Effect of Catheter Ablation for Atrial Fibrillation in Heart Failure With Mid-Range or Preserved Ejection Fraction　- Pooled Analysis of the AF Frontier Ablation Registry and Hokuriku-Plus AF Registry.

BACKGROUND: A recent randomized trial demonstrated that catheter ablation for atrial fibrillation (AF) in patients with heart failure with reduced ejection fraction (EF) is associated with a reduction in death or heart failure. However, the effect of catheter ablation for AF in patients with heart failure with mid-range or preserved EF is unclear.Methods and Results: We screened 899 AF patients (72.4% male, mean age 68.4 years) with heart failure and left ventricular EF ≥40% from 2 Japanese multicenter AF registries: the Atrial Fibrillation registry to Follow the long-teRm Outcomes and use of aNTIcoagulants aftER Ablation (AF Frontier Ablation Registry) as the ablation group (525 patients who underwent ablation) and the Hokuriku-Plus AF Registry as the medical therapy group (374 patients who did not undergo ablation). Propensity score matching was performed in these 2 registries to yield 106 matched patient pairs. The primary endpoint was a composite of cardiovascular death and hospitalization for heart failure. At 24.6 months, the ablation group had a significantly lower incidence of the primary endpoint (hazard ratio 0.32; 95% confidence interval 0.13-0.70; P=0.004) than the medical therapy group. CONCLUSIONS: Compared with medical therapy, catheter ablation for AF in patients with heart failure and mid-range or preserved EF was associated with a significantly lower incidence of cardiovascular death or hospitalization for heart failure.

Different Determinants of the Recurrence of Atrial Fibrillation and Adverse Clinical Events in the Mid-Term Period After Atrial Fibrillation Ablation.

BACKGROUND: It is unclear whether there are differences in the clinical factors between atrial fibrillation (AF) recurrence and adverse clinical events (AEs), including stroke/transient ischemic attack (TIA), major bleeding, and death, after AF ablation.Methods and Results:We examined the data from a retrospective multicenter Japanese registry conducted at 24 cardiovascular centers between 2011 and 2017. Of the 3,451 patients (74.1% men; 63.3±10.3 years) who underwent AF ablation, 1,046 (30.3%) had AF recurrence and 224 (6.5%) suffered AEs (51 strokes/TIAs, 71 major bleeding events, and 36 deaths) over a median follow-up of 20.7 months. After multivariate adjustment, female sex, persistent and long-lasting persistent AF (vs. paroxysmal AF), and stepwise increased left atrial diameter (LAd) quartiles were significantly associated with post-ablation recurrences. A multivariate analysis revealed that an age ≥75 years (vs. <65 years), body weight <50 kg, diabetes, vascular disease, left ventricular (LV) ejection fraction <40% (vs. ≥50%), Lad ≥44 mm (vs. <36 mm), and creatinine clearance <50 mL/min were independently associated with AE incidences, but not with recurrences. CONCLUSIONS: This study disclosed different determinants of post-ablation recurrence and AEs. Female sex, persistent AF, and enlarged LAd were determinants of post-ablation recurrence, whereas an old age, comorbidities, and LV and renal dysfunction rather than post-ablation recurrence were AEs determinants. These findings will help determine ablation indications and post-ablation management.

Impact of sinus rhythm maintenance on major adverse cardiac and cerebrovascular events after catheter ablation of atrial fibrillation: insights from AF frontier ablation registry.

The impact of catheter ablation for atrial fibrillation (AF) on cardiovascular events and mortality is controversial. We investigated the impact of sinus rhythm maintenance on major adverse cardiac and cerebrovascular events after AF ablation from a Japanese multicenter cohort of AF ablation. We investigated 3326 consecutive patients (25.8% female, mean age 63.3 ± 10.3 years) who underwent catheter ablation for AF from the atrial fibrillation registry to follow the long-term outcomes and use of anti coagulants after ablation (AF frontier ablation registry). The primary endpoint was a composite of stroke, transient ischemic attack, cardiovascular events, and all-cause death. During a mean follow-up of 24.0 months, 2339 (70.3%) patients were free from AF after catheter ablation, and the primary composite endpoint occurred in 144 (4.3%) patients. The AF nonrecurrence group had a significantly lower incidence of the primary endpoint (1.8 per 100 person-years) compared with the AF recurrence group (3.0 per 100 person-years, p = 0.003). The multivariate analysis revealed that freedom from AF (hazard ratio 0.61, 95% confidence interval 0.44-0.86, p = 0.005) was independently associated with the incidence of the composite event. In the multicenter cohort of AF ablation, sinus rhythm maintenance after catheter ablation was independently associated with lower rates of major adverse cardiac and cerebrovascular events.

Clinical outcomes of ablation versus non-ablation therapy for atrial fibrillation in Japan: analysis of pooled data from the AF Frontier Ablation Registry and SAKURA AF Registry.

Whether ablation for atrial fibrillation (AF) is, in terms of clinical outcomes, beneficial for Japanese patients has not been clarified. Drawing data from 2 Japanese AF registries (AF Frontier Ablation Registry and SAKURA AF Registry), we compared the incidence of clinically relevant events (CREs), including stroke/transient ischemic attack (TIA), major bleeding, cardiovascular events, and death, between patients who underwent ablation (n = 3451) and those who did not (n = 2930). We also compared propensity-score matched patients (n = 1414 in each group). In propensity-scored patients who underwent ablation and those who did not, mean follow-up times were 27.2 and 35.8 months, respectively. Annualized rates for stroke/TIA (1.04 vs. 1.06%), major bleeding (1.44 vs. 1.20%), cardiovascular events (2.15 vs. 2.49%) were similar (P = 0.96, 0.39, and 0.35, respectively), but annualized death rates were lower in the ablation group than in the non-ablation group (0.75 vs.1.28%, P = 0.028). After multivariate adjustment, the risk of CREs was statistically equivalent between the ablation and non-ablation groups (hazard ratio [HR] 0.89, 95% confidence interval [CI] 0.71-1.11), but it was significantly low among patients who underwent ablation for paroxysmal AF (HR 0.68 [vs. persistent AF], 95% CI 0.49-0.94) and had a CHA2DS2-VASc score < 3 (HR 0.66 [vs. CHA2DS2-VASc score ≥ 3], 95% CI 0.43-0.98]). The 2-year risk reduction achieved by ablation may be small among Japanese patients, but AF ablation may benefit those with paroxysmal AF and a CHA2DS2-VASc score < 3.

Clinical Outcomes of Off-Label Underdosing of Direct Oral Anticoagulants After Ablation for Atrial Fibrillation.

Direct oral anticoagulants (DOACs) are sometimes prescribed at off-label under-doses for patients who have undergone ablation for atrial fibrillation (AF). This practice may be an attempt to balance the risk of bleeding against that of stroke or AF recurrence.We examined outcomes of 1163 patients who continued use of a DOAC after ablation. The patients were enrolled in a large (3530 patients) multicenter registry in Japan. The study patients were classified as 749 (64.4%) appropriate standard-dose DOAC users, 216 (18.6%) off-label under-dose DOAC users, and 198 (17.0%) appropriate low-dose DOAC users.Age and CHA2DS2-VASc scores differed significantly between DOAC dosing regimens, with patients given an appropriate standard-dose being significantly younger (63.3 ± 9.4 versus 64.8 ± 9.5 versus 73.2 ± 6.8 years, P < 0.0001) and lower (2.1 ± 1.5 versus 2.4 ± 1.6 versus 3.4 ± 1.4, P < 0.0001) than those given an off-label under-dose or an appropriate low-dose. During the median 19.0-month follow-up period, the AF recurrence rate was similar between the appropriate standard-dose and off-label under-dose groups but relatively low in the appropriate low-dose group (42.5% versus 41.2% versus 35.4%, P = 0.08). Annualized rates of thromboembolic events, major bleeding, and death from any cause were 0.47%, 0.70%, and 0.23% in the off-label under-dose group, while those rates were 0.74%, 0.73%, and 0.65% in the appropriate standard-dose, and 1.58%, 2.12%, and 1.57% in the appropriate low-dose groups.In conclusion, the clinical adverse event rates for patients on an off-label under-dose DOAC regimen after ablation, predicated on careful patient evaluations, was not high as seen with that of patients on a standard DOAC dosing regimen.

Current Status and Clinical Outcomes of Oral Anticoagulant Discontinuation After Ablation for Atrial Fibrillation in Japan　- Findings From the AF Frontier Ablation Registry.

BACKGROUND: The safety of discontinuing oral anticoagulant (OAC) after ablation for atrial fibrillation (AF) in Japanese patients has not been clarified.Methods and Results:A study based on the Atrial Fibrillation registry to Follow the long-teRm Outcomes and use of aNTIcoagulants aftER Ablation (AF Frontier Ablation Registry) was conducted. Data were collected from 3,451 consecutive patients (74.1% men; age, 63.3±10.3 years) who had undergone AF ablation at any of 24 cardiovascular centers in Japan between August 2011 and July 2017. During a 20.7-month follow-up period, OAC therapy was discontinued in 1,836 (53.2%) patients; 51 patients (1.5%) suffered a stroke/transient ischemic attack (TIA), 71 (2.1%) suffered major bleeding, and 36 (1.0%) died. Patients in whom OAC therapy was discontinued were significantly younger than those in whom OACs were continued, and their CHA2DS2-VASc scores were significantly lower. The incidences of stroke/TIA, major bleeding, and death were significantly lower among these patients. Upon multivariate adjustment, stroke events were independently associated with relatively high baseline CHA2DS2-VASc scores but not with OAC status. CONCLUSIONS: Although the incidences of stroke/TIA, major bleeding, and death were relatively low among patients for whom OAC therapy was discontinued, stroke/TIA occurrence was strongly associated with a high baseline stroke risk rather than with OAC status. Thus, discontinuation of OAC therapy requires careful consideration, especially in patients with a high baseline stroke risk.

Impact of thin-cap fibroatheroma on predicting deteriorated coronary flow during interventional procedures in acute as well as stable coronary syndromes: insights from optical coherence tomography analysis.

The occurrence of deteriorated coronary flow associated with distal embolization during percutaneous coronary intervention results in impaired myocardial perfusion and worsens the clinical prognosis. This study aimed to examine the impact of optical coherence tomography (OCT)-determined coronary plaque morphology on the prediction of deteriorated coronary flow after stent implantation in acute as well as stable coronary syndromes (ACS and SAP, respectively). We studied 126 patients who underwent OCT during stenting for ACS (n = 44) and SAP (n = 82) with a de novo lesion. Angiographic deteriorated coronary flow was defined as the deterioration of TIMI flow grade after mechanical dilatation in the absence of a mechanical obstruction on angiograms. Patients could be divided into the deteriorated flow group (n = 21) and the reflow group (n = 105). Under these conditions, the presence of thin-cap fibroatheroma (TCFA) was more frequently observed in the deteriorated flow group than in the reflow group in both ACS and SAP. A multivariable logistic regression model revealed that TCFA was an independent predictor of deteriorated coronary flow (hazard ratio: 12.32; 95 % confidence interval: 3.02-50.31; p = 0.0005). These results demonstrate that TCFA detected by OCT could be a strong predictor of the occurrence of deteriorated coronary flow during stent implantation in ACS as well as SAP.

Multicenter prospective observational study to clarify the current status and clinical outcome in Japanese patients who have an indication for implantable cardioverter defibrillator (ICD) or wearable cardioverter defibrillator (WCD) (TRANSITION JAPAN-ICD/WCD study): Rationale and design of a prospective, multicenter, observational, comparative study.

Background: Despite the positive impact of implantable cardioverter defibrillators (ICDs) and wearable cardioverter defibrillators (WCDs) on prognosis, their implantation is often withheld especially in Japanese heart failure patients with reduced left ventricular ejection fraction (HFrEF) who have not experienced ventricular tachycardia (VT) or ventricular fibrillation (VF) for uncertain reasons. Recent advancements in heart failure (HF) medications have significantly improved the prognosis for HFrEF. Given this context, a critical reassessment of the treatment and prognosis of ICDs and WCDs is essential, as it has the potential to reshape awareness and treatment strategies for these patients. Methods: We are initiating a prospective multicenter observational study for HFrEF patients eligible for ICD in primary and secondary prevention, and WCD, regardless of device use, including all consenting patients. Study subjects are to be enrolled from 31 participant hospitals located throughout Japan from April 1, 2023, to December 31, 2024, and each will be followed up for 1 year or more. The planned sample size is 651 cases. The primary endpoint is the rate of cardiac implantable electronic device implementation. Other endpoints include the incidence of VT/VF and sudden death, all-cause mortality, and HF hospitalization, other events. We will collect clinical background information plus each patient's symptoms, Clinical Frailty Scale score, laboratory test results, echocardiographic and electrocardiographic parameters, and serial changes will also be secondary endpoints. Results: Not applicable. Conclusion: This study offers invaluable insights into understanding the role of ICD/WCD in Japanese HF patients in the new era of HF medication.

Registry for Evaluating Healthy Life Expectancy and Long-Term Outcomes after Catheter Ablation of Atrial Fibrillation in the Very Elderly (REHEALTH AF) study: rationale and design of a prospective, multicentre, observational, comparative study.

INTRODUCTION: Data are lacking on the extent to which patients with non-valvular atrial fibrillation (AF) who are aged ≥80 years benefit from ablation treatment. The question pertains especially to patients' postablation quality of life (QoL) and long-term clinical outcomes. METHODS AND ANALYSIS: We are initiating a prospective, registry-based, multicentre observational study that will include patients aged ≥80 years with non-valvular AF who choose to undergo treatment by catheter ablation and, for comparison, such patients who do not choose to undergo ablation (either according to their physician's advice or their own preference). Study subjects are to be enrolled from 52 participant hospitals and three clinics located throughout Japan from 1 June 2022 to 31 December 2023, and each will be followed up for 1 year. The planned sample size is 660, comprising 220 ablation group patients and 440 non-ablation group patients. The primary endpoint will be the composite incidence of stroke/transient ischaemic attack (TIA) or systemic embolism (SE), another cardiovascular event, major bleeding and/or death from any cause. Other clinical events such as postablation AF recurrence, a fall or bone fracture will be recorded. We will collect standard clinical background information plus each patient's Clinical Frailty Scale score, AF-related symptoms, QoL (Five-Level Version of EQ-5D) scores, Mini-Mental State Examination (optional) score and laboratory test results, including measures of nutritional status, on entry into the study and 1 year later, and serial changes in symptoms and QoL will also be secondary endpoints. Propensity score matching will be performed to account for covariates that could affect study results. ETHICS AND DISSEMINATION: The study conforms to the Declaration of Helsinki and the Ethical Guidelines for Clinical Studies issued by the Ministry of Health, Labour and Welfare, Japan. Results of the study will be published in one or more peer-reviewed journals. TRIAL REGISTRATION NUMBER: UMIN000047023.

Transition of the ST segment from a J wave to a coved-type elevation before ventricular fibrillation induced by coronary vasospasm in the precordial leads.

We describe the case of a 63-year-old man whose electrocardiogram showed transition of the ST segment from a J wave to a coved-type elevation in precordial leads before ventricular fibrillation induced by right coronary artery vasospasm. Simultaneously, the ST segment in inferior leads was gradually depressed with a J wave. Considering the sudden death of his son, induced ventricular fibrillation by programmed electrical stimulation, and modulations of the ST segment in the precordial and inferior leads by pilsicainide, some abnormalities in repolarization associated with Brugada syndrome or early repolarization syndrome might have caused these atypical ST-segment manifestations.

Impact of functional studies on exome sequence variant interpretation in early-onset cardiac conduction system diseases.

AIMS: The genetic cause of cardiac conduction system disease (CCSD) has not been fully elucidated. Whole-exome sequencing (WES) can detect various genetic variants; however, the identification of pathogenic variants remains a challenge. We aimed to identify pathogenic or likely pathogenic variants in CCSD patients by using WES and 2015 American College of Medical Genetics and Genomics (ACMG) standards and guidelines as well as evaluating the usefulness of functional studies for determining them. METHODS AND RESULTS: We performed WES of 23 probands diagnosed with early-onset (<65 years) CCSD and analysed 117 genes linked to arrhythmogenic diseases or cardiomyopathies. We focused on rare variants (minor allele frequency < 0.1%) that were absent from population databases. Five probands had protein truncating variants in EMD and LMNA which were classified as 'pathogenic' by 2015 ACMG standards and guidelines. To evaluate the functional changes brought about by these variants, we generated a knock-out zebrafish with CRISPR-mediated insertions or deletions of the EMD or LMNA homologs in zebrafish. The mean heart rate and conduction velocities in the CRISPR/Cas9-injected embryos and F2 generation embryos with homozygous deletions were significantly decreased. Twenty-one variants of uncertain significance were identified in 11 probands. Cellular electrophysiological study and in vivo zebrafish cardiac assay showed that two variants in KCNH2 and SCN5A, four variants in SCN10A, and one variant in MYH6 damaged each gene, which resulted in the change of the clinical significance of them from 'Uncertain significance' to 'Likely pathogenic' in six probands. CONCLUSION: Of 23 CCSD probands, we successfully identified pathogenic or likely pathogenic variants in 11 probands (48%). Functional analyses of a cellular electrophysiological study and in vivo zebrafish cardiac assay might be useful for determining the pathogenicity of rare variants in patients with CCSD. SCN10A may be one of the major genes responsible for CCSD.

Growth of infants with osteogenesis imperfecta treated with bisphosphonate.

BACKGROUND: Osteogenesis imperfecta (OI) is a heritable bone disease characterized by bone brittleness and various degrees of growth disorder. Cyclic pamidronate therapy is reportedly useful to prevent bone fracture in OI and in infants with OI, but, it remains unclear how infants with OI grow during bisphosphonate therapy. METHODS: Height and weight measurements of OI infants treated with cyclic pamidronate therapy were taken before and every 6 months during therapy until 18 months. Vertebral morphometry and the concavity index were analyzed using X-ray films taken simultaneously. RESULTS: Among OI patients, those in the group for which the height z-score decreased tended to have more femur fractures than those of the group for which the height z-score increased. Morphometry of the lumbar spine showed that compression fractures occurred less during cyclic pamidronate therapy, by which the lumbar bone mineral density increased. CONCLUSIONS: Bisphosphonate preserved vertebral morphometry during 18 months after starting therapy in infants. Prevention of femur fracture during the infantile period might help prevent short stature; therapeutic strategies during infancy must better emphasize prevention of long bone fracture before the beginning of gait.

Acute flaccid myelitis associated with enterovirus D68 in a non-epidemic setting.

Acute flaccid myelitis (AFM) is a recently defined clinical disease accompanied by the national outbreak of enterovirus D68 (EV-D68) in the United States during the late summer/fall of 2014; 258 cases of EV-D68 and 59 cases of AFM were reported in Japan during the late summer/fall of 2015. Subsequently, there have been no epidemics of AFM or EV-D68. However, we encountered a patient who had AFM associated with EV-D68 in 2017. This is the first case of AFM caused by EV-D68 after the 2015 epidemic, and the only reported case in 2017. This report indicates that AFM caused by EV-D68 can arise even in non-epidemic situations. If a patient presents with paralysis, AFM caused by EV-D68 should be included in the differential diagnosis, regardless of the absence of an epidemic of EV-D68 infection.

Pial arteriovenous fistula of the spine in a child with hemiplegia.

Pial arteriovenous fistula (AVF) is an extremely rare disease in children. When a child presents with sudden onset of hemiparesis and headache, it is very important to perform spinal magnetic resonance imaging (MRI) scanning for early diagnosis and treatment.

High incidence of sudden cardiac death with conduction disturbances and atrial cardiomyopathy caused by a nonsense mutation in the STA gene.

BACKGROUND: The STA gene encodes emerin and is one of the genes that is affected in Emery-Dreifuss muscular dystrophy (EDMD). Although it has been reported that EDMD caused by the STA gene mutation is associated with X-linked recessive inheritance, the genotype-phenotype correlations, with special reference to cardiac manifestations, are not well defined. METHODS AND RESULTS: We identified 16 carriers (7 male and 9 female) with a nonsense mutation in exon 6 of the STA gene in 2 EDMD families. Pacemakers were required for treatment of bradyarrhythmias in all 7 male carriers and in 2 of the 9 female carriers. In addition, 2 of the 9 female carriers displayed atrial fibrillation. In these 2 families, 3 males without pacemaker implantation, who were not tested genetically, had died suddenly. In these family members, the majority of carriers with the mutation had not been clinically diagnosed as having EDMD before genetic testing because of extremely mild or nonexistent skeletal myopathy. CONCLUSIONS: EDMD caused by this mutation is characterized by atypical clinical features and incomplete penetrance of the clinical phenotype and may result in serious cardiac complications, including sudden death. Approaches to preventing possible sudden death in carriers with the STA gene mutation require further study.

Impact of Distal Protection with Filter-Type Device on Long-term Outcome after Percutaneous Coronary Intervention for Acute Myocardial Infarction: Clinical Results with Filtrap®.

AIM: Although distal embolization during percutaneous coronary intervention (PCI) for acute myocardial infarction (AMI) deteriorates cardiac function, whether distal protection (DP) can improve prognosis is still controversial. We investigated whether a filter-type DP device, Filtrap®, could improve long-term outcomes after PCI for AMI. METHOD: We studied 164 patients (130 men, mean age: 65.7 years) who underwent PCI. Patients were divided into two groups based on the use of Filtrap®. The occurrence of congestive heart failure (CHF) and major adverse cardiac events (MACE) defined as cardiac death, recurrent AMI, and target vessel revascularization were compared. RESULT: Between DP (n=53, 41 men, mean age: 65.5 years) and non-DP (n=111, 89 men, mean age: 65.8 years) groups, although there was significantly greater plaque area in the DP group than in the non-DP group, there were no significant differences in coronary reperfusion flow after PCI. Interestingly, patients with CHF in the non-DP group exhibited a higher CK level than those in the DP group. During a 2-year follow-up period, cumulative CHF was significantly lower in the DP group than in the non-DP group (log-rank p=0.018), and there was no significant difference in the MACE rate (log-rank p=0.238). The use of DP device could not predict MACE, but could predict CHF by multivariate analysis (odds ratio=0.099, 95% CI: 0.02-0.42, p=0.005). CONCLUSION: These results demonstrate that favorable clinical outcomes could be achieved by the filter-type DP device in AMI, particularly in patients with CHF.

A novel missense mutation in the myosin binding protein-C gene is responsible for hypertrophic cardiomyopathy with left ventricular dysfunction and dilation in elderly patients.

OBJECTIVES: We studied the clinical features of hypertrophic cardiomyopathy (HCM) caused by a novel mutation in the myosin binding protein-C (MyBP-C) gene in patients and family members of Japanese descent. BACKGROUND: Previous reports have demonstrated that the clinical features of HCM associated with mutations in the MyBP-C gene include late onset and a favorable clinical course. Recently, some mutations in genes encoding sarcomeric proteins have been reported to be a cause of dilated cardiomyopathy (DCM), as well as HCM. However, mutations of the MyBP-C gene have not been reported as a cause of DCM up to now. METHODS: We analyzed MyBP-C gene mutations in 250 unrelated probands with HCM and in 90 with DCM. We used electrocardiography (ECG) and echocardiography to determine clinical phenotypes. RESULTS: We identified 17 individuals in 8 families (7 HCM, 1 DCM) with an Arg820Gln mutation in the MyBP-C gene. Overall, 2 (40%) of 5 carriers age >70 years displayed "burnt-out" phase HCM, and one of them had been diagnosed as having DCM before genetic identification. The disease penetrance in subjects age >50 years was 70% by echocardiography and 100% by ECG, and that in those age <50 years was 40% and 50%, respectively. CONCLUSIONS: Elderly patients with Arg820Gln mutation may show "burnt-out" phase HCM, and patients with this mutation may be included among those diagnosed as having DCM. Screening of patients with DCM, as well as HCM, for this mutation is of significant importance because patients with this mutation may be diagnosed clinically as having DCM.

An effective case of growth hormone treatment on cartilage-hair hypoplasia.

Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.

Differences in diagnostic value of four electrocardiographic voltage criteria for hypertrophic cardiomyopathy in a genotyped population.

The diagnostic value of various classic electrocardiographic (ECG) voltage criteria for hypertrophic cardiomyopathy (HC) has not been established in a genotyped population. This study aimed to determine the most accurate diagnostic definition of classic ECG voltage criteria for detecting carriers of HC. ECG and echocardiographic findings were analyzed in 161 genotyped subjects (97 genetically affected, 64 unaffected) from 20 families with disease-causing mutations in 4 genes. The diagnostic value of 4 voltage criteria (Cornell, Sokolow-Lyon, Romhilt-Estes, and 12-lead QRS voltage) for detecting carriers of HC was investigated. In all subjects, the Romhilt-Estes (point score > or =4) criterion and 12-lead QRS voltage (> or =240 mm) were most sensitive (37% and 36%, respectively), with high specificity (95% each), resulting in the greatest accuracy (60% and 59%, respectively). Using these criteria, in subjects without echocardiographic evidence of left ventricular hypertrophy, voltage abnormalities were found in 22.6% of carriers and 4.7% of noncarriers (p <0.01). In conclusion, these findings suggest that the Romhilt-Estes and the 12-lead QRS voltage criteria may be the most accurate diagnostic definitions for HC on the basis of molecular genetic diagnoses. Furthermore, this study demonstrated that voltage abnormalities may be found in prehypertrophic carriers. Even when genetic testing becomes widely available, it will be difficult to make genetic diagnoses in all patients with HC because of its genetic heterogeneity. Therefore, understanding the diagnostic value of classic ECG voltage criteria may be important in detecting carriers, including those without left ventricular hypertrophy.

A rare type of alternating bundle branch block in a patient with cardiac sarcoidosis--a case report.

The authors report a rare type of alternating bundle branch block observed in a patient with cardiac sarcoidosis. Not only alternation of complete right and left bundle branch block but also narrow QRS complexes were observed on electrocardiogram. The mechanism of these unusual findings is briefly discussed.