H2O2 Photosynthesis from H2O and O2 under Weak Light by Carbon Nitrides with the Piezoelectric Effect.

Driven by the essential need of a green, safe, and low-cost approach to producing H2O2, a highly valuable multifunctional chemical, artificial photosynthesis emerges as a promising avenue. However, current catalyst systems remain challenging, due to the need of high-density sunlight, poor selectivity and activity, or/and unfavorable thermodynamics. Here, we reported that an indirect 2e- water oxidation reaction (WOR) in photocatalytic H2O2 production was unusually activated by C5N2 with piezoelectric effects. Interestingly, under ultrasonication, C5N2 exhibited an overall H2O2 photosynthesis rate of 918.4 µM/h and an exceptionally high solar-to-chemical conversion efficiency of 2.6% after calibration under weak light (0.1 sun). Mechanism studies showed that the piezoelectric effect of carbon nitride overcame the high uphill thermodynamics of *OH intermediate generation, which enabled a new pathway for 2e- WOR, the kinetic limiting step in the overall H2O2 production from H2O and O2. Benefiting from the outstanding sonication-assisted photocatalytic H2O2 generation under weak light, the concept was further successfully adapted to biomedical applications in efficient sono-photochemodynamic therapy for cancer treatment and water purification.

Spin-Adapted Externally Contracted Multireference Configuration Interaction Method Based on Selected Reference Configurations.

As one kind of approximation of the full configuration interaction solution, the selected configuration interaction (sCI) methods have been shown to be valuable for large active spaces. However, the inclusion of dynamic correlation beyond large active spaces is necessary for more quantitative results. Since the sCI wave function can provide a compact reference for multireference methods, previously, we proposed an externally contracted multireference configuration interaction method using the sCI reference reconstructed from the density matrix renormalization group wave function [J. Chem. Theory Comput. 2018, 14, 4747-4755]. The DMRG2sCI-EC-MRCI method is promising for dealing with more than 30 active orbitals and large basis sets. However, it suffers from two drawbacks: spin contamination and low efficiency when using Slater determinant bases. To solve these problems, in this work, we adopt configuration state function bases and introduce a new algorithm based on the hybrid of tree structure for convenient configuration space management and the graphical unitary group approach for efficient matrix element calculation. The test calculation of naphthalene shows that the spin-adapted version could achieve a speed-up of 6.0 compared with the previous version based on the Slater determinant. Examples of dinuclear copper(II) compound as well as Ln(III) and An(III) complexes show that the sCI-EC-MRCI can give quantitatively accurate results by including dynamic correlation over sCI for systems with large active spaces and basis sets.

Theoretical investigation of distal charge separation in a perylenediimide trimer.

An exciton-phonon (ex-ph) model based on our recently developed block interaction product basis framework is introduced to simulate the distal charge separation (CS) process in aggregated perylenediimide (PDI) trimer incorporating the quantum dynamic method, i.e., the time-dependent density matrix renormalization group. The electronic Hamiltonian in the ex-ph model is represented by nine constructed diabatic states, which include three local excited (LE) states and six charge transfer (CT) states from both the neighboring and distal chromophores. These diabatic states are automatically generated from the direct products of the leading localized neutral or ionic states of each chromophore's reduced density matrix, which are obtained from ab initio quantum chemical calculation of the subsystem consisting of the targeted chromophore and its nearest neighbors, thus considering the interaction of the adjacent environment. In order to quantum-dynamically simulate the distal CS process with massive coupled vibrational modes in molecular aggregates, we used our recently proposed hierarchical mapping approach to renormalize these modes and truncate those vibrational modes that are not effectively coupled with electronic states accordingly. The simulation result demonstrates that the formation of the distal CS process undergoes an intermediate state of adjacent CT, i.e., starts from the LE states, passes through an adjacent CT state to generate the intermediates (∼200 fs), and then formalizes the targeted distal CS via further charge transference (∼1 ps). This finding agrees well with the results observed in the experiment, indicating that our scheme is capable of quantitatively investigating the CS process in a realistic aggregated PDI trimer and can also be potentially applied to exploring CS and other photoinduced processes in larger systems.

Associations between resting heart rate and cognitive decline in Chinese oldest old individuals: a longitudinal cohort study.

BACKGROUND: The trajectories of cognitive function in the oldest old individuals is unclear, and the relationship between resting heart rate (RHR) and cognitive decline is controversial. METHODS: 3300 participants who had cognitive function repeatedly measured 4 ~ 8 times were included, and latent class growth mixed models were used to identified the cognitive function trajectories. Cognitive decline was defined by the trajectory shapes, considering level and slope. After excluding individuals with sinus rhythm abnormal, 3109 subjects were remained and were divided into five groups by their RHR. Logistic regression models were used to estimate the relationship between RHR and cognitive decline. RESULTS: Three distinct cognitive function trajectory groups were identified: high-stable (n = 1226), medium-decreasing (n = 1526), and rapid-decreasing (n = 357). Individuals of medium/rapid-decreasing group were defined as cognitive decline. Adjusting for covariates, the odds ratios (95% confidence intervals) of RHR sub-groups were 1.19 (0.69, 2.05), 1.27 (1.03, 1.56), 1.30 (1.01, 1.67) and 1.62 (1.07, 2.47) for those RHR < 60 bpm, 70 ~ 79 bpm, 80 ~ 89 bpm and > 90 bpm respectively, compared with those RHR 60 ~ 69 bpm. The interaction effect between RHR and physical activity (PA) on cognitive decline was found, and stratification analysis was presented that higher RHR would only show risk effects on cognitive decline in those with physical inactivity (P < 0.05 for all). CONCLUSIONS: Our study demonstrates RHR more than 70 bpm present significant risk effect on cognitive decline, and this relationship is modified by PA. Elder population with physical inactivity and higher RHR should be paid more attention to prevent cognitive decline.

Tumor-suppressive E3 ubiquitin ligase CHIP inhibits the PBK/ERK axis to repress stem cell properties and radioresistance in non-small cell lung cancer.

Recently, radioresistant cancer cells surviving radiotherapy have been suggested to show more aggressive phenotypes than parental cells, and the underlying mechanisms may be associated with cancer stem cells. This study provided novel mechanistic insights for E3 ubiquitin ligase CHIP in stem cell properties and radioresistance of non-small cell lung cancer (NSCLC). After bioinformatic prediction for key genes involved, NSCLC tissues and cells were collected to measure the expression of CHIP and PBK. E3 ubiquitin ligase CHIP was poorly expressed, while PBK was highly expressed in NSCLC tissues and cells. CHIP reduced the protein stability of PBK through the ubiquitin-protease pathway to repress the activation of ERK pathway. Based on the gain- or loss-of-function experiments, it was noted that restoration of CHIP curtailed stem cell properties and radioresistance in NSCLC, as manifested by inhibited sphere formation and cell proliferation, decreased number of CD133+CD44+ cells and expression of OCT4, SOX2, and NANOG, as well as facilitated apoptosis of NSCLC cells. Besides, in vivo animal experiments further confirmed that CHIP restrained tumorigenic ability and improved radiosensitivity of NSCLC cells by inhibiting PBK/ERK axis. Collectively, CHIP suppressed stem cell properties and radioresistance of NSCLC cells by inhibiting PBK/ERK axis, therefore offering a potential therapeutic target for enhancing efficacy of radiotherapy.

Kylin 1.0: An ab-initio density matrix renormalization group quantum chemistry program.

The accurate evaluation of electron correlations is highly necessary for the proper descriptions of the electronic structures in strongly correlated molecules, ranging from bond-dissociating molecules, polyradicals, to large conjugated molecules and transition metal complexes. For this purpose, in this paper, a new ab-initio quantum chemistry program Kylin 1.0 for electron correlation calculations at various quantum many-body levels, including configuration interaction (CI), perturbation theory (PT), and density matrix renormalization group (DMRG), is presented. Furthermore, fundamental quantum chemistry methods such as Hartree-Fock self-consistent field (HF-SCF) and the complete active space SCF (CASSCF) are also implemented. The Kylin 1.0 program possesses the following features: (1) a matrix product operator (MPO) formulation-based efficient DMRG implementation for describing static electron correlation within a large active space composed of more than 100 orbitals, supporting both U 1 n × U 1 S z and U 1 n × SU 2 S symmetries; (2) an efficient second-order DMRG-self-consistent field (SCF) implementation; (3) an externally contracted multi-reference CI (MRCI) and Epstein-Nesbet PT with DMRG reference wave functions for including the remaining dynamic electron correlation outside the large active spaces. In this paper, we introduce the capabilities and numerical benchmark examples of the Kylin 1.0 program.

Suppressing Non-Radiative Relaxation through Single-Atom Metal Modification for Enhanced Fluorescence Efficiency in Molybdenum Disulfide Quantum Dots.

To enhance the fluorescence efficiency of semiconductor nanocrystal quantum dots (QDs), strategies via enhancing photo-absorption and eliminating non-radiative relaxation have been proposed. In this study, we demonstrate that fluorescence efficiency of molybdenum disulfide quantum dots (MoS2 QDs) can be enhanced by single-atom metal (Au, Ag, Pt, Cu) modification. Four-fold enhancement of the fluorescence emission of MoS2 QDs is observed with single-atom Au modification. The underlying mechanism is ascribed to the passivation of non-radiative surface states owing to the new defect energy level of Au in the forbidden band that can trap excess electrons in n-type MoS2 , increasing the recombination probability of conduction band electrons with valence band holes of MoS2 . Our results open an avenue for enhancing the fluorescence efficiency of QDs via the modification of atomically dispersed metals, and extend their scopes and potentials in a fundamental way for economic efficiency and stability of single-atom metals.

Theoretical Study of Effects of Solvents, Ligands, and Anions on Separation of Trivalent Lanthanides and Actinides.

Due to its associated low CO2 emissions, nuclear energy production is rapidly growing. In this context, the treatment of high-level liquid waste (HLLW) of nuclear plants is of high concern to both scientific and industrial communities. Specifically, the separation of An(III) and Ln(III) cations when processing nuclear fuel is a vitally important, yet challenging, step within HLLW because An(III) and Ln(III) have similar chemical properties in solution. To guide the choice of relevant ligands, anions, and solvents for this separation step, in this work, we calculate and compare the free energy of formation of different Am(III) and Eu(III) complexes (which are typical and important An(III) and Ln(III) cation examples), involving two different ligands and three different counter ions in four different solvents. Based on our calculations, we predict that the chosen solvent is a key factor in the extraction of Am(III) and Eu(III) in treatment of HLLW. This study supports a systematic, computation-assisted screening of solvents and extractive ligands with counter anions as a proficient method to optimize the separation of Ln(III) and An(III).

Quantum dynamics simulation of intramolecular singlet fission in covalently linked tetracene dimer.

In this work, we study singlet fission in tetracene para-dimers, covalently linked by a phenyl group. In contrast to most previous studies, we account for the full quantum dynamics of the combined excitonic and vibrational system. For our simulations, we choose a numerically unbiased representation of the molecule's wave function, enabling us to compare with experiments, exhibiting good agreement. Having access to the full wave function allows us to study in detail the post-quench dynamics of the excitons. Here, one of our main findings is the identification of a time scale t0 ≈ 35 fs dominated by coherent dynamics. It is within this time scale that the larger fraction of the singlet fission yield is generated. We also report on a reduced number of phononic modes that play a crucial role in the energy transfer between excitonic and vibrational systems. Notably, the oscillation frequency of these modes coincides with the observed electronic coherence time t0. We extend our investigations by also studying the dependency of the dynamics on the excitonic energy levels that, for instance, can be experimentally tuned by means of the solvent polarity. Here, our findings indicate that the singlet fission yield can be doubled, while the electronic coherence time t0 is mainly unaffected.

Mechanisms of a Cyclobutane-Fused Lactone Hydrolysis in Alkaline and Acidic Conditions.

Searching for functional polyesters with stability and degradability is important due to their potential applications in biomedical supplies, biomass fuel, and environmental protection. Recently, a cyclobutane-fused lactone (CBL) polymer was experimentally found to have superior stability and controllable degradability through hydrolysis reactions after activation by mechanical force. In order to provide a theoretical basis for developing new functional degradable polyesters, in this work, we performed a detailed quantum chemical study of the alkaline and acidic hydrolysis of CBL using dispersion-corrected density functional theory (DFT-D3) and mixed implicit/explicit solvent models. Various possible hydrolysis mechanisms were found: BAC2 and BAL2 in the alkaline condition and AAC2, AAL2, and AAL1 in the acidic condition. Our calculations indicated that CBL favors the BAC2 and AAC2 mechanisms in alkaline and acidic conditions, respectively. In addition, we found that incorporating explicit water solvent molecules is highly necessary because of their strong hydrogen-bonding with reactant/intermediate/product molecules.

Depression and anxiety symptoms are associated with problematic smartphone use under the COVID-19 epidemic: The mediation models.

COVID-19 epidemic has brought wide psychological impacts on the young adults. To investigate the depression and anxiety symptoms and their associations with problematic smartphone use under the COVID-19 epidemic, a total of 847 Chinese undergraduate students joined in this study and were measured with their levels of depression and anxiety symptoms, resilience, perceived social support, the sense of school belonging and problematic smartphone use. Results showed that among the Chinese undergraduate students, the disorder rates of depression and anxiety symptoms were 29.16% and 46.64% respectively, and their symptoms ranged from mild to extreme severe. Depression and anxiety symptoms both positively predicted problematic smartphone use. Resilience, perceived social support and the sense of school belonging partially mediated both associations; resilience and the sense of school belonging exerted buffering effects, while perceived social support exacerbated the impacts. The current study advanced our understanding of the COVID-19 impacts and furthermore, suggested the protective factors for mitigating these impacts.

Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect.

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1·PF6, PF6- = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH- ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Automatic Selection of Active Orbitals from Generalized Valence Bond Orbitals.

The accurate multireference (MR) calculation of a strongly correlated chemical system usually relies on a correct preselection of a small number of active orbitals from numerous molecular orbitals. Currently, the active orbitals are generally determined by using a trial-and-error method. Such a preselection by chemical intuition and personal experience may be tedious or unreliable, especially for large complicated systems, and accordingly, the construction of active space becomes a bottleneck for large-scale MR calculations. In this work, we propose to automatically select the active orbitals according to the natural orbital occupation numbers by performing black box generalized valence bond calculations. We demonstrate the accuracy of this method through testing calculations of the ground states in various systems, ranging from bond dissociation of diatomic molecules (N2, C2, Cr2) to conjugated molecules (pentacene, hexacene, and heptacene) as well as a binuclear transition-metal complex [Mn2O2(H2O)2(terpy)2]3+ (terpy = 2,2':6,2″-terpyridine) with active spaces up to (30e, 30o) and comparing with the complete active space self-consistent field (CASSCF), density matrix renormalization group (DMRG)-CASSCF references, and other recently proposed inexpensive strategies for constructing active spaces. The results indicate that our method is among the most successful ones within our comparison, providing high-quality initial active orbitals very close to the finally optimized (DMRG-)CASSCF orbitals. The method proposed here is expected to greatly benefit the practical implementation of large active space ground-state MR calculations, for example, large-scale DMRG calculations.

Singlet Fission Dynamics in Tetracene Single Crystals Probed by Polarization-Dependent Two-Dimensional Electronic Spectroscopy.

The exact mechanism of endothermic singlet fission in crystalline polyacene remains to be clarified. It has been elusive whether the excess energy of vibrational hot states and the upper branch of Davydov splitting is important for the energy compensation. Here, we probe the excited-state specified singlet fission dynamics in tetracene single crystals by polarization-dependent two-dimensional electronic spectroscopy (2DES). While a major spectral transfer with a characteristic lifetime of 86 ps is observed to be largely independent of the excitation energy due to formation of the spatially separated triplet pairs (1(T···T)), the excitation-energy dependent subpicosecond dynamics show marked differences for different states probed, implying the possible involvement of a coherently formed triplet pair state (1(TT)). Analysis of coherent vibrational modes suggests the coupling to high energy modes may offset the energy difference between singlet and triplet pair states. Moreover, the beating map of the low frequency mode indicates a vibrational hot state violating the aggregation behavior of Davydov exciton, which can be explained as a resonance of the 1(TT) state. These results suggest that the coherent vibronic mixing between local excitation and triplet pair states is essential for the singlet fission dynamics in molecule aggregates.

Charge transfer via deep hole in the J51/N2200 blend.

In recently developed non-fullerene acceptor (NFA) based organic solar cells (OSCs), both the donor and acceptor parts can be excited by absorbing light photons. Therefore, both the electron transfer and hole transfer channels could occur at the donor/acceptor interface for generating free charge carriers in NFA based OSCs. However, in many molecular and DNA systems, recent studies revealed that the high charge transfer (CT) efficiency cannot be reasonably explained by a CT model with only highest occupied molecular orbitals (HOMOs) and lowest unoccupied molecular orbitals (LUMOs) of donor and acceptor molecules. In this work, taking an example of a full-polymer blend consisting of benzodithiophene-alt-benzotriazole copolymers (J51) as donor and naphthalene diimide-bithiophene (N2200) as acceptor, in which the ultrafast hole transfer has been recently reported, we investigate its CT process and examine the different roles of various frontier molecular orbitals (FMOs). Through a joint study of quantum mechanics electronic structure calculation and nonadiabatic dynamics simulation, we find that the hole transfer between HOMOs of J51 and N2200 can hardly happen, but the hole transfer from HOMO of N2200 to HOMO - 1 of J51 is much more efficient. This points out the underlying importance of the deep hole channel in the CT process and indicates that including FMOs other than HOMOs and LUMOs is highly necessary to build a robust physical model for studying the CT process in molecular optoelectronic materials.

High-Performance Inverted Planar Perovskite Solar Cells Enhanced by Thickness Tuning of New Dopant-Free Hole Transporting Layer.

A new hole transporting material (HTM) named DMZ is synthesized and employed as a dopant-free HTM in inverted planar perovskite solar cells (PSCs). Systematic studies demonstrate that the thickness of the hole transporting layer can effectively enhance the morphology and crystallinity of the perovskite layer, leading to low series resistance and less defects in the crystal. As a result, the champion power conversion efficiency (PCE) of 18.61% with JSC = 22.62 mA cm-2 , VOC = 1.02 V, and FF = 81.05% (an average one is 17.62%) is achieved with a thickness of ≈13 nm of DMZ (2 mg mL-1 ) under standard global AM 1.5 illumination, which is ≈1.5 times higher than that of devices based on poly(3,4-ethylenedioxythiophene)/poly(styrene sulfonic acid) (PEDOT:PSS). More importantly, the devices based on DMZ exhibit a much better stability (90% of maximum PCE retained after more than 556 h in air (relative humidity ≈ 45%-50%) without any encapsulation) than that of devices based on PEDOT:PSS (only 36% of initial PCE retained after 77 h in same conditions). Therefore, the cost-effective and facile material named DMZ offers an appealing alternative to PEDOT:PSS or polytriarylamine for highly efficient and stable inverted planar PSCs.

Carbon Dioxide (CO2) Fixation: Linearly Bridged Zn2 Paddlewheel Nodes by CO2 in a Metal-Organic Framework.

When the reaction of zinc nitrate with 4',4‴,4‴″,4‴‴'-(ethene-1,1,2,2-tetrayl)tetrakis[(1,1'-biphenyl-3-carboxylic acid)] (H4tmpe) in dimethylformamide (DMF) under hydrothermal condition is performed in air or carbon dioxide (CO2), [Zn4(tmpe)2(H2O)2(µ2-CO2)]·8DMF·18H2O (1) crystallizes out. However, if it is in dioxygen, argon, or carbon monoxide, [Zn2(tmpe)(DMF)]·2DMF·8H2O (2) is the product. Both compounds are chemically stable coordination polymers. 1 contains zinc carboxylate paddlewheels as nodes linearly bridged by CO2 into two interpenetrating lattices, and 2 has an infinite single framework formed by a tetranuclear node. 1 is the second example containing the linear CO2-bridged paddlewheel node. Interestingly, CO2 fixation in a µ2-η2O,O bridging mode is observed in 1, which is rarely characterized structurally and has been confirmed using IR and gas chromatography analysis. The stability of 1 is further verified by density functional theory calculations, which found an energy minimum with a Zn-O═C angle of 180°. Both compounds display strong emission around 490 nm and excited-state lifetimes around 2.4 ns.

A molecular contact theory for simulating polarization: application to dielectric constant prediction.

Microscopic polarization in liquids, which is challenging to account for intuitively and quantitatively, can impact the behavior of liquids in numerous ways and thus is ubiquitous in a broad range of domains and applications. To overcome this challenge, in this work, a molecular contact theory was proposed as a proxy to simulate microscopic polarization in liquids. In particular, molecular surfaces from implicit solvation models were used to predict both the dipole moment of individual molecules and mutual orientations arising from contacts between molecules. Then, the calculated dipole moments and orientations were combined in an analytical coupling, which allowed for the prediction of effective (polarized) dipole moments for all distinct species in the liquid. As a proof-of-concept, the model focused on predicting the dielectric constant and was tested on 420 pure liquids, 269 binary organic mixtures (3792 individual compositions) and 46 aqueous mixtures (704 individual compositions). The model proved to be flexible enough to reach an unprecedented satisfactory mean relative error of about 16-22% and a classification accuracy of 84-90% within four meaningful classes of weak, low average, high average and strong dielectric constants. The method also proved to be computationally very efficient, with calculation times ranging from a few seconds to about ten minutes on a personal computer with a single CPU. This success demonstrates that much of the microscopic polarization concept can be satisfactorily described based on a simple molecular contact theory. Moreover, the new model for dielectric constants provides a useful alternative to computationally expensive molecular dynamics simulations for large scale virtual screenings in chemical engineering and material sciences.

Time-dependent density matrix renormalization group quantum dynamics for realistic chemical systems.

Electronic and/or vibronic coherence has been found by recent ultrafast spectroscopy experiments in many chemical, biological, and material systems. This indicates that there are strong and complicated interactions between electronic states and vibration modes in realistic chemical systems. Therefore, simulations of quantum dynamics with a large number of electronic and vibrational degrees of freedom are highly desirable. Due to the efficient compression and localized representation of quantum states in the matrix-product state (MPS) formulation, time-evolution methods based on the MPS framework, which we summarily refer to as tDMRG (time-dependent density-matrix renormalization group) methods, are considered to be promising candidates to study the quantum dynamics of realistic chemical systems. In this work, we benchmark the performances of four different tDMRG methods, including global Taylor, global Krylov, and local one-site and two-site time-dependent variational principles (1TDVP and 2TDVP), with a comparison to multiconfiguration time-dependent Hartree and experimental results. Two typical chemical systems of internal conversion and singlet fission are investigated: one containing strong and high-order local and nonlocal electron-vibration couplings and the other exhibiting a continuous phonon bath. The comparison shows that the tDMRG methods (particularly, the 2TDVP method) can describe the full quantum dynamics in large chemical systems accurately and efficiently. Several key parameters in the tDMRG calculation including the truncation error threshold, time interval, and ordering of local sites were also investigated to strike the balance between efficiency and accuracy of results.

Boosting Luminance Energy Transfer Efficiency in Upconversion Nanoparticles with an Energy-Concentrating Zone.

Despite the successful application of upconversion nanoparticles (UCNPs), their low energy transfer efficiency is still a bottleneck to further applications. Here we design UCNPs with a multilayer structure, including an inert NaYF4 :Gd core and an energy-concentrating zone (ECZ), for efficient energy concentration. The ECZ is composed of an emitting layer of NaYF4 :Yb,Er and an absorption layer of NaYF4 :Nd,Yb with antenna IRDye 800CW to manipulate the energy transfer. The stable and tight packing of 800CW linked originally with a bisphosphonate ligand improves greatly the transfer efficiency. The proximity of the emitting layer to both surface antenna and accepter also decreases energy depletion. Compared to classical UCNPs, the ECZ UCNPs show 3600 times higher luminescence intensity with an energy transfer efficiency near 60 %. In proof-of-concept applications, this type of structure was employed for Hg2+ detection and for photodynamic therapy under hypoxic conditions.