RESUMO
Presented research aimed at investigating the effect of short-term contact with petroleum-derived substances (PDSs) on life parameters of Porcellio scaber Latr. (Isopoda) and accumulation of polycyclic aromatic hydrocarbons (PAHs) in its body. The influence of presence of P. scaber on the total petroleum hydrocarbons (TPH) content in soil was also determined. The following objects were established: control-unpolluted soil; soil polluted with petrol; soil polluted with diesel fuel and soil polluted with used engine oil. Every pollutant was used in the amounts equal to 6000 mg of fuel/kg d.m. of soil 15 months earlier. In the laboratory, survival and body mass change of P. scaber reared in investigated soils were observed. The delivered food was not contaminated with PDSs. P. scaber reveals a considerable resistance in a short (4 weeks) contact with PDSs, evidenced as high survivability (from 68% on the soil polluted with engine oil to 77% on the soil polluted with diesel fuel) and undisturbed increase in body mass (on the level similar to control). It indicates the potential usefulness of this animal as a monitoring organism. No positive correlation was observed between TPH depletion in the soils contaminated with PDSs and P. scaber presence during 4 weeks of the experiment. PAH level in P. scaber bodies was generally very low (with the highest level of anthracene 0.40 µg/g of wet mass-after 4 weeks of rearing on the diesel fuel-contaminated soil), which may confirm the thesis about considerable abilities of isopods for biotransformation of these pollutants and low susceptibility to these xenobiotic penetration through integuments. However, a tendency for accumulation for phenanthrene and anthracene in conditions of soil polluted with diesel fuel was observed respectively 0.07 and 0.21 µg/g of wet mass for phenanthrene and 0.22 and 0.40 µg/g of wet mass for anthracene, observed successively in the 2nd and 4th week of rearing.
Assuntos
Isópodes/fisiologia , Petróleo/análise , Hidrocarbonetos Policíclicos Aromáticos/análise , Poluentes do Solo/análise , Solo/química , Adaptação Fisiológica , Animais , Antracenos/análise , Monitoramento Ambiental , Poluição Ambiental , Gasolina/análise , Hidrocarbonetos/análise , Fenantrenos/análiseRESUMO
BACKGROUND: PPM1D (WIP1) negatively regulates by dephosphorylation many proteins including p53 tumour suppressor. The truncating mutations (nonsense and frameshift) in exon 6 of PPM1D were found recently in blood cells of patients with breast, ovarian or colorectal cancer. These mutants code for gain-of-function PPM1D with retained phosphatase activity. Their significance in carcinogenesis is unknown. METHODS: The exon 6 of PPM1D was sequenced in blood DNA of 543 non-small-cell lung cancer patients (NSCLC). The functional significance of selected PPM1D alterations (Arg458X, Lys469Glu) was compared with the wild-type gene and examined by recombinant DNA techniques, immunoblotting and luciferase reporter assays. RESULTS: The frameshift mutations were found in five NSCLC patients (5/543; 0.92%), all of them had squamous cell carcinomas (5/328; 1.5%). All patients with the mutations were exposed, before the blood collection, to the DNA damaging agents as a part of chemotherapeutic regimen. Functional tests demonstrated that truncating mutation Arg458X causes enhancement of dephosphorylation activity of PPM1D toward serine 15 of p53, whereas Lys469Glu version is equivalent to the wild-type. Neither version of PPM1D (wild-type, Arg458X, Lys469Glu) significantly modulated the ability of p53 to transactivate promoters of the examined p53-target genes (BAX and MDM2). CONCLUSIONS: The truncating mutations of PPM1D are present in blood DNA of NSCLC patients at frequency similar to percentage determined for ovarian cancer patients. Our findings raise a question if the detected lesions are a result of chemotherapy.
Assuntos
Códon sem Sentido , DNA de Neoplasias/genética , Mutação da Fase de Leitura , Neoplasias Pulmonares/sangue , Neoplasias Pulmonares/genética , Fosfoproteínas Fosfatases/sangue , Fosfoproteínas Fosfatases/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , Carcinoma Pulmonar de Células não Pequenas/sangue , Carcinoma Pulmonar de Células não Pequenas/genética , Dano ao DNA , DNA de Neoplasias/sangue , Éxons , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Regiões Promotoras Genéticas , Proteína Fosfatase 2C , Serina/genética , Proteína Supressora de Tumor p53/genética , Adulto JovemRESUMO
There was performed an analysis of the working conditions and health status of workers of the chemical enterprise. In male electrical staff exposed to electromagnetic fields (EMF) of 50 Hz and chemicals, according to data of periodic medical examinations there was revealed statistically higher incidence of cardiovascular diseases and autonomic disorders. The obtained preliminary results allow to suggest the upsurge of the involvement of the autonomic nervous system in response to the combined effects of EMF of 50 Hz and chemicals.
Assuntos
Campos Eletromagnéticos/efeitos adversos , Substâncias Perigosas/efeitos adversos , Nível de Saúde , Doenças Profissionais/epidemiologia , Exposição Ocupacional/efeitos adversos , Humanos , Incidência , Masculino , Pessoa de Meia-Idade , Doenças Profissionais/etiologia , Tartaristão/epidemiologiaRESUMO
Features of working conditions and a state of health of operation personnel of the network companies of power industry were studied for the purpose of justification and introduction of preventive actions for the decrease in influence of factors of professional risk.
Assuntos
Doenças Profissionais/prevenção & controle , Exposição Ocupacional/prevenção & controle , Saúde Ocupacional , Centrais Elétricas , Humanos , Doenças Profissionais/etiologia , RiscoRESUMO
Having assessed functional state during the work, the authors revealed factors proving stress state in operative staffers of electric power stations. Features of occupational activities and workplace organization were assessed, risk factors promoting stress states were revealed, recommendations on optimizing the working process and on health preservation were specified.
Assuntos
Hemodinâmica/fisiologia , Doenças Profissionais , Saúde Ocupacional/normas , Centrais Elétricas , Estresse Psicológico , Indicadores Básicos de Saúde , Coração/fisiopatologia , Testes de Função Cardíaca , Humanos , Doenças Profissionais/etiologia , Doenças Profissionais/fisiopatologia , Doenças Profissionais/psicologia , Saúde Ocupacional/estatística & dados numéricos , Fatores de Risco , Federação Russa , Estresse Psicológico/etiologia , Estresse Psicológico/fisiopatologia , Estresse Psicológico/psicologia , Carga de TrabalhoRESUMO
BACKGROUND: Carriers of the FMR1 premutation allele are at a significantly increased risk for a late-onset neurodegenerative disorder, fragile X-associated tremor/ataxia syndrome (FXTAS). This disorder is distinct from fragile X syndrome (FXS) in its molecular aetiology and clinical presentation. The primary features of FXTAS are late-onset intention tremor and gait ataxia. Associated features include parkinsonism, neuropsychological dysfunction, autonomic dysfunction and peripheral neuropathy. AIM: To investigate the usefulness of a quantitative neurological test battery implemented through the CATSYS instrument to identify preclinical symptoms of FXTAS. METHODS: Both premutation carriers with 70-199 repeats (62 men) and their low-repeat allele carrier siblings (27 men), identified through families with an individual affected with FXS, were tested. RESULTS: As expected, because of its sensitivity, use of the instrument allowed identification of tremor in 23% of men who had not self-reported tremor, and ataxia in 30% of men who had not self-reported ataxia. Among subjects with self-reported tremor and ataxia, we found significant concordance between measures of the CATSYS system and the self-report. CONCLUSION: Rates of these traits among premutation carriers and low-repeat allele carrier siblings could be identified, and are presented in this paper, along with the minimum estimates of age-related prevalence.
Assuntos
Ataxia/diagnóstico , Diagnóstico por Computador , Transtornos Heredodegenerativos do Sistema Nervoso/diagnóstico , Destreza Motora , Tremor/diagnóstico , Ataxia/etiologia , Síndrome do Cromossomo X Frágil/diagnóstico , Testes Genéticos , Transtornos Heredodegenerativos do Sistema Nervoso/etiologia , Humanos , Masculino , Exame Neurológico , Prevalência , Tremor/etiologiaRESUMO
Recent molecular epidemiological studies have identified polymorphisms in the XPD gene that are associated with increased risk of brain gliomas and head, neck, lung, and skin cancers. However, the functional significance of these polymorphic variants in altering cell processes such as cell cycle checkpoints, DNA repair, and apoptosis is uncertain. We have cloned the XPD variants Lys751Gln, Asp312Asn, and Lys751Gln-Asp312Asn into a pcDNA-3.1-expression vector. Using these constructs, we did not find any detectable difference in either in vitro binding with wild-type p53 or in DNA repair proficiency as measured by host cell reactivation assay. We then genotyped 34 different lymphoblastoid cell lines from six Centre d'Etude du Polymorphisme Humaine (CEPH)/Utah pedigree families and a CEPH/French pedigree family for polymorphisms at codons 751 and 312 and assessed their apoptotic response after either UV or ionized radiation exposure. The lymphoblastoid cell lines with homozygous or heterozygous Asp at codon 312 have similar apoptotic rates, whereas cell lines with homozygous Asn at codon 312 showed a 2.5-fold increased response to UV (P = 0.005; Student's t test). This is the first report known to us of a functional polymorphism in a gene involved in DNA damage-induced apoptosis. However, the presence of Lys or Gln at codon 751 did not influence the apoptotic response to UV. The diminished apoptotic response of cells containing the 312 Asp allele could both allow the survival and selective clonal expansion of carcinogen-damaged cells and be a mechanistic explanation for the increased risk of cancer at diverse tissue sites.
Assuntos
Apoptose/genética , DNA Helicases , Proteínas de Ligação a DNA , Polimorfismo Genético , Proteínas/genética , Fatores de Transcrição , Substituição de Aminoácidos/fisiologia , Apoptose/efeitos da radiação , Ataxia Telangiectasia/genética , Ataxia Telangiectasia/patologia , Linhagem Celular , Códon/genética , Reparo do DNA , Humanos , Linfócitos/patologia , Linfócitos/fisiologia , Ligação Proteica , Proteínas/metabolismo , Proteínas/fisiologia , Proteína Supressora de Tumor p53/metabolismo , Proteína Grupo D do Xeroderma PigmentosoRESUMO
We examined the genomic status of cyclin-dependent kinase-4 and -6 inhibitors, p16INK4,p15INK4B, and p18, in 40 primary lung cancers and 31 metastatic lung cancers. Alterations of the p16INK4 gene were detected in 6 (2 insertions and 4 homozygous deletions) of 22 metastatic non-small cell lung cancers (NSCLCs; 27%), but none were detected in 25 primary NSCLCs, 15 primary small cell lung cancers (SCLCs), or 9 metastatic SCLCs, indicating that mutation in the p16INK4 gene is a late event in NSCLC carcinogenesis. Although three intragenic mutations of the p15INK4B gene were detected in 25 primary NSCLCs (12%) and five homozygous deletions of the p15INK4B gene were detected in 22 NSCLCs (23%), no genetic alterations of the p15INK4B gene were found in primary and metastatic SCLCs. The p18 gene was wild type in these 71 lung cancers, except 1 metastatic NSCLC which showed loss of heterozygosity. We also examined alterations of these three genes and expression of p16INK4 in 21 human lung cancer cell lines. Alterations of the p16INK4 and p15INK4B genes were detected in 71% of the NSCLC cell lines (n = 14) and 50% of the NSCLC cell lines (n = 14), respectively, but there were none in the 7 SCLC cell lines studied. No p18 mutations were detected in these 21 cell lines. These results indicate that both p16INK4 and p15INK4B gene mutations are associated with tumor progression of a subset of NSCLC, but not of SCLC, and that p15INK4B mutations might also be an early event in the molecular pathogenesis of a subset of NSCLC.
Assuntos
Carcinoma Pulmonar de Células não Pequenas/genética , Carcinoma de Células Pequenas/genética , Deleção de Genes , Neoplasias Pulmonares/genética , Sequência de Bases , Carcinoma Pulmonar de Células não Pequenas/secundário , Carcinoma de Células Pequenas/secundário , DNA de Neoplasias/análise , DNA de Neoplasias/genética , Humanos , Dados de Sequência Molecular , Reação em Cadeia da Polimerase , Polimorfismo Genético , Análise de Sequência de DNA , Células Tumorais CultivadasRESUMO
The fragile histidine triad (FHIT) gene at chromosome 3p14.2 is a candidate tumor suppressor gene linked to cancers of the lung, breast, colon, pancreas, and head and neck. Reports of frequent allelic deletion and abnormal transcripts in primary lung tumors plus recent evidence that it is targeted by tobacco smoke carcinogens suggest that it plays an important role in lung carcinogenesis. Non-small cell lung carcinoma still maintains a poor 5-year survival rate with the stage of disease at presentation as a major determinant of prognosis. We examined for allelic deletion at the FHIT locus in a series of 106 non-small cell lung carcinomas for which a full clinical, epidemiological, and 5-year survival profile was available. We found an allelic deletion frequency of 38% at one or two intragenic microsatellites. Allelic deletion of FHIT was related to tumor histology with 4 of 20 adenocarcinomas (20%) displaying loss of heterozygosity (LOH) compared with 12 of 22 (55%) nonadenocarcinomas (P = 0.03). We found that 63% of tumors with LOH of FHIT also had p53 missense mutations whereas only 26% with LOH had wild type p53 negative sequence (P = 0.02). We also found a significant trend toward poorer survival in patients with LOH of at least one locus of the FHIT gene (log rank, P = 0.01). This survival correlation is independent of tumor stage, size, histological subtype, degree of differentiation, and p53 mutation status. Our data support the hypothesis that the loss of the FHIT contributes to the molecular pathogenesis of human lung cancer and is an indicator of poor prognosis.
Assuntos
Hidrolases Anidrido Ácido , Carcinoma Pulmonar de Células não Pequenas/genética , Genes Supressores de Tumor/genética , Neoplasias Pulmonares/genética , Proteínas de Neoplasias/genética , Proteínas/genética , Adulto , Idoso , Alelos , Carcinoma Pulmonar de Células não Pequenas/mortalidade , Cromossomos Humanos Par 3/genética , Feminino , Deleção de Genes , Marcadores Genéticos/genética , Humanos , Neoplasias Pulmonares/mortalidade , Masculino , Repetições de Microssatélites/genética , Pessoa de Meia-Idade , Prognóstico , Taxa de SobrevidaRESUMO
A deficiency in DNA repair is associated with increased cancer risk. Inter-individual variations in DNA repair capacity observed in humans may result from genetic polymorphisms in DNA repair genes. In order to provide a basis for future functional and molecular epidemiology studies on cancer susceptibility, we screened 35 individuals for polymorphisms in coding regions of XPA and XPB genes involved in nucleotide excision repair (NER). Relevant cDNA sequences were amplified by PCR, sequenced with fluorescently labeled terminators and analyzed with automated sequencer. Two polymorphisms in XPB were found: AAA-->AGA (445A>G; GenBank M31899) causing K117R substitution and GGC-->TGC (1299G>T; GenBank M31899) causing G402C exchange. Also, two polymorphisms in XPB were detected: CGA-->CAA (709G>A; GenBank D14533) causing R228Q exchange, and A-->G (23A>G; GenBank D14533) substitution in the 5' non-coding region of the gene. The three aforementioned amino acid substitutions were uncommon in this population (1.4%). In contrast, the substitution located 4 nucleotides upstream of the ATG start codon of XPB was frequent (57%). To our best knowledge this is the first report of these sequence variants. The location of these polymorphisms in evolutionary conserved regions suggest that they may be of functional significance.
Assuntos
Reparo do DNA/genética , Proteínas de Ligação a DNA/genética , Polimorfismo de Nucleotídeo Único/genética , Proteínas de Ligação a RNA/genética , Animais , Galinhas , DNA Helicases , Drosophila melanogaster , Testes Genéticos , Humanos , Camundongos , Polônia , Saccharomyces cerevisiae , Xenopus , Proteína de Xeroderma Pigmentoso Grupo ARESUMO
Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.
Assuntos
Carcinoma Pulmonar de Células não Pequenas/enzimologia , DNA Glicosilases , Neoplasias Pulmonares/enzimologia , N-Glicosil Hidrolases/genética , O(6)-Metilguanina-DNA Metiltransferase/genética , Carcinoma Pulmonar de Células não Pequenas/genética , Elementos Facilitadores Genéticos/genética , Humanos , Neoplasias Pulmonares/genética , Polônia , Polimorfismo GenéticoRESUMO
Germ-line mutations in BRCA1 and BRCA2 genes result in a significantly increased risk of breast and ovarian cancer. Other genes involved in an increased predisposition to breast cancer include the TP53 gene, mutated in Li-Fraumeni syndrome. To estimate the frequency of germ-line mutations in these three genes in Upper Silesia, we have analyzed 47 breast/ovarian cancer families from that region. We found five different disease predisposing mutations in 17 (36%) families. Twelve families (25.5%) carried known BRCA1 mutations (5382insC and C61G), four families (8.5%) carried novel BRCA2 mutations (9631delC and 6886delGAAAA), and one family (2%) harbored novel mutation 1095del8 in the TP53 gene, which is the largest germline deletion in coding sequence of this gene identified thus far. The 5382insC mutation in BRCA1 was found in 11 families and the 9631delC mutation in BRCA2 occurred in three families. These two mutations taken together contribute to 82% of all mutations found in this study, and 30% of the families investigated harbor one of these mutations. The very high frequency of common mutations observed in these families can only be compared to that reported for Ashkenazi Jewish, Icelandic, and Russian high-risk families. This frequency, however, may not be representative for the entire Polish population. The observed distribution of mutations will favor routine pre-screening of predisposed families using a simple and cost-effective test.
Assuntos
Neoplasias da Mama/epidemiologia , Neoplasias da Mama/genética , Genes BRCA1/genética , Mutação/genética , Proteínas de Neoplasias/genética , Neoplasias Ovarianas/epidemiologia , Neoplasias Ovarianas/genética , Fatores de Transcrição/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , Proteína BRCA2 , Feminino , Marcadores Genéticos/genética , Humanos , Pessoa de Meia-Idade , Linhagem , Polônia/epidemiologiaRESUMO
The blood-retinal barrier (BRB) might be governed by the same permeability principles as the blood-brain barrier (BBB). For a weak acid like fluorescein, BRB permeability would be proportional to its pH-dependent lipid solubility, according to the pH partition hypothesis. A range of metabolic acidosis was produced in 20 rats by the oral administration of NH4Cl; six additional rats received normal saline. Four hours later, vitreous fluorophotometry, venous fluorescein values, and arterial pH were measured. Significant linear relationships were found between vitreous fluorophotometry readings and blood hydrogen ion concentrations (p less than 0.025) and plasma fluorescein concentrations (p less than 0.05). According to the linear relationship, changing the pH from 7.4 to 7.3 or 6.9 would result in an increase in vitreous fluorophotometry reading of 8.5 or 72%, respectively. Since the pH partition hypothesis predicts values of 52 or 640% our results suggest that the BRB conforms less to the hypothesis than does the BBB. Furthermore, although pH changes of a magnitude able to influence vitreous fluorophotometry readings substantially may occur under experimental conditions in animals, they are unlikely to occur in ambulatory human patients.
Assuntos
Fenômenos Fisiológicos Sanguíneos , Fluoresceínas/fisiologia , Concentração de Íons de Hidrogênio , Vasos Retinianos/fisiologia , Animais , Fluoresceína , Masculino , Ratos , Ratos EndogâmicosRESUMO
Carboxyfluorescein resembles fluorescein in size and spectral characteristics but is much less lipid soluble. Both dyes were used to differentiate between two groups of factors that influence penetration across the blood-retinal barrier: (1) factors that depend on lipid solubility, such as the area of the barrier, and (2) factors independent of lipid solubility, such as opened intercellular junctions or necrotic cells. Vitreous fluorophotometry was performed on normal and diabetic rats after injection of either dye. After the results were adjusted for sources of error, midvitreous-plasma dye ratios for carboxyfluorescein and fluorescein were of the same order of magnitude in normal rats. Ratios for both dyes increased in diabetic rats, and the increases were similar in magnitude. Our results suggest that lipid solubility contributes little to inward transport of these dyes in both the normal and diabetic states.
Assuntos
Fenômenos Fisiológicos Sanguíneos , Diabetes Mellitus Experimental/fisiopatologia , Fluoresceínas , Fluorometria/métodos , Retina/fisiologia , Corpo Vítreo/análise , Animais , Transporte Biológico , Fluoresceína , Fluoresceínas/análise , Fluoresceínas/metabolismo , Metabolismo dos Lipídeos , Masculino , Permeabilidade , Ratos , Retina/fisiopatologia , Solubilidade , Corpo Vítreo/metabolismoRESUMO
Since serum fluorescein levels are altered in various experimental states, we examined the relationship between serum and vitreous fluorescein levels. We also injected streptozocin, alloxan, and alloxan with glucose pretreatment do determine whether alterations in the blood-retinal barrier are directly attributable to drug toxicity. When corrected for serum levels, one- and two-hour vitreous fluorescein levels increased above prediabetic values two days after streptozocin or alloxan administration; two-hour readings were higher. Rats treated with alloxan plus glucose did not become diabetic or show elevated vitreous fluorescein levels. Insulin treatment of alloxan-induced diabetic rats resulted in normal vitreous readings without normoglycemia. These results suggest that vitreous readings should be corrected for serum levels and that observations at two hours could be more sensitive than at one hour. Furthermore, the observed alterations in blood-retinal barrier function are not attributed to drug toxicity.
Assuntos
Aloxano/farmacologia , Angiofluoresceinografia , Vasos Retinianos/efeitos dos fármacos , Estreptozocina/farmacologia , Animais , Glicemia/análise , Fluoresceínas/efeitos adversos , Fluoresceínas/análise , Fluoresceínas/sangue , Insulina/sangue , Masculino , Ratos , Corpo Vítreo/análiseRESUMO
Diabetic macular edema is a major cause of vision loss and is evaluated with qualitative or semiquantitative techniques. A new quantitative method for assessment of macular edema using retinal thickness analysis was applied to 19 patients with diabetic macular edema. Foveal thickening was frequently coupled with poor visual acuity. Slit-lamp biomicroscopy and stereophotography detected 80% and 78% of local areas of thickening, respectively, but failed to detect locations with average thicknesses of 1.5 and 1.6 times normal, respectively. Fluorescein leakage on angiography was generally associated with retinal thickening, but locations with similar degrees of leakage had widely varying retinal thickening. Fluorescein leakage in the posterior vitreous correlated poorly with the degree of foveal thickening. These results indicate that quantitative measurement of retinal thickness may become useful in the management of diabetic patients with macular edema.
Assuntos
Retinopatia Diabética/patologia , Edema Macular/patologia , Retina/patologia , Idoso , Retinopatia Diabética/fisiopatologia , Angiofluoresceinografia , Fluorometria , Fundo de Olho , Humanos , Edema Macular/fisiopatologia , Pessoa de Meia-Idade , Fotografação , Fotometria , Acuidade VisualRESUMO
We tested whether vitreoperfusion, a new method of perfusing the vitreous cavity with solutions containing nutrients, can limit retinal injury if initiated after the onset of ischemia. Severe bilateral ocular ischemia was induced in cats with healed lensectomy-vitrectomy wounds; 30, 60, 90, or 120 minutes later, one eye from each of 18 cats underwent vitreoperfusion while the ischemia continued for 120 minutes. The other eye simultaneously underwent either continued untreated ischemia or reinstated circulation. The histopathologic abnormalities evident after 8 days depended on the duration of ischemia. Reinstated circulation yielded less retinal damage than continued ischemia. Nine additional cats underwent bilateral ischemia for at least 210 minutes. Vitreoperfusion was initiated in one eye after 30 minutes. In each cat, the vitreoperfused eye fared significantly better as observed histopathologically and electroretinographically. We believe that no other treatment has similarly limited retinal injury in vivo when initiated so long after total ocular ischemia has developed.
Assuntos
Isquemia/complicações , Perfusão , Doenças Retinianas/prevenção & controle , Vasos Retinianos , Corpo Vítreo , Análise de Variância , Animais , Gatos , Eletrorretinografia , Doenças Retinianas/etiologia , Doenças Retinianas/fisiopatologia , VitrectomiaRESUMO
The permeability of the blood-vitreous barrier to fluorescein passing out of the vitreous does not necessarily equal the permeability to fluorescein passing into it. We calculated the ratio between the outward and inward permeability coefficients of the blood-vitreous barrier in eight normal men who ingested 3-g of sodium fluorescein. The calculation was based on the ratio between the serum free fluorescein and the vitreous fluorescein concentrations (as determined by fluorophotometry) when the net transport across the barrier was zero. The outward permeability to fluorescein was 31 +/- 18 times (mean +/- SD) the inward permeability. To our knowledge, this article provides the first direct evidence for a specialized transport mechanism in humans whereby fluorescein is removed from the vitreous into the blood. The malfunction of this process may be important in human diseases. Pharmacologic manipulation of this process may be possible.
Assuntos
Permeabilidade Capilar , Fluoresceínas/metabolismo , Corpo Vítreo/metabolismo , Adulto , Transporte Biológico , Fluoresceína , Humanos , Masculino , Permeabilidade , Fotometria/métodos , UltrafiltraçãoRESUMO
The status of the blood-retinal barrier (BRB) in carriers of choroideremia and X-linked retinitis pigmentosa (XLRP) was determined by vitreous fluorophotometry (VF) and compared with that in female control subjects. Electroretinographic (ERG) amplitudes were measured to determine the overall functional integrity of retinal rods and cones. Comparison of the VF results showed an abnormal BRB in at least some carriers of XLRP, particularly those with peripheral fundus pigmentary changes, but not in carriers of choroideremia with even moderately extensive pigmentary changes. The abnormal BRB in XLRP carriers, with or without peripheral fundus pigmentary changes, was associated with at least moderate to moderately extensive reduction in scotopic ERG amplitudes, while the normal VF results in choroideremia carriers were associated with normal scotopic ERG amplitudes. However, in XLRP carriers, mild to modest reductions in ERG scotopic responses were seen in the presence of normal VF findings.