Copy Number Profiling Implicates Thin High-Grade Squamous Intraepithelial Lesions as a True Precursor of Cervical Human Papillomavirus-Induced Squamous Cell Cancer.

Full-thickness high-grade squamous intraepithelial lesions (HSIL) are precursors of invasive cervical squamous cell carcinoma (SCC). The World Health Organization and Lower Anogenital Squamous Terminology Standardization Project for human papilloma virus (HPV)-associated lesions divide full-thickness HSIL of the cervix into thin HSIL with thickness of 1 to 9 cell layers and the typical full-thickness HSIL of >10 cell layers. Although HPV oncogene transcripts and p16ink4a overexpression, as markers of transforming HPV infection, are detectable in thin HSIL, the biological significance of thin HSIL in cervical carcinogenesis remains poorly understood. To further characterize thin HSIL, we performed a comparative study of chromosomal copy number variations (CNV), an analysis of dysregulated genes present in the segments with CNV, and a generalized genetic complexity calculation for 31 thin HSIL, 31 thick HSIL, 24 microinvasive SCC (pT1a SCC), and 22 highly invasive SCC samples. Thin HSIL share various CNV and specific dysregulated gene pathways with thick HSIL and invasive SCC. Thin HSIL exhibited an average CNV of 11.6% compared with 14.1% for thick HSIL, 15.5% for pT1a SCC, and 26.6% for highly invasive SCC. The CNV included gains at 1q and 3q (40% and 43%, respectively), partial loss of 3p, and loss of chromosomes 11 (18%), 16 (50%), 20 (35%), and 22 (40%). Pathways affected solely in thin HSIL were those enhancing immune evasion and primarily involved the (interleukin) IL6, IL21, and IL23 genes. ILs are transiently upregulated in response to infection and play a crucial role in mounting antitumor T-cell activity. Deregulation reflects an attempt by the HPV to evade the initial immune response of the host. The primary pathways shared by thick HSIL and invasive SCC were interactions between lymphoid and nonlymphoid cells, NOTCH2 signaling, tight junction interactions (primarily of the claudin family), and FGR2 alternative splicing. Our results show that thin HSIL carry similar genetic changes as thick HSIL and SCC, indicating that thin HSIL are true precursor lesions that can progress to thick HSIL and SCC.

The mutual value of histopathology and ITS sequencing in the diagnosis of mucormycosis.

AIMS: Mucormycosis is a fast-progressing disease with a high mortality rate. The most important factor determining survival of patients is early and accurate diagnosis. Although histopathology often recognises invasive mould infections at first, histomorphology alone is insufficient in providing an accurate diagnosis. Unbiased molecular methods to detect and identify fungi are promising, yet their role in complementing routine histopathological workflows has not been studied sufficiently. METHODS AND RESULTS: We performed a retrospective single-centre study examining the clinical value of complementing histopathology with internal transcribed spacer (ITS) sequencing of fungal DNA in the routine diagnosis of mucormycosis. At our academic centre, we identified 14 consecutive mucormycosis cases diagnosed by histopathology and subsequent ITS sequencing. Using histomorphological examination, fungal hyphae could be detected in all cases; however, morphological features were unreliable regarding specifying the taxa. Subsequent ITS sequencing identified a remarkable phylogenetic diversity among Mucorales: the most common species was Rhizopus microsporus (six of 14; 42.9%), followed by Lichtheimia corymbifera (three of 14, 21.4%) and single detections of Rhizopus oryzae, Actinomucor elegans, Mucor circinelloides, Rhizomucor pusillus and Rhizomucor miehei (one of 14; 7.1%, respectively). In one case, we additionally detected Pneumocystis jirovecii in the same lung tissue specimen, suggesting a clinically relevant co-infection. Fungal culture was performed in 10 cases but yielded positive results in only two of 10 (20%), revealing its limited value in the diagnosis of mucormycosis. CONCLUSIONS: Our study demonstrates that a combination of histopathology and ITS sequencing is a practically feasible approach that outperforms fungal culture in detecting Mucorales in tissue-associated infections. Therefore, pathologists might adapt diagnostic workflows accordingly when mucormycosis is suspected.

Different Mutational Landscapes in Human Papillomavirus-Induced and Human Papillomavirus-Independent Invasive Penile Squamous Cell Cancers.

Penile squamous cell carcinomas (SCC) are rare cancers that arise after transforming human papillomavirus (HPV) infections or independent of HPV in the background of chronic dermatoses. Limited knowledge about genetic alterations driving penile carcinogenesis comes from studies of mainly small cohorts of typically mixed etiology. In this comparative genetic study of HPV-induced and HPV-independent invasive penile SCC of 156 patients from a single institution in a low-incidence country, hotspots of 50 cancer-relevant genes were analyzed with targeted next-generation sequencing. Seventy-nine of 156 SCC were classified as HPV induced, and 77 of 156 SCC arose independent of HPV. Only 28 (35%) of 79 HPV-induced penile SCC, but 69 (90%) of 77 HPV-independent SCC carried somatic gene mutations. PIK3CA, FGFR3, and FBXW7 mutations occurred in both groups in similar numbers as seen in other human cancers. In contrast, mutations in TP53 (44/77; 57%), CDKN2A (35/77; 45%), and HRAS (13/77; 17%) genes occurred with one exception of a HIV positive patient exclusively in HPV-independent SCC with a frequent co-occurrence of TP53 and CDKN2A mutations (28/77; 42%). Mutations in multiple genes occurred in 9 (11%) of 79 HPV-induced SCC versus 47 (62%) of 77 HPV-independent SCC (χ2; P < .001). More than one mutation per gene (multi hits) was characteristic for HPV-independent SCC in 14 (18%) of 77 compared with only 3 (4%) of 79 HPV-induced SCC (χ2; P < .001). The total number of mutations in HPV-induced penile SCC (47 mutations) was significantly lower than that in HPV-independent SCC (143 mutations; Welsh test; P < .001). The presence of somatic driver gene mutations did not correlate with the age of patients, histology, or tumor stage of the primary SCC in either etiologic group, suggesting that acquisition of driver gene mutations is an early event after invasion. This large cohort analysis identified characteristic differences in mutational landscapes for the 2 etiologies. While genetic mutations in tumor suppressor genes drive HPV-independent penile carcinogenesis, oncogenic action of E6 and E7 substitute for mutations in HPV-induced SCC. A subgroup of patients with advanced SCC may be candidates for targeted therapy and clinical trials, although the majority of advanced penile SCC remain a therapeutic challenge.

Sensitive and robust liquid biopsy-based detection of PIK3CA mutations in hormone-receptor-positive metastatic breast cancer patients.

BACKGROUND: The benefit of alpelisib in hormone-receptor-positive (HR+) metastatic breast cancer patients provided clinical evidence for the increasing importance of PIK3CA testing. We performed a comparison of liquid biopsy and tissue-based detection of PIK3CA mutations. MATERIALS AND METHODS: PIK3CA hotspot mutation analysis using a high-resolution SiMSen-Seq assay was performed in plasma from 93/99 eligible patients with HR+/HER2- breast cancer. Additionally, mFAST-SeqS was used to estimate the tumour fractions in plasma samples. In 72/93 patients, matched tissue was available and analysed using a customised Ion Torrent panel. RESULTS: PIK3CA mutations were detected in 48.6% of tissue samples and 47.3% of plasma samples, with identical PIK3CA mutation detected in 24/72 (33.3%) patients both in tissue and plasma. In 10 (13.9%) patients, mutations were only found in plasma, and in 6 (8.3%) patients, PIK3CA mutations found in tissue were not detectable in ctDNA. In 49/93 plasma samples without detectable PIK3CA mutations, 22 (44.9%) samples had elevated tumour fractions, implying true negative results. CONCLUSION: SiMSen-Seq-based detection of PIK3CA mutations in plasma shows advantageous concordance with the tissue analyses. A combination with an untargeted approach for detecting ctDNA fractions may confirm a negative PIK3CA result and enhance the performance of the SiMSen-Seq test.

Free threonine in human breast milk is related to infant intestinal microbiota composition.

BACKGROUND: Accumulating evidence indicates that free amino acids (FAA) might be bioactive compounds with potential immunomodulatory capabilities. However, the FAA composition in human milk is still poorly characterized with respect to its correlation to maternal serum levels and its physiological significance for the infant. Studies addressing the relation of human milk FAA to the infants' intestinal microbiota are still missing. METHODS: As part of a pilot study, maternal serum and breast milk FAA concentrations as well as infant intestinal microbiota (16S rRNA) were determined 2 months after birth. The study cohort consisted of 41 healthy mothers and their term delivered, healthy infants with normal birthweight. The relationship between maternal serum and milk FAA was determined by correlation analyses. Associations between (highly correlated) milk FAA and infant intestinal beta diversity were tested using PERMANOVA, LefSe and multivariate regression models adjusted for common confounders. RESULTS: Seven breast milk FAA correlated significantly with serum concentrations. One of these, threonine showed a negative association with abundance of members of the class Gammaproteobacteria (R2adj = 17.1%, p = 0.006; ß= - 0.441). In addition, on the level of families and genera, threonine explained 23.2% of variation of the relative abundance of Enterobacteriaceae (R2adj; p = 0.001; ß = - 0.504) and 11.1% of variability in the abundance of Escherichia/Shigella (R2adj, p = 0.025; ß = - 0.368), when adjusted for confounders. CONCLUSION: Our study is the first to suggest potential interactions between breast milk FAA and infant gut microbiota composition during early lactation. The results might be indicative of a potential protective role of threonine against members of the Enterobacteriaceae family in breast-fed infants. Still, results are based on correlation analyses and larger cohorts are needed to support the findings and elucidate possible underlying mechanisms to assess the complex interplay between breast milk FAA and infant intestinal microbiota in detail.

Driver gene mutations in micro-invasive cervical squamous cancers have no prognostic significance.

OBJECTIVE: To evaluate the prevalence of somatic gene mutations in different stages of cervical carcinogenesis placing special emphasis on micro-invasive pT1a cervical squamous cell cancers (SCC). METHODS: Micro-dissected samples of 32 micro-invasive pT1a and 55 ≥ pT1b SCC were evaluated by next generation sequencing of 50 cancer genes (cancer hot spot panel). RESULTS: At primary diagnosis, 8/32 (25%) pT1a SCC, 10/28 (36%) pT1b SCC and 15/27 (56%) pT2/3 SCC carried somatic gene mutations. The most commonly affected gene was the PIK3CA gene in hot spot regions E545K and E453K in 5/8 (62%) pT1a SCC, 7/15 (70%) pT1b SCC and 10/15 (66%) pT2/3 SCC followed by FBXW7 (n = 4), KRAS and RB1 (n = 2 each). ERBB2, APC, ATM, MLP gene mutations occurred only once. Solitary activating oncogenic somatic mutations dominated over tumor suppressor mutation in 88% pT1a, 80% pT1b and 60% pT2/3 SCC. Concomitant mutations involved typically an activating oncogenic mutation and an inactivating tumor-suppressor gene mutation. All patients with pT1a SCC are alive without evidence of disease after surgical treatment, independent of mutational status or lympho-vascular space invasion. CONCLUSIONS: Activating oncogenic gene mutations, in particular in the PIK3CA gene, occur early in cervical carcinogenesis. Although driver gene mutations bestow tumor cells with a growth advantage, early detection and complete removal of all cancer cells - with or without somatic gene mutations - are essential for cure. In contrast to advanced inoperable SCC, where PIK3CA driver gene mutations carry an adverse prognosis, the mutational status in surgically treated micro-invasive SCC is prognostically irrelevant.

Anhedonia induced by high-fat diet in mice depends on gut microbiota and leptin.

Objectives: Imbalanced nutrition and obesity are risk factors for depression, a relationship that in rodents can be modeled by depression-like behavior in response to high-fat diet (HFD). In this work, we examined the role of the intestinal microbiota and the adipocytokine leptin as potential mediators of the effects of HFD to induce anhedonia-like behavior and reduce self-care in mice.Methods: Male mice were fed a control diet or HFD (60 kJ% from fat) for a period of 4 weeks, after which behavioral tests and molecular analyses (gut microbiome composition, intestinal metabolome, fecal fatty acids, plasma hormone levels) were performed. The role of the intestinal microbiota was addressed by selective depletion of gut bacteria with a combination of non-absorbable antibiotics, while the implication of leptin was examined by the use of leptin-deficient ob/ob mice.Results: Antibiotic treatment reduced the HFD-induced weight gain and adiposity and prevented HFD-induced anhedonia-like behavior and self-care reduction. These effects were associated with a decrease in fecal fatty acids and intestinal microbiota-related metabolites including short-chain fatty acids, glucose and amino acids. Gut microbiota depletion suppressed the HFD-induced rise of plasma leptin, and the circulating leptin levels correlated with the anhedonia-like behavior and reduced self-care caused by HFD. The anhedonic effect of HFD was absent in leptin-deficient ob/ob mice although these animals gained more weight and adiposity in response to HFD than wild-type mice.Discussion: The results indicate that anhedonia-like behavior induced by HFD in mice depends on the intestinal microbiome and involves leptin as a signaling hormone.

Rapid Antigen Test for Postmortem Evaluation of SARS-CoV-2 Carriage.

Detecting severe acute respiratory syndrome coronavirus 2 in deceased patients is key when considering appropriate safety measures to prevent infection during postmortem examinations. A prospective cohort study comparing a rapid antigen test with quantitative reverse transcription PCR showed the rapid test's usability as a tool to guide autopsy practice.

Molecular epidemiology and diagnostics of KRAS mutations in human cancer.

RAS mutation is the most frequent oncogenic alteration in human cancers. KRAS is the most frequently mutated followed by NRAS. The emblematic KRAS mutant cancers are pancreatic, colorectal, lung adenocarcinomas and urogenital cancers. KRAS mutation frequencies are relatively stable worldwide in various cancer types with the one exception of lung adenocarcinoma. The frequencies of KRAS variant alleles appears cancer type specific, reflecting the various carcinogenic processes. In addition to point mutation KRAS, allelic imbalances are also frequent in human cancers leading to the predominance of a mutant allele. KRAS mutant cancers are characterized by typical, cancer-type-specific co-occurring mutations and distinct gene expression signatures. The heterogeneity of KRAS mutant primary cancers is significant, affecting the variant allele frequency, which could lead to unpredictable branching development in metastases. Selection of minute mutant subclones in the primary tumors or metastases during target therapies can also occur frequently in lung or colorectal cancers leading to acquired resistance. Ultrahigh sensitivity techniques are now routinely available for diagnostic purposes, but the proper determination of mutant allele frequency of KRAS in the primary or metastatic tissues may have larger clinical significance.

Broadening the spectrum of NTRK rearranged mesenchymal tumors and usefulness of pan-TRK immunohistochemistry for identification of NTRK fusions.

Fusions involving NTRK1, NTRK2, and NTRK3 are oncogenic drivers occurring in a spectrum of mesenchymal neoplasms ranging from benign to highly malignant tumors. To gain further insights into the staining profile with the pan-TRK assay, we analyzed a large number of soft tissue sarcomas and correlated our findings with molecular testing. Additionally, we expand the spectrum of NTRK-fusion tumors by reporting a mesenchymal lesion in the lung as well as a mesenchymal skin lesion in the spectrum of benign fibrous histiocytoma with NTRK-fusion. We retrospectively reviewed soft tissue sarcomas diagnosed at the Diagnostic and Research Institute of Pathology, Medical University of Graz, between 1999 and 2019, and cases from the consultation files of one of the authors (BLA). In total, 494 cases were analyzed immunohistochemically with pan-TRK antibody (clone EPR17341, RTU, Roche/Ventana) and positive cases (defined as any cytoplasmic/nuclear staining in more than 1% of tumor cells) underwent next-generation sequencing (NGS). Immunohistochemical staining was observed in 16 (3.2%) cases. Eleven cases with focal weak and moderate cytoplasmic/membranous or focal moderate to strong nuclear staining did not harbor an NTRK-fusion (three synovial sarcomas, three leiomyosarcomas, two extraskeletal myxoid chondrosarcomas, and one each: dedifferentiated liposarcoma, pleomorphic liposarcoma, and myxofibrosarcoma). Four cases showed strong diffuse nuclear and/or cytoplasmatic staining, and one case showed diffuse, but weak cytoplasmic staining. All these cases demonstrated an NTRK-fusion (LMNA-NTRK1, IRF2BP2-NTRK1, TMB3-NTRK1, ETV6-NTRK3, RBPMS-NTRK3). Pan-TRK assay (clone EPR17341, RTU, Roche, Ventana) immunohistochemistry serves as a reliable diagnostic marker that can also be expressed in non-NTRK-rearranged mesenchymal neoplasms. It can be used as a surrogate marker for identification of NTRK fusion, nevertheless, an RNA-based NGS for detection of the specific fusion should be performed to confirm the rearrangement, if patients are undergoing targeted therapy. Additionally, we identified NTRK-fusion-positive, primary mesenchymal tumors of the lung and the skin.

MUG Mel3 Cell Lines Reflect Heterogeneity in Melanoma and Represent a Robust Model for Melanoma in Pregnancy.

Melanomas are aggressive tumors with a high metastatic potential and an increasing incidence rate. They are known for their heterogeneity and propensity to easily develop therapy-resistance. Nowadays they are one of the most common cancers diagnosed during pregnancy. Due to the difficulty in balancing maternal needs and foetal safety, melanoma is challenging to treat. The aim of this study was to provide a potential model system for the study of melanoma in pregnancy and to illustrate melanoma heterogeneity. For this purpose, a pigmented and a non-pigmented section of a lymph node metastasis from a pregnant patient were cultured under different conditions and characterized in detail. All four culture conditions exhibited different phenotypic, genotypic as well as tumorigenic properties, and resulted in four newly established melanoma cell lines. To address treatment issues, especially in pregnant patients, the effect of synthetic human lactoferricin-derived peptides was tested successfully. These new BRAF-mutated MUG Mel3 cell lines represent a valuable model in melanoma heterogeneity and melanoma pregnancy research. Furthermore, treatment with anti-tumor peptides offers an alternative to conventionally used therapeutic options-especially during pregnancy.

Loss of RAF kinase inhibitor protein is involved in myelomonocytic differentiation and aggravates RAS-driven myeloid leukemogenesis.

RAS-signaling mutations induce the myelomonocytic differentiation and proliferation of hematopoietic stem and progenitor cells. Moreover, they are important players in the development of myeloid neoplasias. RAF kinase inhibitor protein (RKIP) is a negative regulator of RAS-signaling. As RKIP loss has recently been described in RAS-mutated myelomonocytic acute myeloid leukemia, we now aimed to analyze its role in myelomonocytic differentiation and RAS-driven leukemogenesis. Therefore, we initially analyzed RKIP expression during human and murine hematopoietic differentiation and observed that it is high in hematopoietic stem and progenitor cells and lymphoid cells but decreases in cells belonging to the myeloid lineage. By employing short hairpin RNA knockdown experiments in CD34+ umbilical cord blood cells and the undifferentiated acute myeloid leukemia cell line HL-60, we show that RKIP loss is indeed functionally involved in myelomonocytic lineage commitment and drives the myelomonocytic differentiation of hematopoietic stem and progenitor cells. These results could be confirmed in vivo, where Rkip deletion induced a myelomonocytic differentiation bias in mice by amplifying the effects of granulocyte macrophage-colony-stimulating factor. We further show that RKIP is of relevance for RAS-driven myelomonocytic leukemogenesis by demonstrating that Rkip deletion aggravates the development of a myeloproliferative disease in NrasG12D -mutated mice. Mechanistically, we demonstrate that RKIP loss increases the activity of the RAS-MAPK/ERK signaling module. Finally, we prove the clinical relevance of these findings by showing that RKIP loss is a frequent event in chronic myelomonocytic leukemia, and that it co-occurs with RAS-signaling mutations. Taken together, these data establish RKIP as novel player in RAS-driven myeloid leukemogenesis.

Occurrence of SARS-CoV-2 in the intraocular milieu.

The purpose of this research is to study the intraocular occurrence of SARS-CoV-2. In postmortem examinations, aqueous humor and the vitreous samples were collected. All individuals were previously positive in nasopharyngeal swabbing and cause of death was respiratory failure due to SARS-CoV-2 infection. Testing was done using quantitative RT-PCR. We included 16 aqueous humor and 16 vitreous samples for PCR testing. None of the results was positive for SARS-CoV-2. Human GAPDH genes to verify the presence of RNA was present in all aqueous humor samples (16/16, 100%) and 15/16 (93.8%) vitreous samples. In conclusion, this case series found no evidence of SARS-CoV-2 in the intraocular milieu.

Sexual dimorphism of miRNA signatures in feto-placental endothelial cells is associated with altered barrier function and actin organization.

Endothelial function and the risk for endothelial dysfunction differ between males and females. Besides the action of estrogen, sex chromosome gene expression and programming effects also provoke this sexual dimorphism. MicroRNAs (miRNAs) have emerged as regulators of endothelial cell function and dysfunction. We here hypothesized distinct miRNA expression patterns in male versus female human endothelial cells that contribute to the functional differences. We used our well-established model of fetal endothelial cells isolated from placenta (fpEC) and analyzed sexual dimorphic miRNA expression and potentially affected biological functions. Next-generation miRNA sequencing of fpEC isolated after pregnancies with male and female neonates identified sex-dependent miRNA expression patterns. Potential biological pathways regulated by the altered set of miRNAs were determined using mirPath and mirSystem softwares, and suggested differences in barrier function and actin organization. The identified pathways were further investigated by monolayer impedance measurements (ECIS) and analysis of F-actin organization (Phalloidin). Nine miRNAs were differentially expressed in fpEC of male versus female neonates. Functional pathways most significantly regulated by these miRNAs included 'Adherens junction', 'ECM receptor interaction' and 'Focal adhesion'. These pathways control monolayer barrier function and may be paralleled by altered cytoskeletal organization. In fact, monolayer impedance was higher in fpEC of male progeny, and F-actin staining revealed more pronounced peripheral stress fibers in male versus female fpEC. Our data highlight that endothelial cell function differs between males and females already in utero, and that altered miRNAs are associated with sex dependent differences in barrier function and actin organization.

Possibly carcinogenic HPV subtypes are a cause of HSIL and negative clinical HPV tests - A European prospective single center study.

OBJECTIVE: To correlate p16ink4a positive cervical precancers of 388 consecutive patients from a single European center with the preceding clinical HPV-DNA and HPV E6/E7 mRNA screening test. METHOD: 374/388 patients had a HSIL (CIN 2/3) and 14/388 AIS (6 pure and 8 combined AIS/HSIL). Lesional tissues of HSIL/AIS with negative Cobas and/or Aptima HPV tests underwent HPV genotyping with CHIPRON HPV 3.5 LCD-array. Selected cases were subjected to a cancer hot spot analysis. RESULTS: The Aptima test missed 10/388 (2.6%) and the Cobas test seven of 388 (1.8%) precancers associated HPV-HR. Both HPV tests were negative in 20/374 precancers (5.3%; 17 HSIL/CIN3, two HSIL/CIN2, one AIS). Due to insufficient DNA four of 20 double negative cases (three HSIL, one AIS) were not genotyped. In the remaining cases, two of 20 (10%) HSIL genotyping detected HR-HPV subtypes. 10/20 (50%) HSIL were associated with possibly carcinogenic and low risk HPV (four x HPV73, three x HPV 53, one x HPV 82, one x HPV 67 and one x HPV 6), all of which are not included in both HPV tests. Two of 20 (10%) HSIL were negative with all HPV tests; one of these HSIL had a somatic PIK3CA gene mutation and the other had a single nucleotide variant in the APC gene. Three of 20 HSIL (15%) were thin HSIL (≤9 cell layers thick). CONCLUSIONS: Possibly carcinogenic HPV subtypes not included in the clinical HPV tests may account for the small gap of missed HSIL in clinical HPV screening. True HPV negative HSIL are exceedingly rare. Expanding HPV testing to include more possibly carcinogenic HPV subtypes may further reduce cervical cancer.

Sensitive and broadly applicable residual disease detection in acute myeloid leukemia using flow cytometry-based leukemic cell enrichment followed by mutational profiling.

Persistent measurable residual disease (MRD) is an increasingly important prognostic marker in acute myeloid leukemia (AML). Currently, MRD is determined by multi-parameter flow cytometry (MFC) or PCR-based methods detecting leukemia-specific fusion transcripts and mutations. However, while MFC is highly operator-dependent and difficult to standardize, PCR-based methods are only available for a minority of AML patients. Here we describe a novel, highly sensitive and broadly applicable method for MRD detection by combining MFC-based leukemic cell enrichment using an optimized combinatorial antibody panel targeting CLL-1, TIM-3, CD123 and CD117, followed by mutational analysis of recurrently mutated genes in AML. In dilution experiments this method showed a sensitivity of 10-4 to 10-5 for residual disease detection. In prospectively collected remission samples this marker combination allowed for a median 67-fold cell enrichment with sufficient DNA quality for mutational analysis using next generation sequencing (NGS) or digital PCR in 39 out of 41 patients. Twenty-one samples (53.8%) tested MRD positive, whereas 18 (46.2%) were negative. With a median follow-up of 559 days, 71.4% of MRD positive (15/21) and 27.8% (5/18) of MRD negative patients relapsed (P = .007). The cumulative incidence of relapse (CIR) was higher for MRD positive patients (5-year CIR: 90.5% vs 28%, P < .001). In multivariate analysis, MRD positivity was a prominent factor for CIR. Thus, MFC-based leukemic cell enrichment using antibodies against CLL-1, TIM-3, CD123 and CD117 followed by mutational analysis allows high sensitive MRD detection and is informative on relapse risk in the majority of AML patients.

Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.

KIT mutation in a naïve succinate dehydrogenase-deficient gastric GIST.

Up to 85% of gastrointestinal stromal tumors (GIST) harbor mutually exclusive mutations in the KIT or the PDGFRA gene. Among others, known as wild type GIST, succinate dehydrogenase (SDH)-deficient tumors develop due to genetic or epigenetic alterations in any of four SDH genes. Herein, we present a unique case of SDH-deficient GIST with an unusual heterogeneous SDHA and SDHB staining pattern and mutations detected in the SDHA and KIT gene. A 50-year-old patient presented with a 5 cm large gastric tumor with a multinodular/plexiform growth pattern, mixed epithelioid and spindle cell morphology, and focal pronounced nuclear atypia with hyperchromasia and high mitotic activity. Immunohistochemically, CD117 and DOG-1 were positive. SDHB and SDHA stains showed loss of expression in some of the nodules, whereas others presented with an unusually weak patchy positivity. Molecular analysis revealed a point mutation in exon 5 of the SDHA gene and a mutation in exon 11 of the KIT gene. We hypothesize that based on the allele frequency of SDHA and KIT mutations the tumor is best regarded as SDH-deficient GIST in which the SDHA mutation represents the most likely driver mutation. The identified KIT mutation raises the distinct possibility that the KIT mutation is a secondary event reflecting clonal evolution. This is the first case of a treatment naïve GIST harboring a somatic SDHA and a KIT mutation, challenging the dogma that oncogenic mutations in treatment naïve GIST are mutually exclusive.

Time series analysis of TP53 gene mutations in recurrent HPV-negative vulvar squamous cell carcinoma.

The impact of TP53 gene mutations in recurrent HPV-negative vulvar squamous cell carcinomas is unclear. TP53 gene mutations were analyzed in archival tissues of 24 primary squamous cell carcinoma and local vulvar recurrences arising in chronic inflammatory dermatoses by analyzing the full coding sequence of the TP53 gene and correlated with disease-free survival. After resection of the primary squamous cell carcinoma with clear margins 19/24 patients had one and 5/24 had multiple recurrences. The first recurrence occurred after median of 46 months (range 12-180 months). In all, 17/24 (71%) primary squamous cell carcinomas had TP53 gene mutations and recurred after median disease-free intervals of 33 months (range 12-180). 14/17 (88%) recurrent squamous cell carcinomas carried again TP53 gene mutations, five with identical and nine with different, more complex TP53 gene mutations. 7/24 (29%) patients with a p53 wild-type primary SCC had the first recurrence after median 65 months (range 14-144) featuring p53 wild-type in 3/7 (43%) and TP53 gene mutations in 4/7 (57%) recurrent squamous cell carcinomas. Disease-free intervals of > 5 years (60-180 months) were observed in 10/24 patients total (42%; equally divided among p53 wild-type (5/7; 71%) and TP53 gene mutated (5/17; 29%) squamous cell carcinomas). In summary, squamous cell carcinomas recurred in the residual vulvar dermatosis independent of TP53 gene mutational status of the primary squamous cell carcinoma. The majority of TP53 gene mutated cancers recurred with different TP53 gene mutations, some of them more complex, and patients with p53 wild type developed TP53 gene mutations in the recurrent squamous cell carcinomas, possibly indicating increased genetic instability in longstanding chronic inflammatory dermatoses. A change of TP53 gene mutational status after > 5 years suggests de novo oncogenic events/carcinogenesis. Longer disease-free intervals in patients with p53 wild-type primary squamous cell carcinoma suggest that TP53 gene mutational status may serve as a prognostic marker for disease-free intervals.

Stochastic phenotype switching leads to intratumor heterogeneity in human liver cancer.

Intratumor heterogeneity is increasingly recognized as a major factor impacting diagnosis and personalized treatment of cancer. We characterized stochastic phenotype switching as a mechanism contributing to intratumor heterogeneity and malignant potential of liver cancer. Clonal analysis of primary tumor cell cultures of a human sarcomatoid cholangiocarcinoma identified different types of self-propagating subclones characterized by stable (keratin-7-positive or keratin-7-negative) phenotypes and an unstable phenotype consisting of mixtures of keratin-7-positive and keratin-7-negative cells, which lack stem cell features but may reversibly switch their phenotypes. Transcriptome sequencing and immunohistochemical studies with the markers Zeb1 and CD146/MCAM demonstrated that switching between phenotypes is linked to changes in gene expression related but not identical to epithelial-mesenchymal transition. Stochastic phenotype switching occurred during mitosis and did not correlate with changes in DNA methylation. Xenotransplantation assays with different cellular subclones demonstrated increased tumorigenicity of cells showing phenotype switching, resulting in tumors morphologically resembling the invasive component of primary tumor and metastasis. CONCLUSION: Our data demonstrate that stochastic phenotype switching contributes to intratumor heterogeneity and that cells with a switching phenotype have increased malignant potential. (Hepatology 2017).