An integrated machine learning model enhances delayed graft function prediction in pediatric renal transplantation from deceased donors.

BACKGROUND: Kidney transplantation is the optimal renal replacement therapy for children with end-stage renal disease; however, delayed graft function (DGF), a common post-operative complication, may negatively impact the long-term outcomes of both the graft and the pediatric recipient. However, there is limited research on DGF in pediatric kidney transplant recipients. This study aims to develop a predictive model for the risk of DGF occurrence after pediatric kidney transplantation by integrating donor and recipient characteristics and utilizing machine learning algorithms, ultimately providing guidance for clinical decision-making. METHODS: This single-center retrospective cohort study includes all recipients under 18 years of age who underwent single-donor kidney transplantation at our hospital between 2016 and 2023, along with their corresponding donors. Demographic, clinical, and laboratory examination data were collected from both donors and recipients. Univariate logistic regression models and differential analysis were employed to identify features associated with DGF. Subsequently, a risk score for predicting DGF occurrence (DGF-RS) was constructed based on machine learning combinations. Model performance was evaluated using the receiver operating characteristic curves, decision curve analysis (DCA), and other methods. RESULTS: The study included a total of 140 pediatric kidney transplant recipients, among whom 37 (26.4%) developed DGF. Univariate analysis revealed that high-density lipoprotein cholesterol (HDLC), donor after circulatory death (DCD), warm ischemia time (WIT), cold ischemia time (CIT), gender match, and donor creatinine were significantly associated with DGF (P < 0.05). Based on these six features, the random forest model (mtry = 5, 75%p) exhibited the best predictive performance among 97 machine learning models, with the area under the curve values reaching 0.983, 1, and 0.905 for the entire cohort, training set, and validation set, respectively. This model significantly outperformed single indicators. The DCA curve confirmed the clinical utility of this model. CONCLUSIONS: In this study, we developed a machine learning-based predictive model for DGF following pediatric kidney transplantation, termed DGF-RS, which integrates both donor and recipient characteristics. The model demonstrated excellent predictive accuracy and provides essential guidance for clinical decision-making. These findings contribute to our understanding of the pathogenesis of DGF.

The role of regulatory T cells in the pathogenesis of acute kidney injury.

The incidence of acute kidney injury (AKI) is on the rise and is associated with high mortality; however, there are currently few effective treatments. Moreover, the relationship between Tregs and other components of the immune microenvironment (IME) in the pathogenesis of AKI remains unclear. We downloaded four publicly accessible AKI datasets, GSE61739, GSE67401, GSE19130, GSE81741, GSE19288 and GSE106993 from the gene expression omnibus (GEO) database. Additionally, we gathered two kidney single-cell sequencing (scRNA-seq) samples from the Department of Organ Transplantation at Zhujiang Hospital of Southern Medical University to investigate chronic kidney transplant rejection (CKTR). Moreover, we also collected three samples of normal kidney tissue from GSE131685. By analysing the differences in immune cells between the AKI and Non-AKI groups, we discovered that the Non-AKI group contained a significantly greater number of Tregs than the AKI group. Additionally, the activation of signalling pathways, such as inflammatory molecules secretion, immune response, glycolytic metabolism, NOTCH, FGF, NF-κB and TLR4, was significantly greater in the AKI group than in the Non-AKI group. Additionally, analysis of single-cell sequencing data revealed that Tregs in patients with chronic kidney rejection and in normal kidney tissue have distinct biology, including immune activation, cytokine production, and activation fractions of signalling pathways such as NOTCH and TLR4. In this study, we found significant differences in the IME between AKI and Non-AKI, including differences in Tregs cells and activation levels of biologically significant signalling pathways. Tregs were associated with lower activity of signalling pathways such as inflammatory response, inflammatory molecule secretion, immune activation, glycolysis.

First Report of Muskmelon Fruit Rot Caused by Fusarium sulawesiense in China.

Muskmelon (Cucumis melo L.) is a widely cultivated and economically important fruit crop worldwide. In June 2022, fruit rot symptoms were observed on ripening muskmelons (cv. Boyang) in Shouguang City (36.81°N 118.90°E) of China. To determine the causal agent, we surveyed 200 muskmelon plants in about 1000 m2 of planting area and collected diseased muskmelons. Approximately 20% of muskmelon fruits had symptoms, and yield loss averaged 20%. Water-soaked lesions were observed on the surface and the fruit rotted from inside. Lesions were covered with white mycelium. Rotted fruit were surface-disinfested with 1% NaOCl for 1 min, 75% ethanol for 30 s, and washed three times with sterile water. Pieces (1 cm3) were cut from the disinfested fruit, placed on potato dextrose agar (PDA), and incubated at 25°C for 1 week. Ten isolates with similar morphology were obtained and isolates SG66 and SG68 were selected for further characterization. Colonies maintained on PDA in the dark had an average radial growth rate of 10-12 mm/d at 25°C. Surface was white, velvety to felty mycelium. Reverse was white to pale wheat. Diffusible pigments were absent. On carnation leaf agar, sporodochia appeared as slimy dots, macroconidia were 3- to 5-septate, 20-35 × 3-5 µm, falcate, with a pronounced dorsiventral curvature, with blunt to papillate apical cell, and barely to distinctly notched basal cell. Microconidia and chlamydospores were not observed. These morphological characteristics were consistent with descriptions of Fusarium sp. DNA was extracted from isolates SG66 and SG68 using a CTAB method. Nucleotide sequences of the internal transcribed spacers (ITS) (White et al. 1990), calmodulin (CAM), RNA polymerase II second largest subunit (RPB2), and translation elongation factor 1-α gene (TEF1) (Xia et al. 2019) were amplified using generic primers, the products sequenced, and sequences deposited in GenBank (ITS: OP251362, OP251363; CAM: OP266024, OP266025; RPB2: OP266028, OP266029; TEF1: OP266026, OP266027). Isolates SG66 and SG68 clustered with Fusarium sulawesiense (85% bootstrap) (Maryani et al. 2019). The Fusarioid-ID database pairwise alignment of ITS (526 bp), CAM (534 bp), RPB2 (861 bp), and TEF1 (636 bp) sequences from isolate SG66 showed 99.6% (98.9% coverage), 100% (100% coverage), 100% (100% coverage) and 100% (98.4% coverage) similarity with the corresponding sequences (GQ505730, LS479422, LS479855 and GQ505641), respectively, of the reference strains of F. sulawesiense (InaCC F940 and NRRL 34059). To perform a pathogenicity test, 10 µl of conidial suspensions (1 × 106 conidia/ml) were injected into ten muskmelon fruit using a syringe, and ten control fruit were inoculated with 10 µl of sterile distilled water. The test was repeated three times. After 7 days at 25°C, the pulp of all inoculated muskmelons began to rot, and the lesion expanded from the inside to the fruit surface at the injection site and became covered with white mycelia. No symptoms developed on the control fruit. The fungus was successfully re-isolated from infected tissues and confirmed as F. sulawesiense by morphological and phylogenetic analyses. F. sulawesiense has previously been reported on yellow melon (Canary) in Brazil (Lima et al. 2021) and on a range of hosts, including Luffa aegyptiaca, in China (Wang et al. 2019). To our knowledge, this is the first report of muskmelon fruit rot caused by F. sulawesiense in China.

Single cell sequencing coupled with bioinformatics reveals PHYH as a potential biomarker in kidney ischemia reperfusion injury.

Ischemia reperfusion injury(IRI) is an important factor affecting the early function and long-term survival of transplanted kidney. Single cell RNA sequencing (scRNA-seq) is a powerful method for investigating cell-specific transcriptome changes in the kidney. This study aimed to identify the significant cell type and potential biomarkers in IRI. First, we downloaded the IRI related scRNA dataset GSE139506 from the GEO database. Then, classification of cell type was characterized and proximal tubule cell (PTC) was identified as a significant cell type. The functional enrichment analysis indicated that PTC were related to kidney function and is significant in the ferroptosis of IRI. Analyses of three-dimensional structure and iron binding substructure of protein was carried out basing on SWISS-MODEL database. Finally, we constructed the murine model with IRI and verify the higher expression of PHYH in IRI by PCR, Western blot (WB) and Immunohistochemistry (IHC) experiments. In conclusion, this study provided novel insights on the cell-type-specific expression gene biomarker in IRI pathogenesis.

lncRNA USP30-AS1 sponges miR-765 and modulates the progression of colon cancer.

BACKGROUND: The incidence and mortality of colon cancer is increasing recently. It is necessary to identify effective biomarkers for the progression and prognosis of colon cancer. To assess the potential of lncRNA USP30-AS1 (USP30-AS1) in serving as the biomarker of colon cancer and unearth the underlying mechanism. METHODS: There were 123 colon cancer patients enrolled. The expression of USP30-AS1 was evaluated with PCR in tissue and cell samples. The clinical significance of USP30-AS1 was assessed with a series of statistical methods, while the CCK8 and Transwell assay were conducted to estimate its biological effect on the colon cancer cellular processes. In mechanism, the interaction of USP30-AS1 with miR-765 was evaluated with the dual-luciferase reporter assay. RESULTS: In colon cancer tissues, the USP30-AS1 downregulation and the miR-765 upregulation were observed, and there was a negative correlation between the USP30-AS1 expression level and the miR-765 expression level. The downregulation of USP30-AS1 related to the malignant progression and served as an adverse prognostic indicator of colon cancer. The overexpression of USP30-AS1 dramatically suppressed colon cancer cellular processes, which was alleviated by miR-765. CONCLUSIONS: USP30-AS1 predicts the malignancy and prognosis of colon cancer patients. USP30-AS1 suppressed the progression of colon cancer through modulating miR-765.

Tomato chlorosis virus infecting Luffa cylindrica and Citrullus lanatus in China.

Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approximately 780 bp were detected in all sponge gourd and watermelon samples. The fragments were inserted into pMD18-T vector (Takara, Shiga, Japan), which was subsequently transformed into Escherichia coli DH5α. Sponge gourd (n=1; ToCV-sponge gourd) and watermelon (n=1; ToCV-watermelon)-positive samples were selected for Sanger sequencing. BLASTN comparison of the sequencing results confirmed the presence of ToCV. The sequencing results were processed using DNAMAN version 6.0 (Lynnon Biosoft, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). The phylogenetic tree based on ToCV coat protein (CP) was constructed using amplified ToCV-sponge gourd, ToCV-watermelon, and ToCV representative sequences in GenBank database. According to the results, the ToCV sponge gourd and watermelon sequences belonged to an independent branch with the Chinese ToCV isolate (KC812619). Sequence analysis based on nucleotide sequences of ToCV CP demonstrated that ToCV-sponge gourd and ToCV-watermelon isolates shared the highest nucleotide sequence identity of 99.7% with the Chinese isolate (KC812619). To assess the transmissibility of ToCV, virus-free whiteflies (Bemisia tabaci) (n = 30) were placed for one day on ToCV-infected sponge gourd and watermelon plants for virus acquisition. Thereafter, whiteflies were transferred onto the virus-free sponge gourd (cv. 'Changlv', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) and watermelon (cv. 'ZaoJia 8424', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) seedlings for one day. Three weeks later, all plants from tested group showed same symptoms as those observed in the greenhouses, whereas plants in the control group were symptom-free. RT-PCR analysis confirmed the ToCV infection in sponge gourd and watermelon plants, whereas control plants were found uninfected. ToCV infection in sponge gourds and watermelons has not been reported previously. To the best of our knowledge, this is the first report of sponge gourd and watermelon being natural hosts of ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.

First Report of Muskmelon Fruit Rot Caused by Fusarium nanum in China.

Muskmelon (Cucumis melo L.) is one of the most widely cultivated and economically important fruit crops in the world. However, many pathogens can cause decay of muskmelon fruit, including Fusarium asiaticum, F. equiseti, F. incarnatum and F. lateritium (Hao et al. 2021; Wang et al. 2019). Fusarium spp. are the most important pathogens affecting muskmelon fruit yield and quality (Wang et al. 2011). In August 2020, fruit rot symptoms were observed on ripening muskmelons (cv. Tianbao) in several fields in Jiyang District, Jinan City of Shandong Province, China. The incidences of infected muskmelon ranged from 15% to 30% and caused an average 20% yield loss. Symptoms appeared as pale brown, water-soaked lesions that were irregular in shape, with the lesion sizes ranging from a small spot (1 to 2 cm) to decay of the entire fruit. The core and surface of infected fruit were colonized and covered with white mycelia. Two infected muskmelons were collected from two fields, 7 km apart. Tissues removed from inside the infected fruit were surface disinfected with 75% ethanol for 30 s, and cultured on potato dextrose agar (PDA) at 25°C in the dark for 5 days. Four purified cultures were obtained using the single spore method. On carnation leaf agar (CLA), macroconidia were 1 to 5 septate, falcate, with a pronounced dorsiventral curvature with blunt to papillate apical cell, and barely to distinctly notched basal cell, measuring 12 to 35 × 3.5 to 6 µm. Microconidia and chlamydospores were not observed. These morphological characteristics were consistent with the description of Fusarium sp. Because these isolates had similar morphology, two representative isolates (XP9 and XP10) were selected for multilocus phylogenetic analyses. DNA was extracted from the representative isolates using a CTAB method. Nucleotide sequences of the internal transcribed spacers (ITS) (White et al. 1990), calmodulin (CAM), RNA polymerase II second largest subunit (RPB2), translation elongation factor 1-α gene (TEF1) (Xia et al. 2019) were amplified using specific primers, sequenced, and deposited in GenBank (ITS: MW391507 and MW391508, CAM: MW392787 and MW392788, RPB2: MW392795 and MW392796, TEF1: MW392791 and MW392792). The Fusarium MLST database pairwise alignment of ITS (546 bp), CAM (628 bp), RPB2 (902 bp) and TEF1 (718 bp) sequences from isolate XP9 showed 99.63%, 99.33%, 100.00% and 99.71% similarity with the corresponding sequences (GQ505685, GQ505508, GQ505774 and GQ505596) of the reference strain of F. nanum (NRRL 22244), respectively. The overlap of ITS, CAM, RPB2 and TEF1 sequences from XP9 and NRRL 22244 were 100.00%, 95.06%, 97.45% and 94.99%, respectively. Alignments of a combined dataset of ITS, CAM, RPB2 and TEF1 were made using MAFFT v. 7, and phylogenetic analyses were conducted in MEGA v. 7.0 using the maximum likelihood method. The muskmelon isolates (XP9 and XP10) clustered together with the F. nanum reference strain CGMCC3.19498 and NRRL 22244 (100% bootstrap) (Wang et al., 2019). To perform a pathogenicity test, 10 µl of conidial suspensions (1 × 106 conidia/ml) were injected into each muskmelon fruit using a syringe, and the control fruit was inoculated with 10 µl of sterile distilled water. There were ten replicated fruits for each treatment. The test was repeated three times. After 7 days at 25°C, the interior of the inoculated muskmelons begun to rot, and the rot lesion expanded from the core towards the surface of the fruit, then white mycelia were produced on the surface. Ten isolations were re-isolated from the infected tissues and identified by morphological and phylogenetic analyses and confirmed to fulfill Koch's postulates. No symptoms were observed on the control muskmelons. To our knowledge, this is the first report of muskmelon fruit rot caused by F. nanum in China. Considering the economic value of the muskmelon crop, correct identification can help farmers select appropriate field management measures for control of this disease.

Synergistic Catalysis of SnO2/Reduced Graphene Oxide for VO2+/VO2+ and V2+/V3+ Redox Reactions.

In spite of their low cost, high activity, and diversity, metal oxide catalysts have not been widely applied in vanadium redox reactions due to their poor conductivity and low surface area. Herein, SnO2/reduced graphene oxide (SnO2/rGO) composite was prepared by a sol-gel method followed by high-temperature carbonization. SnO2/rGO shows better electrochemical catalysis for both redox reactions of VO2+/VO2+ and V2+/V3+ couples as compared to SnO2 and graphene oxide. This is attributed to the fact that reduced graphene oxide is employed as carbon support featuring excellent conductivity and a large surface area, which offers fast electron transfer and a large reaction place towards vanadium redox reaction. Moreover, SnO2 has excellent electrochemical activity and wettability, which also boost the electrochemical kinetics of redox reaction. In brief, the electrochemical properties for vanadium redox reactions are boosted in terms of diffusion, charge transfer, and electron transport processes systematically. Next, SnO2/rGO can increase the energy storage performance of cells, including higher discharge electrolyte utilization and lower electrochemical polarization. At 150 mA cm-2, the energy efficiency of a modified cell is 69.8%, which is increased by 5.7% compared with a pristine one. This work provides a promising method to develop composite catalysts of carbon materials and metal oxide for vanadium redox reactions.

METTL3 contributes to renal ischemia-reperfusion injury by regulating Foxd1 methylation.

To investigate the mechanism of renal ischemia-reperfusion injury (IRI) via regulation of N6-methyl-adenosine (m6A) and relevant genes, IRI was induced in Sprague-Dawley rats, and urine and serum creatinine levels and tissue structure changes were observed. m6A and methyltransferase-like 3 (METTL3) protein levels were assessed via dot-blot and Western blot analyses, respectively. The hypoxia/reoxygenation (H/R) cell model was constructed using NRK-52E cells, and METTL3 protein levels were assessed. METTL3 was inhibited to observe its impact on NRK-52E cell apoptosis and m6A expression in H/R processes. Methylated RNA immunoprecipitation (MeRIP) sequencing was conducted followed by MeRIP-quantitative RT-PCR and quantitative RT-PCR validation. Our results indicated that urine and serum creatinine levels increased and that renal injury and cell apoptosis were both observed in the IRI model. In additon, m6A expression increased in the IRI model, and METTL3 protein levels significantly increased in the IRI and H/R models. When METTL3 was inhibited, m6A levels were accordingly decreased and cell apoptosis was suppressed in the H/R in vitro model. Based on MeRIP sequencing, transcription factor activating enhancer binding protein 2α (tfap2a), cytochrome P-450 1B1 (cyp1b1), and forkhead box D1 (foxd1) were significantly differentially expressed, as was m6A, which is involved in the negative regulation of cell proliferation and kidney development. We confirmed that foxd1 mRNA and its methylation levels contributed to IRI and H/R.

Yb3+ doped gain guided index anti-guided fiber based on the nanoporous silica glass rod.

We report a heavily Yb3+/Al3+/B3+/F- co-doped high silica rod with a negative refractive index relative to pure silica. The high silica rod was fabricated from nanoporous silica rod using glass phase-separation technology. To lower the refractive index, B3+ and F- were simultaneously introduced into the silica rod and the optical properties of the silica rod were investigated. The fiber preform was prepared with the rod-in-tube method by which the Yb3+ doped high silica rod was only used as an active core. The fiber has a core diameter of 80 µm and a cladding diameter of 400 µm. The measurements show that the Yb3+ in the high silica fiber core is 15856 ppm by weight, while the refractive index is 0.0024 lower than that of the inner cladding. The amplification performance of the fiber was investigated. The results indicate that nanoporous silica glass based on the glass phase-separation technology has great potential for gain-guided index anti-guided high silica fiber.

Association of acute kidney injury with frailty in elderly population: a systematic review and meta-analysis.

Aim: The objective of this study was to assess whether an elderly patient's frailty was associated with acute kidney injury (AKI) and to examine whether severe frailty group had an increased risk of AKI than mild-moderate group.Methods: We searched The Cochrane Library, PubMed, and EMBASE for relevant studies without language limitations before 1 March 2019 with a priori defined inclusion and exclusion criteria. Five population-based cohort studies were included for systematic review and meta-analysis.Results: Compared with the control group, the frailty group is significantly associated AKI (Odds Ratio = 2.05; 95% CI: 1.23-3.43). The moderate-severe frailty group has an increased risk of AKI than mild frailty group (Hazard Ratio = 2.87; 95% CI: 1.60-5.17.Conclusion: In conclusion, the available best evidence support an association between frailty and AKI among elder patients, thus relevant interventions should be taken among elderly under potential risk of AKI.

Bone mesenchymal stem cells pretreated with erythropoietin enhance the effect to ameliorate cyclosporine A-induced nephrotoxicity in rats.

An increasing number of experiments and clinical trials have demonstrated the safety, feasibility, and efficacy of mesenchymal stem cells (MSCs)-based therapies for the treatment of various diseases. The main drawbacks of MSC therapy are the lack of specific homing after systemic infusion and early death of injected cells because of the injury micro-environment. We pretreated bone mesenchymal stem cells (BMSCs) with erythropoietin (EPO) to investigate their positive effect on cyclosporine A (CsA)-induced nephrotoxicity. BMSCs were incubated with different concentrations of EPO (10, 100, 500, and 1000 IU/mL) for 24 and 48 h, and their proliferation rate, cytoskeletal morphology, migration ability, and the expression of CXCR4 were evaluated to determine the optimal pretreatment conditions. To investigate the therapeutic effects of BMSCs pretreated with EPO in CsA-induced nephrotoxicity, we established CsA-induced in vitro and in vivo toxicity models. In our in vitro study, preconditioning of BMSCs with 500 IU/mL EPO for 48 h induced a marked increase in their proliferation rate, cytoskeletal rearrangement, migration in the scrape-healing assay, and migration toward injured HK2 cells. In vivo, EPO-BMSCs showed higher ability to improve renal function than BMSCs, and in CsA-induced rats treated with EPO-BMSCs, interstitial lymphocyte infiltration, tubular swelling, necrosis, and interstitial fibrosis decreased. We demonstrated that pretreatment with 500 IU/mL EPO before infusion markedly increased the homing ability of BMSCs, and obviously ameliorate CsA-induced nephrotoxicity in rats.

Yb3+ heavily doped photonic crystal fiber lasers prepared by the glass phase-separation technology.

We report a Yb3+ heavily doped photonic crystal fiber with 30 µm core diameter manufactured for the first time by an alternative technique. Silica core rods with a diameter of 3 mm and a length of 280 mm were prepared by the sodium-borosilicate glass phase-separation technology. The measurements show that the fiber has an Yb3+ concentration of 22810 ppm by weight, and a resultant absorption of approximately 8.5 dB/m at 976 nm. The Yb3+ ions are distributed throughout the fiber core with an excellent homogeneity. The laser performance demonstrates a high slope efficiency of 64.5% for laser emission at 1033.4 nm and a low power threshold of 3 W within a short fiber length of 1 m. This novel approach provides an alternative means of preparing large active silica rods with high doping levels and excellent material homogeneity for large mode area fibers with complex designs.

Mechanisms and therapeutic implications of selective autophagy in nonalcoholic fatty liver disease.

BACKGROUND: Nonalcoholic fatty liver disease (NAFLD) has become the most common chronic liver disease worldwide, whereas there is no approved drug therapy due to its complexity. Studies are emerging to discuss the role of selective autophagy in the pathogenesis of NAFLD, because the specificity among the features of selective autophagy makes it a crucial process in mitigating hepatocyte damage caused by aberrant accumulation of dysfunctional organelles, for which no other pathway can compensate. AIM OF REVIEW: This review aims to summarize the types, functions, and dynamics of selective autophagy that are of particular importance in the initiation and progression of NAFLD. And on this basis, the review outlines the therapeutic strategies against NAFLD, in particular the medications and potential natural products that can modulate selective autophagy in the pathogenesis of this disease. KEY SCIENTIFIC CONCEPTS OF REVIEW: The critical roles of lipophagy and mitophagy in the pathogenesis of NAFLD are well established, while reticulophagy and pexophagy are still being identified in this disease due to the insufficient understanding of their molecular details. As gradual blockage of autophagic flux reveals the complexity of NAFLD, studies unraveling the underlying mechanisms have made it possible to successfully treat NAFLD with multiple pharmacological compounds that target associated pathways. Overall, it is convinced that the continued research into selective autophagy occurring in NAFLD will further enhance the understanding of the pathogenesis and uncover novel therapeutic targets.

Exploration of novel human neutrophil elastase inhibitors from natural compounds: Virtual screening, in vitro, molecular dynamics simulation and in vivo study.

BACKGROUND: Human neutrophil elastase (HNE) is an important contributor to lung diseases such as acute lung injury (ALI) or acute respiratory distress syndrome. Therefore, this study aimed to identify natural HNE inhibitors with anti-inflammatory activity through machine learning algorithms, in vitro assays, molecular dynamic simulation, and an in vivo ALI assay. METHODS: Based on the optimized Discovery Studio two-dimensional molecular descriptors, combined with different molecular fingerprints, six machine learning models were established using the Naïve Bayesian (NB) method to identify HNE inhibitors. Subsequently, the optimal model was utilized to screen 6925 drug-like compounds obtained from the Traditional Chinese Medicine Systems Pharmacy Database and Analysis Platform (TCMSP), followed by ADMET analysis. Finally, 10 compounds with reported anti-inflammatory activity were selected to determine their inhibitory activities against HNE in vitro, and the compounds with the best activity were selected for a 100 ns molecular dynamics simulation and its anti-inflammatory effect was evaluated using Poly (I:C)-induced ALI model. RESULTS: The evaluation of the in vitro HNE inhibition efficiency of the 10 selected compounds showed that the flavonoid tricetin had the strongest inhibitory effect on HNE. The molecular dynamics simulation indicated that the binding of tricetin to HNE was relatively stable throughout the simulation. Importantly, in vivo experiments indicated that tricetin treatment substantially improved the Poly (I:C)-induced ALI. CONCLUSION: The proposed NB model was proved valuable for exploring novel HNE inhibitors, and natural tricetin was screened out as a novel HNE inhibitor, which was confirmed by in vitro and in vivo assays for its inhibitory activities.

Vanadium Redox Flow Battery: Review and Perspective of 3D Electrodes.

Vanadium redox flow battery (VRFB) has garnered significant attention due to its potential for facilitating the cost-effective utilization of renewable energy and large-scale power storage. However, the limited electrochemical activity of the electrode in vanadium redox reactions poses a challenge in achieving a high-performance VRFB. Consequently, there is a pressing need to assess advancements in electrodes to inspire innovative approaches for enhancing electrode structure and composition. This work categorizes three-dimensional (3D) electrodes derived from materials such as foam, biomass, and electrospun fibers. By employing a flexible electrode design and compositional functionalization, high-speed mass transfer channels and abundant active sites for vanadium redox reactions can be created. Furthermore, the incorporation of 3D electrocatalysts into the electrodes is discussed, including metal-based, carbon-based, and composite materials. The strong interaction and ordered arrangement of these nanocomposites have an influence on the uniformity and stability of the surface charge distribution, thereby enhancing the electrochemical performance of the composite electrodes. Finally, the challenges and perspectives of VRFB are explored through advancements in 3D electrodes, 3D electrocatalysts, and mechanisms. It is hoped that this review will inspire the development of methodology and concept of 3D electrodes in VRFB, so as to promote the future development of scientific energy storage and conversion technology.

Melanin-like nanoparticles alleviate ischemia-reperfusion injury in the kidney by scavenging reactive oxygen species and inhibiting ferroptosis.

Kidney transplantation is essential for patients with end-stage renal disease; however, ischemia-reperfusion injury (IRI) during transplantation can lead to acute kidney damage and compromise survival. Recent studies have reported that antiferroptotic agents may be a potential therapeutic strategy, by reducing production of reactive oxygen species (ROS). Therefore, we constructed rutin-loaded polydopamine nanoparticles (PEG-PDA@rutin NPs, referred to as PPR NPs) to eliminate ROS resulting from IRI. Physicochemical characterization showed that the PPR NPs were ∼100 nm spherical particles with good ROS scavenging ability. Notably, PPR NPs could effectively enter lipopolysaccharide (LPS)-treated renal tubular cells, then polydopamine (PDA) released rutin to eliminate ROS, repair mitochondria, and suppress ferroptosis. Furthermore, in vivo imaging revealed that PPR NPs efficiently accumulated in the kidneys after IRI and effectively protected against IRI damage. In conclusion, PPR NPs demonstrated an excellent ability to eliminate ROS, suppress ferroptosis, and protect kidneys from IRI.

Interferon lambda in respiratory viral infection: immunomodulatory functions and antiviral effects in epithelium.

Type III interferon (IFN-λ), a new member of the IFN family, was initially considered to possess antiviral functions similar to those of type I interferon, both of which are induced via the JAK/STAT pathway. Nevertheless, recent findings demonstrated that IFN-λ exerts a nonredundant antiviral function at the mucosal surface, preferentially produced in epithelial cells in contrast to type I interferon, and its function cannot be replaced by type I interferon. This review summarizes recent studies showing that IFN-λ inhibits the spread of viruses from the cell surface to the body. Further studies have found that the role of IFN-λ is not only limited to the abovementioned functions, but it can also can exert direct and/or indirect effects on immune cells in virus-induced inflammation. This review focuses on the antiviral activity of IFN-λ in the mucosal epithelial cells and its action on immune cells and summarizes the pathways by which IFN-λ exerts its action and differentiates it from other interferons in terms of mechanism. Finally, we conclude that IFN-λ is a potent epidermal antiviral factor that enhances the respiratory mucosal immune response and has excellent therapeutic potential in combating respiratory viral infections.

Anti-inflammatory effect and pharmacokinetics of dehydroandrographolide, an active component of Andrographis paniculata, on Poly(I:C)-induced acute lung injury.

Acute lung injury (ALI) is a common and critical respiratory disorder caused by various factors, with viral infection being the leading contributor. Dehydroandrographolide (DAP), a constituent of the Chinese herbal plant Andrographis paniculata, exhibits a range of activities including anti-inflammatory, in vitro antiviral and immune-enhancing effects. This study evaluated the anti-inflammatory effects and pharmacokinetics (PK) profile of DAP in ALI mice induced by intratracheal instillation of Poly(I:C) (PIC). The results showed that oral administration of DAP (10-40 mg/kg) effectively suppressed the increase in lung wet-dry weight ratio, total cells, total protein content, accumulation of immune cells, inflammatory cytokines and neutrophil elastase levels in bronchoalveolar lavage fluid of PIC-treated mice. DAP concentrations, determined by an LC-MS/MS method, in plasma after receiving DAP (20 mg/kg) were unchanged compared to those in normal mice. However, DAP concentrations and relative PK parameters in the lungs were significantly altered in PIC-treated mice, exhibiting a relatively higher maximum concentration, larger AUC, and longer elimination half-life than those in the lungs of normal mice. These results demonstrated that DAP could improve lung edema and inflammation in ALI mice, and suggested that lung injury might influence the PK properties of DAP, leading to increased lung distribution and residence. Our study provides evidence that DAP displays significant anti-inflammatory activity against viral lung injury and is more likely to distribute to damaged lung tissue.

Single-cell atlas of human infrapatellar fat pad and synovium implicates APOE signaling in osteoarthritis pathology.

The infrapatellar fat pad (IPFP) and synovium play essential roles in maintaining knee joint homeostasis and in the progression of osteoarthritis (OA). The cellular and transcriptional mechanisms regulating the function of these specialized tissues under healthy and diseased conditions are largely unknown. Here, single-cell and single-nuclei RNA sequencing of human IPFP and synovial tissues were performed to elucidate the cellular composition and transcriptional profile. Computational trajectory analysis revealed that dipeptidyl peptidase 4+ mesenchymal cells function as a common progenitor for IPFP adipocytes and synovial lining layer fibroblasts, suggesting that IPFP and synovium represent an integrated tissue unit. OA induced a profibrotic and inflammatory phenotype in mesenchymal lineage cells with biglycan+ intermediate fibroblasts as a major contributor to OA fibrosis. Apolipoprotein E (APOE) signaling from intermediate fibroblasts and macrophages was identified as a critical regulatory factor. Ex vivo incubation of human cartilage with soluble APOE accelerated proteoglycan degeneration. Inhibition of APOE signaling by intra-articular injection of an anti-APOE neutralizing antibody attenuated the progression of collagenase-induced OA in mice, demonstrating a detrimental effect of APOE on cartilage. Our studies provide a framework for designing further therapeutic strategies for OA by describing the cellular and transcriptional landscape of human IPFP and synovium in healthy versus OA joints.