Analysis of nonsynonymous SNPs in candidate genes that influence bovine temperament and evaluation of their effect in Brahman cattle.

BACKGROUND: Temperament is an important production trait in cattle and multiple strategies had been developed to generate molecular markers to assist animal selection. As nonsynonymous single nucleotide polymorphisms are markers with the potential to affect gene functions, they could be useful to predict phenotypic effects. Genetic selection of less stress-responsive, temperamental animals is desirable from an economic and welfare point of view. METHODS AND RESULTS: Two nonsynonymous single nucleotide polymorphisms identified in HTR1B and SLC18A2 candidate genes for temperament were analyzed in silico to determine their effects on protein structure. Those nsSNPs allowing changes in proteins were selected for a temperament association analysis in a Brahman population. Transversion effects on protein structure were evaluated in silico for each amino acid change model, revealing structural changes in the proteins of the HTR1B and SLC18A2 genes. The selected nsSNPs were genotyped in a Brahman population (n = 138), and their genotypic effects on three temperament traits were analyzed: exit velocity, pen score, and temperament score. Only the SNP rs209984404-HTR1B (C/A) showed a significant association (P = 0.0144) with pen score. The heterozygous genotype showed a pen score value 1.17 points lower than that of the homozygous CC genotype. CONCLUSION: The results showed that in silico analysis could direct the selection of nsSNPs with the potential to change the protein. Non-synonymous single nucleotide polymorphisms causing structural changes and reduced protein stability were identified. Only rs209984404-HTR1B shows that the allele affecting protein stability was associated with the genotype linked to docility in cattle.

A Review of Successes and Impeding Challenges of IoT-Based Insect Pest Detection Systems for Estimating Agroecosystem Health and Productivity of Cotton.

Using artificial intelligence (AI) and the IoT (Internet of Things) is a primary focus of applied engineering research to improve agricultural efficiency. This review paper summarizes the engagement of artificial intelligence models and IoT techniques in detecting, classifying, and counting cotton insect pests and corresponding beneficial insects. The effectiveness and limitations of AI and IoT techniques in various cotton agricultural settings were comprehensively reviewed. This review indicates that insects can be detected with an accuracy of between 70 and 98% using camera/microphone sensors and enhanced deep learning algorithms. However, despite the numerous pests and beneficial insects, only a few species were targeted for detection and classification by AI and IoT systems. Not surprisingly, due to the challenges of identifying immature and predatory insects, few studies have designed systems to detect and characterize them. The location of the insects, sufficient data size, concentrated insects on the image, and similarity in species appearance are major obstacles when implementing AI. Similarly, IoT is constrained by a lack of effective field distance between sensors when targeting insects according to their estimated population size. Based on this study, the number of pest species monitored by AI and IoT technologies should be increased while improving the system's detection accuracy.

Analysis of Polycerate Mutants Reveals the Evolutionary Co-option of HOXD1 for Horn Patterning in Bovidae.

In the course of evolution, pecorans (i.e., higher ruminants) developed a remarkable diversity of osseous cranial appendages, collectively referred to as "headgear," which likely share the same origin and genetic basis. However, the nature and function of the genetic determinants underlying their number and position remain elusive. Jacob and other rare populations of sheep and goats are characterized by polyceraty, the presence of more than two horns. Here, we characterize distinct POLYCERATE alleles in each species, both associated with defective HOXD1 function. We show that haploinsufficiency at this locus results in the splitting of horn bud primordia, likely following the abnormal extension of an initial morphogenetic field. These results highlight the key role played by this gene in headgear patterning and illustrate the evolutionary co-option of a gene involved in the early development of bilateria to properly fix the position and number of these distinctive organs of Bovidae.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milosevic et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

A SNP within the PMCH gene as a molecular marker associated with fertility traits in Angus and Brangus beef heifers raised under a desert environment.

Components of the GH/IGF1 endocrine axis regulate growth and reproductive traits in cattle. The pro-melanin-concentrating hormone (PMCH) gene located within chromosome 5 belongs to this axis. Objective herein was to evaluate PMCH single-nucleotide polymorphisms (SNPs) as molecular markers associated with age at first calving, calving interval, and age at second calving in Angus and Brangus beef heifers raised in desert conditions. Five SNPs within the PMCH gene were included in the study. Three of these SNPs had minor allele frequency > 10% and only one SNP did not deviate from Hardy-Weinberg equilibrium. A genotype to phenotype association analyses was performed using a mixed-effects model which included phenotype as the response variable, SNP genotype, breed, year of birth and age of dam as fixed terms, and sire as a random effect. Genotypes from the SNP rs135033882 were found to be associated (P < 0.05) with all evaluated fertility traits, and the term breed resulted as a significant source of variation only for age at second calving. The allele A was the favorable allele because it decreased the age at first calving 98.6 days, the calving interval 85.3 days, and the age at second calving 183.1 days, in Angus and Brangus heifers. In conclusion, we proposed a SNP within the PMCH gene as a potential candidate marker associated with reproductive performance in Angus and Brangus beef heifers raised in a desert climate.

Identification of a major locus interacting with MC1R and modifying black coat color in an F2 Nellore-Angus population.

BACKGROUND: In cattle, base color is assumed to depend on the enzymatic activity specified by the MC1R locus, i.e. the extension locus, with alleles coding for black (E(D)), red (e), and wild-type (E+). In most mammals, these alleles are presumed to follow the dominance model of E(D) > E+ > e, although exceptions are found. In Bos indicus x Bos taurus F2 cattle, some E(D)E+ heterozygotes are discordant with the dominance series for MC1R and display various degrees of red pigmentation on an otherwise predicted black background. The objective of this study was to identify loci that modify black coat color in these individuals. RESULTS: Reddening was classified with a subjective scoring system. Interval analyses identified chromosome-wide suggestive (P < 0.05) and significant (P < 0.01) QTL on bovine chromosomes (BTA) 4 and 5, although these were not confirmed using single-marker association or Bayesian methods. Evidence of a major locus (F = 114.61) that affects reddening was detected between 60 and 73 Mb on BTA 6 (Btau4.0 build), and at 72 Mb by single-marker association and Bayesian methods. The posterior mean of the genetic variance for this region accounted for 43.75% of the genetic variation in reddening. This region coincided with a cluster of tyrosine kinase receptor genes (PDGFRA, KIT and KDR). Fitting SNP haplotypes for a 1 Mb interval that contained all three genes and centered on KIT accounted for the majority of the variation attributed to this major locus, which suggests that one of these genes or associated regulatory elements, is responsible for the majority of variation in degree of reddening. CONCLUSIONS: Recombinants in a 5 Mb region surrounding the cluster of tyrosine kinase receptor genes implicated PDGFRA as the strongest positional candidate gene. A higher density marker panel and functional analyses will be required to validate the role of PDGFRA or other regulatory variants and their interaction with MC1R for the modification of black coat color in Bos indicus influenced cattle.

Host plant resistance against tomato spotted wilt virus in peanut (Arachis hypogaea) and its impact on susceptibility to the virus, virus population genetics, and vector feeding behavior and survival.

Tomato spotted wilt virus (TSWV) severely affects peanut production in the southeastern United States. Breeding efforts over the last three decades resulted in the release of numerous peanut genotypes with field resistance to TSWV. The degree of field resistance in these genotypes has steadily increased over time, with recently released genotypes exhibiting a higher degree of field resistance than older genotypes. However, most new genotypes have never been evaluated in the greenhouse or laboratory against TSWV or thrips, and the mechanism of resistance is unknown. In this study, TSWV-resistant and -susceptible genotypes were subjected to TSWV mechanical inoculation. The incidence of TSWV infection was 71.7 to 87.2%. Estimation of TSWV nucleocapsid (N) gene copies did not reveal significant differences between resistant and susceptible genotypes. Parsimony and principal component analyses of N gene nucleotide sequences revealed inconsistent differences between virus isolates collected from resistant and susceptible genotypes and between old (collected in 1998) and new (2010) isolates. Amino acid sequence analyses indicated consistent differences between old and new isolates. In addition, we found evidence for overabundance of nonsynonymous substitutions. However, there was no evidence for positive selection. Purifying selection, population expansion, and differentiation seem to have influenced the TSWV populations temporally rather than positive selection induced by host resistance. Choice and no-choice tests indicated that resistant and susceptible genotypes differentially affected thrips feeding and survival. Thrips feeding and survival were suppressed on some resistant genotypes compared with susceptible genotypes. These findings reveal how TSWV resistance in peanut could influence evolution, epidemiology, and management of TSWV.

Seasonal dynamics of thrips (Thrips tabaci) (Thysanoptera: Thripidae) transmitters of iris yellow spot virus: a serious viral pathogen of onion bulb and seed crops.

Thrips-transmitted Iris yellow spot virus (IYSV) is an important economic constraint to the production of bulb and seed onion crops in the United States and many other parts of the world. Because the virus is exclusively spread by thrips, the ability to rapidly detect the virus in thrips vectors would facilitate studies on the role of thrips in virus epidemiology, and thus formulation of better vector management strategies. Using a polyclonal antiserum produced against the recombinant, Escherichia coli-expressed nonstructural protein coded by the small (S) RNA of IYSV, an enzyme linked immunosorbent assay was developed for detecting IYSV in individual as well as groups of adult thrips. The approach enabled estimating the proportion of potential thrips transmitters in a large number of field-collected thrips collected from field-grown onion plants. Availability of a practical and inexpensive test to identify viruliferous thrips would be useful in epidemiological studies to better understand the role of thrips vectors in outbreaks of this economically important virus of onion.

Alternative parameterizations of relatedness in whole genome association analysis of pre-weaning traits of Nelore-Angus calves.

Gestation length, birth weight, and weaning weight of F2 Nelore-Angus calves (n = 737) with designed extensive full-sibling and half-sibling relatedness were evaluated for association with 34,957 SNP markers. In analyses of birth weight, random relatedness was modeled three ways: 1) none, 2) random animal, pedigree-based relationship matrix, or 3) random animal, genomic relationship matrix. Detected birth weight-SNP associations were 1,200, 735, and 31 for those parameterizations respectively; each additional model refinement removed associations that apparently were a result of the built-in stratification by relatedness. Subsequent analyses of gestation length and weaning weight modeled genomic relatedness; there were 40 and 26 trait-marker associations detected for those traits, respectively. Birth weight associations were on BTA14 except for a single marker on BTA5. Gestation length associations included 37 SNP on BTA21, 2 on BTA27 and one on BTA3. Weaning weight associations were on BTA14 except for a single marker on BTA10. Twenty-one SNP markers on BTA14 were detected in both birth and weaning weight analyses.

Comparison of breeding value prediction for two traits in a Nellore-Angus crossbred population using different Bayesian modeling methodologies.

The objectives of this study were to 1) compare four models for breeding value prediction using genomic or pedigree information and 2) evaluate the impact of fixed effects that account for family structure. Comparisons were made in a Nellore-Angus population comprising F2, F3 and half-siblings to embryo transfer F2 calves with records for overall temperament at weaning (TEMP; n = 769) and Warner-Bratzler shear force (WBSF; n = 387). After quality control, there were 34,913 whole genome SNP markers remaining. Bayesian methods employed were BayesB (π̃ = 0.995 or 0.997 for WBSF or TEMP, respectively) and BayesC (π = 0 and π̃), where π̃ is the ideal proportion of markers not included. Direct genomic values (DGV) from single trait Bayesian analyses were compared to conventional pedigree-based animal model breeding values. Numerically, BayesC procedures (using π̃) had the highest accuracy of all models for WBSF and TEMP (ρ̂gg = 0.843 and 0.923, respectively), but BayesB had the least bias (regression of performance on prediction closest to 1, ß̂y,x = 2.886 and 1.755, respectively). Accounting for family structure decreased accuracy and increased bias in prediction of DGV indicating a detrimental impact when used in these prediction methods that simultaneously fit many markers.

Herbal extract dietary supplementation effect on growth performance and meat quality in broiler raised under two stocking densities.

The number of birds or their total live weight in relation to a given area is known as stocking density; higher stocking densities will cause more stress to the birds, which may have an impact on their physiological state, productivity, carcass quality, growth performance, immunity, metabolism, and meat quality. The present study aimed to investigate the potential impact of 2 different stocking densities on growth performance, carcass characteristics, meat quality, serum, and expression of Insulin like growth factor-1 (IGF-1), muscle regulatory genes expression and serum biochemical indicators of broilers supplemented with essential oils (EO). In total, 784-day-old chicks of Ross 308 were randomly assigned into 4 different groups with 7 replicates for each: Normal feed (no essential oils [EO] added) and normal stocking as 9 bird/m2, (NSD). Normal feed (no essential oils [EO] added) and high stocking as 14 bird/m2, (HSD). Feed with essential oils (Digestarom DC® 150 g/Ton of feed) and normal stocking as 9 birds/m2, (NSD + EO). Feed with essential oils (Digestarom DC® 150 g/Ton of feed) and high stocking as 14 birds/m2, (HSD + EO) for 35 days. Bodyweight was recorded at the beginning of the trial and then at the end of each week, feed intake was recorded at the end of each week as well. A total of 28 birds (7 birds per treatment) birds were slaughtered at 35 days of age to evaluate each parameter. The HSD group had the lowest (P < 0.05) feed intake. The NSD groups showed the highest (P < 0.05) body weight gain compared to HSD groups. The HSD + EO had lower adjusted FCR (P < 0.05) compared to HSD. The legs % was the highest (P < 0.05) for NSD group, while HSD + EO had the highest (P < 0.05) Fat Pad percentage. Moreover, HSD had the highest CL%, and the lowest WHC and Warner-Bratzler shear force. For biochemical indicators, (IGF-1) was the lowest (P < 0.05) HSD group. Also, Mammalian Target of Rapamycin (mTOR) and Aspartate Aminotransferase (AST) were higher (P < 0.05) in the EO supplemented groups. Regarding gene expression, the results showed that Myogenin (MyoG) and IGF-1 were lower in HSD while MSTN was higher in the same group, (P < 0.05). In brief, essential oil supplement has improved the performance of broilers under high stocking density situation.

Genetic evaluation of crossbred Bos indicus cow temperament at parturition.

Cow temperament at parturition may be mostly a measure of aggressiveness. The heritability of cow temperament at parturition in Bos taurus cows has been reported to be low. The objectives of this study were to estimate the heritability of cow temperament at parturition, conduct a genome-wide association analysis of cow temperament at the time of parturition, and estimate the correspondence of cow temperament at the time of parturition with cow productive performance and early-life temperament traits in Bos indicus crossbreds. Cow temperament was assessed from 1 to 5 indicating increasing levels of aggressiveness of cows (937 cows and 4,337 parturitions) from 2005 to 2022. Estimates of heritability and repeatability were 0.12 ±â€…0.024 and 0.24 ±â€…0.018. The estimates of proportion of phenotypic variance were 0.13 ±â€…0.019 and 0.02 ±â€…0.011 for permanent and maternal permanent environmental components, respectively. Estimates of heritability for maximum lifetime temperament score and proportions of temperament scores >1 were 0.18 ±â€…0.07 and 0.13 ±â€…0.072. Within cycles (generations), 2-yr-old cows had lower temperament score means than cows in most other age categories. There were low to moderate positive estimates of unadjusted correlation coefficients (r = 0.22 to 0.29; P < 0.05) of unadjusted temperament score with temperament measured on the same females when they were 8 mo old. There were low to moderate positive estimates of correlation coefficients (r = 0.09 to 0.37; P < 0.05) of unadjusted temperament score with calving rate, weaning rate, weaning weight per cow exposed, and weaning weight per 454 kg cow weight at weaning. Cows with the lowest temperament score had lower (P < 0.05) calving and weaning rate than cows in other temperament categories. Within 3 of 5 cycles, cows with the lowest temperament score (totally docile) had lower (P < 0.05) weaning weight per cow exposed than cows in other temperament categories. There were 2 SNP on BTA 4 associated with maximum lifetime temperament score (FDR < 0.05). The non-genetic influence of a cow's mother was documented in her own temperament measured at the time of calving; this may be a consequence of learned behavior. Less aggressiveness displayed by cows at the time of calving may be accompanied by lower reproductive and maternal performance.

Cow temperament was evaluated in 1/2 Nellore 1/2 Angus cows from four distinct generations (five herds) from 2005 to 2022. Cows were scored when their calves were processed (1 d age) as 1 = totally docile, 2 = protective, but not aggressive, 3 = moderately aggressive when calf is disturbed, 4 = very aggressive when calf is disturbed, and 5 = very aggressive even when calf is not disturbed. Similar to results in Bos taurus cows, the heritability of this trait was low. The repeatability was more moderate, indicating that additional records from a cow would be beneficial for selection purposes. Young cows had lower scores, indicating more docile behavior. This may be because a strong maternal protective instinct develops and strengthens over time. Temperament measured when cows were 8 mo old was moderately associated with their temperament as mature cows at the time of parturition. Cows with low temperament scores (more docile) had, in several cases, lower reproductive performance and production. Experiential accumulation appears to be important for cow temperament near the time of calving, including the cow's experience as a calf from her dam.

Regional changes of maximum dose insecticide responses in diamondback moth (Lepidoptera: Plutellidae) populations from Georgia and Florida, USA.

Maximum dose bioassays were conducted to assess the efficacy of multiple registered active ingredients for diamondback moth (DBM), Plutella xylostella (L.), control in Georgia and Florida from 2021 to 2023 as a follow-up to an earlier study. Low efficacy (<40% mortality) was recorded for the highest labeled rate of Bacillus thuringiensis var. kurstaki strain ATBS-351 in Georgia, as well as chlorantraniliprole, cyantraniliprole, and cyclaniliprole in Georgia and Florida. The active ingredients with the highest efficacy (>80% mortality) in both states were naled, emamectin benzoate, and spinetoram. Independent analysis of data by state indicated that the efficacy of bifenthrin, chlorantraniliprole, cyantraniliprole, tolfenpyrad, and methomyl was higher in Florida populations than in Georgia populations. In addition, a comparison of these data to a recent DBM maximum dose survey in the same region suggested that these DBM populations have rapidly developed high levels of resistance to cyantraniliprole and cyclaniliprole. This work provides growers in the region with a recent ranking of insecticide efficacy that documents the loss of control for certain active ingredients, which assists pest managers in the planning of ongoing insecticide rotations for DBM resistance management.

Second generation peanut genotypes resistant to thrips-transmitted tomato spotted wilt virus exhibit tolerance rather than true resistance and differentially affect thrips fitness.

Spotted wilt disease caused by Tomato spotted wilt virus (TSWV) (family Bunyaviridae; genus Tospovirus) is a major constraint to peanut (Arachis hypogaea L.) production in the southeastern United States. Reducing yield losses to TSWV has heavily relied on planting genotypes that reduce the incidence of spotted wilt disease. However, mechanisms conferring resistance to TSWV have not been identified in these genotypes. Furthermore, no information is available on how these genotypes influence thrips fitness. In this study, we investigated the effects of newly released peanut genotypes (Georganic, GA-06G, Tifguard, and NC94022) with field resistance to TSWV and a susceptible genotype (Georgia Green) on tobacco thrips, Frankliniella fusca (Hinds), fitness, and TSWV incidence. Thrips-mediated transmission resulted in TSWV infection in both TSWV-resistant and susceptible genotypes and they exhibited typical TSWV symptoms. However, some resistant genotypes had reduced viral loads (fewer TSWV N-gene copies) than the susceptible genotype. F. fusca larvae acquired TSWV from resistant and susceptible genotypes indicating that resistant genotypes also can serve as inoculum sources. Unlike resistant genotypes in other crops that produce local lesions (hypersensitive reaction) upon TSWV infection, widespread symptom development was noticed in peanut genotypes. Results indicated that the observed field resistance in peanut genotypes could be because of tolerance. Further, fitness studies revealed some, but not substantial, differences in thrips adult emergence rates and developmental time between resistant and susceptible genotypes. Thrips head capsule length and width were not different when reared on different genotypes.

Telomere Dynamics in Livestock.

Telomeres are repeated sequences of nucleotides at the end of chromosomes. They deteriorate across mitotic divisions of a cell. In Homo sapiens this process of lifetime reduction has been shown to correspond with aspects of organismal aging and exposure to stress or other insults. The early impetus to characterize telomere dynamics in livestock related to the concern that aged donor DNA would result in earlier cell senescence and overall aging in cloned animals. Telomere length investigations in dairy cows included breed effects, estimates of additive genetic control (heritability 0.12 to 0.46), and effects of external stressors on telomere degradation across animal life. Evaluation of telomeres with respect to aging has also been conducted in pigs and horses, and there are fewer reports of telomere biology in beef cattle, sheep, and goats. There were minimal associations of telomere length with animal productivity measures. Most, but not all, work in livestock has documented an inverse relationship between peripheral blood cell telomere length and age; that is, a longer telomere length was associated with younger age. Because livestock longevity affects productivity and profitability, the role of tissue-specific telomere attrition in aging may present alternative improvement strategies for genetic improvement while also providing translational biomedical knowledge.

Precision and Accuracy of Field Versus Laboratory Bioassay Insecticide Efficacy for the Control of Immature Bemisia tabaci.

Ecotoxicological studies often result in reports on the limitation and sometime failures of biological assay data to predict field response to similar treatments. Nevertheless, it is widely accepted that controlled bioassays can better quantify the specific mortality response of a target pest species to a specific toxin. To quantify the relationship between whitefly bioassay and field response data, we evaluated a controlled laboratory bioassay and a concurrent cucurbit field trial method to assess insecticide efficacy for controlling the sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). This was based on oviposition and nymphal development. We specifically tested the assumptions that a maximum dose bioassay would more precisely measure insecticide efficacy as compared with a comparable field spray test evaluation, and the response would be equal between the bioassay and the field as a measure of control accuracy for both adult oviposition and development of nymphal stages. To make a direct comparison, we tested the same whitefly population subsamples from 352 plots in eight cucurbit field experiments in Georgia, USA, in 2021 and 2022. The bioassays provide significantly precision for estimating proportional whitefly response. As expected, treatment-specific nonequivalence in immature whitefly counts between the bioassay and field, i.e., a lack of accuracy, only occurred with insecticides that were not highly toxic to all growth stages of whiteflies.

Determining Field Insecticide Efficacy on Whiteflies with Maximum Dose Bioassays.

We conducted a rapid bioassay method to assess insecticide efficacy for controlling adult sweetpotato whitefly Bemisia tabaci in squash and cucumber crops before insecticide applications. The study aimed to evaluate the accuracy of a 24-hour laboratory bioassay in determining maximum dose insecticide efficacy in the field. Ten insecticides were evaluated using leaf-dip bioassays, and their effectiveness was tested across eight cucurbit field experiments in Georgia, USA, during the 2021 and 2022 field seasons. The maximum dose, defined as the highest labeled rate of an insecticide diluted in the equivalent of 935 L ha-1 of water, was used for all bioassays. Adult survival observed in the bioassay was compared to adult field count-based survival 24 h after treatment. A low concentration (1/10 rate) was used for imidacloprid, flupyradifurone, pyriproxyfen, and cyantraniliprole to assess insecticide tolerance in the whitefly population. Overall, significant positive correlation between laboratory bioassay and field efficacy was reported, explaining 50-91% of the observed variation. The addition of the low dosage was helpful, indicating that no rate response was consistent with susceptibility to the tested insecticide, while a rate response was associated with a loss of susceptibility between 2021 and 2022.

Comparison of Telomere Length in Age-Matched Primiparous and Multiparous Brahman Cows.

Physiological and psychological stressors have been associated with the attrition of telomeres, which are the protective caps of chromosomes. This study compares the telomere length (TL) in 4-year-old Brahman cows grouped by the first parity (n = 8) and the second parity (n = 11). The cows were bled via jugular venipuncture, weighed, and had their body condition scores recorded at Day -28 prior to calving and at Day + 7 and Day + 28 post-calving. The duration of labor (Dlabor) and parturition ease were recorded. The peripheral leukocytes were isolated, the leukocyte blood count with differential was recorded, and the genomic DNA was extracted. The relative quantity of telomere products, which is proportional to the average TL, was determined via multiplex quantitative PCR using the ratio (T/S ratio) of bovine telomere and ß-globulin DNA. Standards of the bovine telomere (1012-107 dilution series) and ß-globulin (109-104 dilution series) genes were utilized to produce relative copy numbers. The samples were assayed in triplicate and were included if the triplicate Cq difference was less than 0.25 cycles. The parity was the fixed effect, and the random effects included the sire and day repeated with the cow as the subject. Statistical significance was not observed in the leukocyte number or type (p > 0.1). A reduction in the TL of approximately 9225 telomeric copies was found between Parity 1 and Parity 2 (p = 0.02). A trend was found between the TL and Dlabor (p = 0.06). The stress of parturition and raising the first calf of a cow's life may be responsible for TL attenuation. Parity may be considered a stressor of cow longevity.

Differential Expression of Circadian Clock Genes in the Bovine Neuroendocrine Adrenal System.

Knowledge of circadian rhythm clock gene expression outside the suprachiasmatic nucleus is increasing. The purpose of this study was to determine whether expression of circadian clock genes differed within or among the bovine stress axis tissues (e.g., amygdala, hypothalamus, pituitary, adrenal cortex, and adrenal medulla). Tissues were obtained at an abattoir from eight mature nonpregnant Brahman cows that had been maintained in the same pasture and nutritional conditions. Sample tissues were stored in RNase-free sterile cryovials at -80 °C until the total RNA was extracted, quantified, assessed, and sequenced (NovaSeq 6000 system; paired-end 150 bp cycles). The trimmed reads were then mapped to a Bos taurus (B. taurus) reference genome (Umd3.1). Further analysis used the edgeR package. Raw gene count tables were read into RStudio, and low-expression genes were filtered out using the criteria of three minimum reads per gene in at least five samples. Normalization factors were then calculated using the trimmed mean of M values method to produce normalized gene counts within each sample tissue. The normalized gene counts important for a circadian rhythm were analyzed within and between each tissue of the stress axis using the GLM and CORR procedures of the Statistical Analysis System (SAS). The relative expression profiles of circadian clock genes differed (p < 0.01) within each tissue, with neuronal PAS domain protein 2 (NPAS2) having greater expression in the amygdala (p < 0.01) and period circadian regulator (PER1) having greater expression in all other tissues (p < 0.01). The expression among tissues also differed (p < 0.01) for individual circadian clock genes, with circadian locomotor output cycles protein kaput (CLOCK) expression being greater within the adrenal tissues and nuclear receptor subfamily 1 group D member 1 (NR1D1) expression being greater within the other tissues (p < 0.01). Overall, the results indicate that within each tissue, the various circadian clock genes were differentially expressed, in addition to being differentially expressed among the stress tissues of mature Brahman cows. Future use of these findings may assist in improving livestock husbandry and welfare by understanding interactions of the environment, stress responsiveness, and peripheral circadian rhythms.

Inter-Individual Variation in DNA Methylation Patterns across Two Tissues and Leukocytes in Mature Brahman Cattle.

Quantifying the natural inter-individual variation in DNA methylation patterns is important for identifying its contribution to phenotypic variation, but also for understanding how the environment affects variability, and for incorporation into statistical analyses. The inter-individual variation in DNA methylation patterns in female cattle and the effect that a prenatal stressor has on such variability have yet to be quantified. Thus, the objective of this study was to utilize methylation data from mature Brahman females to quantify the inter-individual variation in DNA methylation. Pregnant Brahman cows were transported for 2 h durations at days 60 ± 5; 80 ± 5; 100 ± 5; 120 ± 5; and 140 ± 5 of gestation. A non-transport group was maintained as a control. Leukocytes, amygdala, and anterior pituitary glands were harvested from eight cows born from the non-transport group (Control) and six from the transport group (PNS) at 5 years of age. The DNA harvested from the anterior pituitary contained the greatest variability in DNA methylation of cytosine-phosphate-guanine (mCpG) sites from both the PNS and Control groups, and the amygdala had the least. Numerous variable mCpG sites were associated with retrotransposable elements and highly repetitive regions of the genome. Some of the genomic features that had high variation in DNA methylation are involved in immune responses, signaling, responses to stimuli, and metabolic processes. The small overlap of highly variable CpG sites and features between tissues and leukocytes supports the role of variable DNA methylation in regulating tissue-specific gene expression. Many of the CpG sites that exhibited high variability in DNA methylation were common between the PNS and Control groups within a tissue, but there was little overlap in genomic features with high variability. The interaction between the prenatal environment and the genome could be responsible for the differences in location of the variable DNA methylation.