9% (15 of 191) increment as compared with PCR-based methods. CATSA also corrected the predicted phenotype in 8 fetuses. Specifically, a PCR-based method showed one fetus had homozygous HBB c.52A > T variants, while CATSA determined the variant was heterozygous, which corrected the predicted phenotype from ß-thalassemia major to trait, potentially impacting the pregnancy outcome. CATSA additionally identified α-globin triplicates in 2 fetuses with the heterozygous HBB c.316-197C > T variant, which corrected the predicted phenotype from ß-thalassemia trait to intermedia and changed the disease prognosis. CONCLUSIONS: CATSA represents a more comprehensive and accurate approach that potentially enables more informed genetic counseling and improved clinical outcomes compared to PCR-based methods.

Carotid Siphon Calcification Predicts the Symptomatic Progression in Branch Artery Disease With Intracranial Artery Stenosis-Brief Report.

BACKGROUND: Arterial calcification in the aortic arch, carotid bifurcation, or siphon on computed tomography was associated with cardiovascular disease. The association between arterial calcification prevalence and progression of branch atheromatous disease (BAD) in intracranial artery atherosclerosis was little investigated. METHODS: This study included 310 patients with ischemic stroke from one stroke center. Patients were divided into BAD (110) and non-BAD groups (200). Baseline characteristics, lipids, and arterial calcification were measured. The primary outcome was the prevalence of arterial calcification in BAD progression, and the secondary outcome was the prevalence of calcification in arterial stenosis. The association or correlation among calcification prevalence, lipid markers, and BAD progression was analyzed using logistic regression, receiver operating characteristic curve, and linear regression. RESULTS: Our study found that carotid siphon calcification on computed angiography was more prevalent (P=0.01) in patients with BAD and also more prevalent (P<0.001) in intracranial artery stenosis, and its computed tomography values could independently predict the symptomatic progression (P=0.01). Furthermore, a strong linear correlation between oxidized lipid and calcification density was found (beta=-0.73, P=0.0048) in patients with BAD, a subtype (B-type) of intracranial arterial atherosclerotic disease. CONCLUSIONS: We found that carotid siphon calcification was associated with BAD and its computed tomography values could predict the symptomatic progression in patients with intracranial arterial atherosclerotic disease and BAD, indicating the important role of carotid calcification in B-type intracranial arterial atherosclerotic disease. REGISTRATION: URL: http://www.chictr.org.cn; Unique identifier: ChiCTR1800018315.

Correlations between Multiple SNPs and HbF Levels in ß-Thalassemia Carriers.

BACKGROUND: Increased hemoglobin F (HbF) expression in individuals with ß-thalassemia contributes to the alleviation of pathological phenomena and the reduction of mortality. We have investigated the correlation between six single nucleotide polymorphisms (SNPs) in BCL11A, XmnI-HBG2, HBS1L-MYB, and ANTXR1 and the levels of HbF in ß-thalassemia carriers. METHODS: Samples were collected from 330 cases of ß-thalassemia carriers. The genotypes of the rs4671393, rs-7482144, rs28384513, rs4895441, rs9399137, and rs4527238 were determined using Sanger sequencing. RESULTS: The results both of quantitative and qualitative analysis showed that rs4671393 (BCL11A), rs7482144 (Xmn1-HBG2), and rs9399137 (HBS1L-MYB) in ß-thalassemia carriers correlated with the levels of HbF (p < 0.05), only rs28384513 (HBS1L-MYB) and rs4527238 (ANTXR1) were associated with HbF expression in ß-thalassemia minor (p < 0.05). CONCLUSIONS: These results indicate that the SNP rs4527238 in the ANTXR1 gene was found likely to play a role as a modulator of HbF levels in ß-thalassemia carriers for the first time.

A Rare Case of Abnormal Hemoglobin Variant Hb Mizuho: [HBB: c.206T > C ß 68(E12) Leu-Pro]: A First Report in the Chinese Population.

A 6-month-old female infant presented with unexplained hemolytic anemia, showing no abnormalities by capillary electrophoresis and genetic testing for α- and ß-thalassemia mutations that are commonly seen in the Chinese population. A rare Hb Mizuho: [HBB: c.206T > C ß 68(E12) Leu- Pro] variant was identified by next-generation sequencing (NGS) and verified by Sanger sequencing. Hb Mizuho: [HBB: c.206T > C ß 68(E12) Leu- Pro] is not easily detectable because it is extremely unstable, and the correct diagnosis is usually made via DNA sequencing. This is the first report of this variant in the Chinese population.

An auto-antibody identified from phenotypic directed screening platform shows host immunity against EV-A71 infection.

BACKGROUND: Enterovirus A71 (EV-A71) is a neurotropic virus which may cause severe neural complications, especially in infants and children. The clinical manifestations include hand-foot-and-mouth disease, herpangina, brainstem encephalitis, pulmonary edema, and other severe neurological diseases. Although there are some vaccines approved, the post-marketing surveillance is still unavailable. In addition, there is no antiviral drugs against EV-A71 available. METHODS: In this study, we identified a novel antibody that could inhibit viral growth through a human single chain variable fragment (scFv) library expressed in mammalian cells and panned by infection with lethal dose of EV-A71. RESULTS: We identified that the host protein α-enolase (ENO1) is the target of this scFv, and anti-ENO1 antibody was found to be more in mild cases than severe EV-A71 cases. Furthermore, we examined the antiviral activity in a mouse model. We found that the treatment of the identified 07-human IgG1 antibody increased the survival rate after virus challenge, and significantly decreased the viral RNA and the level of neural pathology in brain tissue. CONCLUSIONS: Collectively, through a promising intracellular scFv library expression and screening system, we found a potential scFv/antibody which targets host protein ENO1 and can interfere with the infection of EV-A71. The results indicate that the usage and application of this antibody may offer a potential treatment against EV-A71 infection.

Whole-exome sequencing identified five novel de novo variants in patients with unexplained intellectual disability.

BACKGROUND: Intellectual disability (ID) represents a neurodevelopmental disorder, which is characterized by marked defects in the intellectual function and adaptive behavior, with an onset during the developmental period. ID is mainly caused by genetic factors, and it is extremely genetically heterogeneous. This study aims to identify the genetic cause of ID using trio-WES analysis. METHODS: We recruited four pediatric patients with unexplained ID from non-consanguineous families, who presented at the Department of Pediatrics, Guizhou Provincial People's Hospital. Whole-exome sequencing (WES) and Sanger sequencing validation were performed in the patients and their unaffected parents. Furthermore, conservative analysis and protein structural and functional prediction were performed on the identified pathogenic variants. RESULTS: We identified five novel de novo mutations from four known ID-causing genes in the four included patients, namely COL4A1 (c.2786T>A, p.V929D and c.2797G>A, p.G933S), TBR1 (c.1639_1640insCCCGCAGTCC, p.Y553Sfs*124), CHD7 (c.7013A>T, p.Q2338L), and TUBA1A (c.1350del, p.E450Dfs*34). These mutations were all predicted to be deleterious and were located at highly conserved domains that might affect the structure and function of these proteins. CONCLUSION: Our findings contribute to expanding the mutational spectrum of ID-related genes and help to deepen the understanding of the genetic causes and heterogeneity of ID.

Influenza a virus NS1 resembles a TRAF3-interacting motif to target the RNA sensing-TRAF3-type I IFN axis and impair antiviral innate immunity.

BACKGROUND: Influenza A virus (IAV) evolves strategies to counteract the host antiviral defense for establishing infection. The influenza A virus (IAV) non-structural protein 1 (NS1) is a key viral factor shown to counteract type I IFN antiviral response mainly through targeting RIG-I signaling. Growing evidence suggests that viral RNA sensors RIG-I, TLR3, and TLR7 function to detect IAV RNA in different cell types to induce type I IFN antiviral response to IAV infection. Yet, it remains unclear if IAV NS1 can exploit a common mechanism to counteract these RNA sensing pathways to type I IFN production at once, then promoting viral propagation in the host. METHODS: Luciferase reporter assays were conducted to determine the effect of NS1 and its mutants on the RIG-I and TLR3 pathways to the activation of the IFN-ß and NF-κB promoters. Coimmunoprecipitation and confocal microscopic analyses were used to the interaction and colocalization between NS1 and TRAF3. Ubiquitination assays were performed to study the effect of NS1 and its mutants on TRAF3 ubiquitination. A recombinant mutant virus carrying NS1 E152A/E153A mutations was generated by reverse genetics for biochemical, ex vivo, and in vivo analyses to explore the importance of NS1 E152/E153 residues in targeting the RNA sensing-TRAF3-type I IFN axis and IAV pathogenicity. RESULTS: Here we report that NS1 subverts the RIG-I, TLR3, and TLR7 pathways to type I IFN production through targeting TRAF3 E3 ubiquitin ligase. NS1 harbors a conserved FTEE motif (a.a. 150-153), in which the E152/E153 residues are critical for binding TRAF3 to block TRAF3 ubiquitination and type I IFN production by these RNA sensing pathways. A recombinant mutant virus carrying NS1 E152A/E153A mutations induces higher type I IFN production ex vivo and in vivo, and exhibits the attenuated phenotype in infected mice, indicating the importance of E152/E153 residues in IAV pathogenicity. CONCLUSIONS: Together our work uncovers a novel mechanism of IAV NS1-mediated immune evasion to promote viral infection through targeting the RNA sensing-TRAF3-type I IFN axis.

Two novel mutations in PADI6 and TLE6 genes cause female infertility due to arrest in embryonic development.

PURPOSE: This study aims to identify genetic causes of female infertility associated with recurrent failure of assisted reproductive technology (ART) characterized by embryonic developmental arrest. METHODS: We recruited infertile patients from two consanguineous families from the Reproductive Medicine Center of Guizhou Provincial People's Hospital. Peripheral blood was collected for genomic DNA extraction. Two affected individuals and their family members were performed with whole-exome sequencing and Sanger validation in order to identify possible causative genes. For further analyzing the effect of splicing mutation on mRNA integrity in vivo, TLE6 cDNA from the peripheral blood lymphocyte of the affected individual was sequenced. In addition, the possible impact of the pathogenic mutation on the structure and function of the protein were also assessed. RESULTS: Two novel homozygous mutations in the peptidylarginine deiminase type VI (PADI6) and the transducin-like enhancer of split 6 (TLE6) genes were identified in the two families. One patient carried the frameshift deletion mutation c.831_832del:p.S278Pfs*59 of the PADI6 gene and the other patient carried the splicing mutation c.1245-2 A>G of the TLE6 gene. The analysis of the mRNA from the proband's peripheral blood leukocytes confirmed aberrant splicing. CONCLUSIONS: Our findings expand the mutational spectrum of PADI6 and TLE6 associated with embryonic developmental arrest and deepen our understanding of the genetic causes of infertility with recurrent ART failure.

Enterovirus A71 Containing Codon-Deoptimized VP1 and High-Fidelity Polymerase as Next-Generation Vaccine Candidate.

Enterovirus A71 (EV-A71) is a major pathogen that causes hand-foot-and-mouth disease (HFMD), which occasionally results in severe neurological complications. In this study, we developed four EV-A71 (rgEV-A71) strains by reverse genetics procedures as possible vaccine candidates. The four rgEV-A71 viruses contained various codon-deoptimized VP1 capsid proteins (VP1-CD) and showed replication rates and antigenicity similar to that of the wild-type virus, while a fifth virus, rg4643C4VP-CD, was unable to form plaques but was still able to be examined by median tissue culture infectious dose (TCID50) titers, which were similar to those of the others, indicating the effect of CD on plaque formation. However, the genome stability showed that there were some mutations which appeared during just one passage of the VP1-CD viruses. Thus, we further constructed VP1-CD rgEV-A71 containing high-fidelity determinants in 3D polymerase (CD-HF), and the number of mutations in CD-HF rgEV-A71 was shown to have decreased. The CD-HF viruses showed less virulence than the parental strain in a mouse infection model. After 14 days postimmunization, antibody titers had increased in mice infected with CD-HF viruses. The mouse antisera showed similar neutralizing antibody titers against various CD-HF viruses and different genotypes of EV-A71. The study demonstrates the proof of concept that VP1 codon deoptimization combined with high-fidelity 3D polymerase decreased EV-A71 mutations and virulence in mice but retained their antigenicity, indicating it is a good candidate for next-generation EV-A71 vaccine development.IMPORTANCE EV-A71 can cause severe neurological diseases with fatality in infants and young children, but there are still no effective drugs to date. Here, we developed a novel vaccine strategy with the combination of CD and HF substitutions to generate the genetically stable reverse genetics virus. We found that CD combined with HF polymerase decreased the virulence but maintained the antigenicity of the virus. This work demonstrated the simultaneous introduction of CD genome sequences and HF substitutions as a potential new strategy to develop attenuated vaccine seed virus. Our work provides insight into the development of a low-virulence candidate vaccine virus through a series of genetic editing of virus sequences while maintaining its antigenicity and genome stability, which will provide an additional strategy for next-generation vaccine development of EV-A71.

Genetic variations on 31 and 450 residues of influenza A nucleoprotein affect viral replication and translation.

BACKGROUND: Influenza A viruses cause epidemics/severe pandemics that pose a great global health threat. Among eight viral RNA segments, the multiple functions of nucleoprotein (NP) play important roles in viral replication and transcription. METHODS: To understand how NP contributes to the virus evolution, we analyzed the NP gene of H3N2 viruses in Taiwan and 14,220 NP sequences collected from Influenza Research Database. The identified genetic variations were further analyzed by mini-genome assay, virus growth assay, viral RNA and protein expression as well as ferret model to analyze their impacts on viral replication properties. RESULTS: The NP genetic analysis by Taiwan and global sequences showed similar evolution pattern that the NP backbones changed through time accompanied with specific residue substitutions from 1999 to 2018. Other than the conserved residues, fifteen sporadic substitutions were observed in which the 31R, 377G and 450S showed higher frequency. We found 31R and 450S decreased polymerase activity while the dominant residues (31 K and 450G) had higher activity. The 31 K and 450G showed better viral translation and replication in vitro and in vivo. CONCLUSIONS: These findings indicated variations identified in evolution have roles in modulating viral replication in vitro and in vivo. This study demonstrates that the interaction between variations of NP during virus evolution deserves future attention.

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

Association of polymorphisms in the HBG1-HBD intergenic region with HbF levels.

BACKGROUND: Increased levels of fetal hemoglobin (HbF) can improve the clinical course of the patients with sickle cell anemia (SCA) or ß-thalassemia. The HBG1-HBD intergenic region plays an important role in this process. However, very few studies investigated whether the variations in this region have an effect on HbF expression. METHODS: We retrieved all the SNP data in the HBG1-HBD intergenic region and defined the haplotype blocks, then performed cluster analysis and selected a tagSNP. A total of 500 normal individuals and 300 ß-thalassemia carriers were enrolled. After routine blood and hemoglobin capillary electrophoresis testing, ß-thalassemia mutations were detected using PCR-reverse dot blot. The genotypes of the rs4910736 (A > C) and rs10128556 (C > T) were determined using Sanger sequencing; the relationship between the two SNPs and the levels of HbF was analyzed. RESULTS: Two haplotype blocks were constructed. Block 1 included seven haplotypes divided into two groups M and N by 11 tagSNPs, among which rs4910736 was selected as a tagSNP, while block 2 included three haplotypes. We found that the haplotypes of block 1 were statistically associated with HbF levels, but the non-tagSNP rs10128556 was shown to be more strongly associated with HbF levels than rs4910736. CONCLUSION: This work proved that the haplotypes in the HBG1-HBD intergenic region and SNP rs10128556 are both statistically associated with HbF levels, revealing the association of polymorphisms in the HBG1-HBD intergenic region with HbF levels.

Enterovirus A71: virulence, antigenicity, and genetic evolution over the years.

As a neurotropic virus, enterovirus A71 (EV-A71) emerge and remerge in the Asia-Pacific region since the 1990s, and has continuously been a threat to global public health, especially in children. Annually, EV-A71 results in hand-foot-and-mouth disease (HFMD) and occasionally causes severe neurological disease. Here we reviewed the global epidemiology and genotypic evolution of EV-A71 since 1997. The natural selection, mutation and recombination events observed in the genetic evolution were described. In addition, we have updated the antigenicity and virulence determinants that are known to date. Understanding EV-A71 epidemiology, genetic evolution, antigenicity, and virulence determinants can expand our insights of EV-A71 pathogenesis, which may benefit us in the future.

[Analysis of LBR gene mutation in a pedigree affected with Pelger-Huёt anomaly].

OBJECTIVE: To detect mutation of LBR gene in a pedigree affected with Pelger-Huёt anomaly (PHA) and to explore its clinical characteristics. METHODS: Genomic DNA was extracted from the pedigree and healthy controls. The 14 exons of the LBR gene were subjected to PCR amplification and Sanger sequencing. Suspected mutations were verified in other family members and 100 healthy controls. Polyphen-2 and SIFT software were used to predict the effect of the mutation, and Swiss-model software was used to simulate the protein structure. RESULTS: Three patients were found to carry a c.893G>A mutation in exon 8 of the LBR gene, which resulted in substitution of the 298th amino acid residue glycine by glutamic acid (p.Gly298Glu). The same mutation was not found in healthy family members and 100 healthy controls. The mutation was predicted to be damaging. Bioinformatic simulation showed the mutation has altered the 3D structure of the LBR protein. CONCLUSION: The c.893G>A (p.Gly298Glu) mutation in the LBR gene probably underlies the PHA in this pedigree and has enriched the spectrum of LBR gene mutations.

A Selective Bottleneck Shapes the Evolutionary Mutant Spectra of Enterovirus A71 during Viral Dissemination in Humans.

RNA viruses accumulate mutations to rapidly adapt to environmental changes. Enterovirus A71 (EV-A71) causes various clinical manifestations with occasional severe neurological complications. However, the mechanism by which EV-A71 evolves within the human body is unclear. Utilizing deep sequencing and haplotype analyses of viruses from various tissues of an autopsy patient, we sought to define the evolutionary pathway by which enterovirus A71 evolves fitness for invading the central nervous system in humans. Broad mutant spectra with divergent mutations were observed at the initial infection sites in the respiratory and digestive systems. After viral invasion, we identified a haplotype switch and dominant haplotype, with glycine at VP1 residue 31 (VP1-31G) in viral particles disseminated into the integumentary and central nervous systems. In vitro viral growth and fitness analyses indicated that VP1-31G conferred growth and a fitness advantage in human neuronal cells, whereas VP1-31D conferred enhanced replication in human colorectal cells. A higher proportion of VP1-31G was also found among fatal cases, suggesting that it may facilitate central nervous system infection in humans. Our data provide the first glimpse of EV-A71 quasispecies from oral tissues to the central nervous system within humans, showing broad implications for the surveillance and pathogenesis of this reemerging viral pathogen.IMPORTANCE EV-A71 continues to be a worldwide burden to public health. Although EV-A71 is the major etiological agent of hand, foot, and mouth disease, it can also cause neurological pulmonary edema, encephalitis, and even death, especially in children. Understanding selection processes enabling dissemination and accurately estimating EV-A71 diversity during invasion in humans are critical for applications in viral pathogenesis and vaccine studies. Here, we define a selection bottleneck appearing in respiratory and digestive tissues. Glycine substitution at VP1 residue 31 helps viruses break through the bottleneck and invade the central nervous system. This substitution is also advantageous for replication in neuronal cells in vitro Considering that fatal cases contain enhanced glycine substitution at VP1-31, we suggest that the increased prevalence of VP1-31G may alter viral tropism and aid central nervous system invasion. Our findings provide new insights into a dynamic mutant spectral switch active during acute viral infection with emerging viral pathogens.

[Results of thalassemia screening and genetic diagnosis for 13 738 pregnant women].

OBJECTIVE: To report on the result of thalassemia screening and genetic diagnosis for pregnant women from Guiyang region. METHODS: Prenatal screening for thalassemia was carried out based on erythrocyte parameters and hemoglobin electrophoresis. Single-tube multiplex GAP-PCR and PCR-reverse dot blot hybridization were performed on suspected cases to identify common alpha- and beta- thalassemia mutations, and direct sequencing was used for identifying rare mutations. RESULTS: Among 13 738 pregnant women, 1745 (12.70%) were suspected as thalassemia. In terms of native place, the provinces with highest screening-positive rates were Guangxi, Guangdong, Jiangxi and Guizhou. And the ethnic groups with highest screening-positive rates were Zhuang, Li, and Buyi. Among 801 women subjected to genetic testing, 457 (57.05%) were diagnosed with thalassemia. In total 9 genotypes of alpha- thalassemia were detected, with the most common genotypes being --SEA/alpha alpha (63.35%), - alpha3.7/alpha alpha (19.37%) and - alpha4.2/alpha alpha (8.90%). Eleven genotypes of beta- thalassemia were detected, with the most common genotypes being CD17/N (42.91%), CD41-42/N (32.46%) and IVS-II-654/N (11.94%). Two cases were detected with rare beta-thalassemia mutations (CD54-58/N and IVS-I-130/N). CONCLUSION: The screening-positive rate of thalassemia among pregnant women in Guiyang region is relatively high. The rates have shown substantial difference in terms of native place and ethnic group. Thalassemia-related mutations in Guizhou region have a diverse spectrum, which showed certain difference from those of other regions.

The genetic basis of asymptomatic codon 8 frame-shift (HBB:c25_26delAA) ß(0) -thalassaemia homozygotes.

Two 21-year old dizygotic twin men of Iraqi descent were homozygous for HBB codon 8, deletion of two nucleotides (-AA) frame-shift ß(0) -thalassaemia mutation (FSC8; HBB:c25_26delAA). Both were clinically well, had splenomegaly, and were never transfused. They had mild microcytic anaemia (Hb 120-130 g/l) and 98% of their haemoglobin was fetal haemoglobin (HbF). Both were carriers of Hph α-thalassaemia mutation. On the three major HbF quantitative trait loci (QTL), the twins were homozygous for G>A HBG2 Xmn1 site at single nucleotide polymorphism (SNP) rs7482144, homozygous for 3-bp deletion HBS1L-MYB intergenic polymorphism (HMIP) at rs66650371, and heterozygous for the A>C BCL11A intron 2 polymorphism at rs766432. These findings were compared with those found in 22 other FSC8 homozygote patients: four presented with thalassaemia intermedia phenotype, and 18 were transfusion dependent. The inheritance of homozygosity for HMIP 3-bp deletion at rs66650371 and heterozygosity for Hph α-thalassaemia mutation was found in the twins and not found in any of the other 22 patients. Further studies are needed to uncover likely additional genetic variants that could contribute to the exceptionally high HbF levels and mild phenotype in these twins.

Mapping Enterovirus A71 Antigenic Determinants from Viral Evolution.

UNLABELLED: Human enterovirus A71 (EV-A71) belongs to the Enterovirus A species in the Picornaviridae family. Several vaccines against EV-A71, a disease causing severe neurological complications or even death, are currently under development and being tested in clinical trials, and preventative vaccination programs are expected to start soon. To characterize the potential for antigenic change of EV-A71, we compared the sequences of two antigenically diverse genotype B4 and B5 strains of EV-A71 and identified substitutions at residues 98, 145, and 164 in the VP1 capsid protein as antigenic determinants. To examine the effects of these three substitutions on antigenicity, we constructed a series of recombinant viruses containing different mutation combinations at these three residues with a reverse genetics system and then investigated the molecular basis of antigenic changes with antigenic cartography. We found that a novel EV-A71 mutant, containing lysine, glutamine, and glutamic acid at the respective residues 98, 145, and 164 in the VP1 capsid protein, exhibited neutralization reduction against patients' antisera and substantially increased virus binding ability to human cells. These observations indicated that this low-neutralization-reactive EV-A71 VP1-98K/145Q/164E mutant potentially increases viral binding ability and that surveillance studies should look out for these mutants, which could compromise vaccine efficacy. IMPORTANCE: Emerging and reemerging EV-A71 viruses can cause severe neurological etiology, primarily affecting children, especially around Asia-Pacific countries. We identified a set of mutations in EV-A71 that both reduced neutralization activity against humoral immunity in antisera of patients and healthy adults and greatly increased the viral binding ability to cells. These findings provide important insights for EV-A71 antigenic determinants and emphasize the importance of continuous surveillance, especially after EV-A71 vaccination programs begin.