Atmospheric effects on the laser-driven avalanche-based remote detection of radiation.

The effect of realistic atmospheric conditions on mid-IR (λ = 3.9 µm) and long-wave-IR (λ = 10 µm) laser-induced avalanche breakdown for the remote detection of radioactive material is examined experimentally and with propagation simulations. Our short-range in-lab mid-IR laser experiments show a correlation between increasing turbulence level and a reduced number of breakdown sites associated with a reduction in the portion of the focal volume above the breakdown threshold. Simulations of propagation through turbulence are in excellent agreement with these measurements and provide code validation. We then simulate propagation through realistic atmospheric turbulence over a long range (0.1-1 km) in the long-wave-IR regime (λ = 10 µm). The avalanche threshold focal volume is found to be robust even in the presence of strong turbulence, only dropping by ∼50% over a propagation length of ∼0.6 km. We also experimentally assess the impact of aerosols on avalanche-based detection, finding that, while background counts increase, a useful signal is extractable even at aerosol concentrations 105 times greater than what is typically observed in atmospheric conditions. Our results show promise for the long-range detection of radioactive sources under realistic atmospheric conditions.

Emergence of Spinons in Layered Trimer Iridate Ba_{4}Ir_{3}O_{10}.

Spinons are well known as the elementary excitations of one-dimensional antiferromagnetic chains, but means to realize spinons in higher dimensions is the subject of intense research. Here, we use resonant x-ray scattering to study the layered trimer iridate Ba_{4}Ir_{3}O_{10}, which shows no magnetic order down to 0.2 K. An emergent one-dimensional spinon continuum is observed that can be well described by XXZ spin-1/2 chains with a magnetic exchange of ∼55 meV and a small Ising-like anisotropy. With 2% isovalent Sr doping, magnetic order appears below T_{N}=130 K along with sharper excitations in (Ba_{1-x}Sr_{x})_{4}Ir_{3}O_{10}. Combining our data with exact diagonalization calculations, we find that the frustrated intratrimer interactions effectively reduce the system into decoupled spin chains, the subtle balance of which can be easily tipped by perturbations such as chemical doping. Our results put Ba_{4}Ir_{3}O_{10} between the one-dimensional chain and two-dimensional quantum spin liquid scenarios, illustrating a new way to suppress magnetic order and realize fractional spinons.

Spin waves and spin-state transitions in a ruthenate high-temperature antiferromagnet.

Ruthenium compounds serve as a platform for fundamental concepts such as spin-triplet superconductivity1, Kitaev spin liquids2-5 and solid-state analogues of the Higgs mode in particle physics6,7. However, basic questions about the electronic structure of ruthenates remain unanswered, because several key parameters (including Hund's coupling, spin-orbit coupling and exchange interactions) are comparable in magnitude and their interplay is poorly understood, partly due to difficulties in synthesizing large single crystals for spectroscopic experiments. Here we introduce a resonant inelastic X-ray scattering (RIXS)8,9 technique capable of probing collective modes in microcrystals of 4d electron materials. We observe spin waves and spin-state transitions in the honeycomb antiferromagnet SrRu2O6 (ref. 10) and use the extracted exchange interactions and measured magnon gap to explain its high Néel temperature11-16. We expect that the RIXS method presented here will enable momentum-resolved spectroscopy of a large class of 4d transition-metal compounds.

Liquid biopsy in triple-negative breast cancer: unlocking the potential of precision oncology.

In the era of precision oncology, the management of triple-negative breast cancer (TNBC) is rapidly changing and becoming more complicated with a variety of chemotherapy, immunotherapy, and targeted treatment options. Currently, TNBC treatment is based on prognostic and predictive factors including immunohistochemical biomarkers [e.g. programmed death-ligand 1 (PD-L1)] and germline BRCA mutations. Given the current limitation of existing biomarkers, liquid biopsies may serve as clinically useful tools to determine treatment efficacy and response in both the (neo)adjuvant and metastatic settings, for detecting early relapse, and for monitoring clonal evolution during treatment. In this review, we comprehensively summarize current and future liquid biopsy applications. Specifically, we highlight the role of circulating tumor cell characterization, circulating tumor DNA, and other preclinical liquid biopsy technologies including circulating exosomes, RNA liquid biopsy, and circulating immune-based biomarkers. In the near future, these biomarkers may serve to identify early disease relapse, therapeutic targets, and disease clonality for patients with TNBC in the clinical setting.

Magnetically propagating Hund's exciton in van der Waals antiferromagnet NiPS3.

Magnetic van der Waals (vdW) materials have opened new frontiers for realizing novel many-body phenomena. Recently NiPS3 has received intense interest since it hosts an excitonic quasiparticle whose properties appear to be intimately linked to the magnetic state of the lattice. Despite extensive studies, the electronic character, mobility, and magnetic interactions of the exciton remain unresolved. Here we address these issues by measuring NiPS3 with ultra-high energy resolution resonant inelastic x-ray scattering (RIXS). We find that Hund's exchange interactions are primarily responsible for the energy of formation of the exciton. Measuring the dispersion of the Hund's exciton reveals that it propagates in a way that is analogous to a double-magnon. We trace this unique behavior to fundamental similarities between the NiPS3 exciton hopping and spin exchange processes, underlining the unique magnetic characteristics of this novel quasiparticle.

An octahedral Mach B-dot probe for 3D flows and magnetic fields in the edge of reversed field pinches.

Measurements and simulations show that plasma relaxation processes in the reversed field pinch drive and redistribute both magnetic flux and momentum. To examine this relaxation process, a new 3D Mach B-dot probe has been constructed. This probe collects ion saturation currents through six molybdenum electrodes arranged on the flattened vertices of an octahedron made of boron nitride (BN). The ion saturation current flows through configurable voltage dividers for measurement and returns through one of six selectable return electrodes equally spaced along the 12 cm BN probe arm. In addition, the probe arm houses three B-dot magnetic pickup coils in the BN stalk immediately below to the octahedron, to measure the local magnetic field. Inserted in the Madison Symmetric Torus (MST) during deuterium discharges with 220 kA plasma current, density of 0.8 × 1013 cm-3, the probe collects ion saturation currents with sawtooth-like peaks correlated with relaxation events. This compact octahedral design fitting six Mach electrode surfaces within a 1 cm3 cube will enable future multi-point, multi-field probes compatible with the 1.5 in. ports of MST. Such probes will allow for flow circulation, current, and canonical vorticity to be calculated in the center of the finite difference stencil formed by the measurement locations.

Antiferromagnetic excitonic insulator state in Sr3Ir2O7.

Excitonic insulators are usually considered to form via the condensation of a soft charge mode of bound electron-hole pairs. This, however, presumes that the soft exciton is of spin-singlet character. Early theoretical considerations have also predicted a very distinct scenario, in which the condensation of magnetic excitons results in an antiferromagnetic excitonic insulator state. Here we report resonant inelastic x-ray scattering (RIXS) measurements of Sr3Ir2O7. By isolating the longitudinal component of the spectra, we identify a magnetic mode that is well-defined at the magnetic and structural Brillouin zone centers, but which merges with the electronic continuum in between these high symmetry points and which decays upon heating concurrent with a decrease in the material's resistivity. We show that a bilayer Hubbard model, in which electron-hole pairs are bound by exchange interactions, consistently explains all the electronic and magnetic properties of Sr3Ir2O7 indicating that this material is a realization of the long-predicted antiferromagnetic excitonic insulator phase.

Flux rope dynamics: experimental study of bouncing and merging.

We show experimentally for the first time that two mutually attracting flux ropes may bounce back instead of merging together, leading to a variety of dynamics not expected from a two-dimensional model. Attraction forces due to flux rope currents compete with repulsion from field line bending of in-plane and out-of-plane magnetic fields and elastic plasma compression. Bouncing dynamics occurs if the line-bending force due to an out-of-plane field dominates. Otherwise, the ropes merge. Further reduction in the field line-bending force results in violently erratic magnetic states.

Impact of a jail-based treatment decision-making intervention on post-release initiation of medications for opioid use disorder.

INTRODUCTION: Opioid use disorder (OUD) is common among people in jail and is effectively treated with medications for OUD (MOUD). People with OUD may have an incomplete or inaccurate understanding of OUD and MOUD, and of how to access care. We evaluated an OUD treatment decision making (TDM) intervention to determine whether the intervention increased MOUD initiation post-release. METHODS: We conducted an observational retrospective cohort study of the TDM intervention on initiation of MOUD, individuals with records data indicating confirmed or suspected OUD incarcerated in four eligible jails were eligible to receive the intervention. Time-to-event analyses of the TDM intervention were conducted using Cox proportional hazard modeling with MOUD as the outcome. RESULTS: Cox proportional hazard modeling, with the intervention modeled as having a time-varying effect due to violation of the proportionality assumption, indicated that those receiving the TDM intervention (n = 568) were significantly more likely to initiate MOUD during the first month after release from jail (adjusted hazard ratio 6.27, 95 % C.I. 4.20-9.37), but not in subsequent months (AHR 1.33 95 % C.I. 0.94-1.89), adjusting for demographics, prior MOUD, or felony or gross misdemeanor arrest in the prior year compared to those not receiving the intervention (n = 3174). CONCLUSION: The TDM intervention was associated with a significantly higher relative hazard of starting MOUD, specifically during the first month after incarceration. However, a minority of all eligible people received any MOUD. Future research should examine ways to increase initiation on MOUD immediately after (or ideally during) incarceration.

Genetic mapping of the mouse proto-oncogene c-sis to chromosome 15.

The mouse homolog (c-sis) of the transforming gene of the simian sarcoma virus was mapped to chromosome 15 by the Southern blot analysis of DNA's from hamster-mouse somatic cell hybrids. Alterations in c-sis expression may thus play a role in the various murine neoplastic diseases characterized by rearrangements or duplications of chromosome 15.

Spinach (Spinacia oleracea) is a New Natural Host of Impatiens necrotic spot virus in California.

Spinach (Spinacia oleracea) plants exhibiting severe stunting and leaves that showed interveinal yellowing, thickening, and deformation were found in an experimental trial adjacent to an artichoke field in Monterey County, CA in October of 2008. Percent incidence of symptomatic plants ranged from 20 to 39% in cvs. Bordeaux, Lazio, and Tigercat. Symptomatic plants were positive for Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) and were negative for Tomato spotted wilt virus, Cucumber mosaic virus, and Tobacco mosaic virus when tested with immunostrips (Agdia Inc., Elkhart, IN). The INSV-positive spinach was used for mechanical transmission to Nicotiana benthamiana, Chenopodium quinoa, and spinach. All inoculated plants were positive for INSV with immunostrips. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic spinach plants using a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5'-GGATGTAAGCCCTTCTTTGTAGTGG-3') and reverse (5'-CCTTCCAAGTCACCCTCTGATTG-3') primers specific to the INSV nucleoprotein (N) gene (GenBank Accession No. DQ425096). Amplicons of the expected size (approximately 364 bp) were obtained from both field-infected and mechanically inoculated spinach plants. Four amplicons were sequenced and compared with INSV N gene sequence in GenBank to confirm the identity of the products. Sequences obtained had 99% nucleotide identity with INSV sequences available under the GenBank Accession Nos. L20885, DQ523597, DQ523598, X66872, L20886, D00914, AB109100, and DQ425096. INSV can be one of the most serious viral pathogens of ornamental plants in North America and Europe. The host range of INSV is expanding and recent reports of INSV infection of vegetables include lettuce, peppers, peanut, and potato (1-4). To our knowledge, this is the first report of natural occurrence of INSV in spinach in California. Since INSV is vectored by thrips, its expanding natural host could make it an economically important problem in California and the United States. References: (1) S. T. Koike et al. Plant Dis. 92:1248, 2008. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) S. S Pappu et al. Plant Dis. 83:966, 1999. (4) K. L. Perry et al. Plant Dis. 89:340, 2005.

Pituitary stalk duplication in association with moya moya disease and bilateral morning glory disc anomaly - broadening the clinical spectrum of midline defects.

BACKGROUND: Duplication of the pituitary stalk, morning glory disc anomaly and moya moya are rare malformations. The combination of these findings may be syndromic and may have an underlying genetic etiology. METHODS: Case report and review of the literature of neurological, ophthalmological, and neuroradiological findings including ophthalmic examination, MRI and MRA. CASE REPORT: A 2 year-old girl presented with reduced visual acuity and roving eye movements since birth. Ophthalmological workup revealed bilateral morning glory disc anomaly. MRI showed duplication of the pituitary stalk and caudal displacement of the floor of the third ventricle. MRA showed narrowing of the supraclinoid internal carotid arteries with focal narrowing of the proximal middle cerebral arteries consistent with early moya moya disease. CONCLUSIONS: Review of the literature of pituitary gland duplication and of the combination of morning glory disc anomaly and moya moya disease revealed only one previously reported case. However, the spectrum of this possibly syndromic presentation may be much broader and include various types of anterior midline defects and may have a common underlying genetic cause.

Effect of fluctuation of oxygenation and time spent in the target range on retinopathy of prematurity in extremely low birth weight infants.

BACKGROUND: The association between saturation of peripheral oxygenation (SpO2) fluctuation and severity of retinopathy of prematurity (ROP) is well elucidated in extremely low birth weight (ELBW) infants. Time spent in the Target range of SpO2 is also associated with the severity of ROP. METHODS: In a prospective observational study, the SpO2 of all ELBW infants admitted to our unit were monitored for the first four weeks of life, and averaged every minute for analysis. The percent time spent at SpO2 <90%, 90-95%, and >95% and weekly SpO2 fluctuations [as SpO2 coefficient of variation (CoV)] were calculated. RESULTS: During the study period 21 infants had moderate to severe ROP and 35 infants served as controls. Infants with moderate to severe ROP were smaller and younger than their controls [676±124 grams vs. 796±148 grams (p < 0.001); and 24.0±1.0 weeks vs. 25.0±1.7 weeks (p < 0.001) respectively]. There were no significant differences in time spent in the 90-95% range between groups (p = 0.66). However there was a significant increase in weekly SpO2 CoV in infants with moderate to severe ROP vs. controls (p = 0.007). CONCLUSION: In ELBW infants, there was an association between SpO2 fluctuation during the first four weeks of life and severity of ROP, although, no association was established with time spent in the target range of SpO2.

First Report of Pelargonium zonate spot virus from Tomato in the United States.

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5' TGGCTGGCTTTTTCCGAACG 3' and R1-R: 5' CCTAATCTGTTGGTCCGAACTGTC 3'), RNA2 (R2-F: 5' GCGTGCGTATCATCAGAAATGG 3' and R2-R: 5' ATCGGGAGCAG AGAAACACCTTCC 3'), and RNA3 (R3-F: 5' CTCACCAACTGAAT GCTCTGGAC 3' and R3-R: 5' TGGATGCGTCTTTCCGAACC 3') for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

Management of subretinal macular haemorrhage by direct administration of tissue plasminogen activator.

BACKGROUND/AIMS: Recent studies on the treatment of acute subretinal macular haemorrhage have shown that the volume of the clot and the time to evacuation have strong prognostic factors for visual outcome. A novel technique for surgical evacuation of these lesions involves direct injection of tissue plasminogen activator (t-PA) into the haematoma using pars plana vitrectomy. The aim of this study was to evaluate the clinical outcomes of this recently described procedure. METHODS: 17 consecutive patients with subretinal macular haemorrhages caused by age related macular degeneration were enrolled. Patient demographics, acuities, and fluorescein angiograms were obtained for all evaluations. All patients underwent complete three port pars plana vitrectomy to enable direct cannulation of the subretinal space and injection of 48 mug of t-PA, partial fluid-air exchange, 1 hour face up supine positioning postoperatively, followed by upright positioning overnight. RESULTS: 88% of patients within the study had stabilisation or improvement of visual acuity. Nine patients had total clearing of the macular haemorrhage and eight patients had subtotal clearing. Two patients had recurrence of the haemorrhage after the procedure and one patient underwent repair for retinal detachment. Occult lesions demonstrated similar outcomes to classic or predominately classic lesions. Nine patients required no therapy after the study to treat subfoveal neovascularisation. CONCLUSIONS: This study represents one of the largest case series to date showing that direct injection of subretinal t-PA with air-fluid exchange only and no intraoperative clot lysis period can have favourable results.

Occurrence of Resistance-Breaking Beet necrotic yellow vein virus of Sugar Beet.

Rhizomania is an important virus disease of sugar beet and is caused by Beet necrotic yellow vein virus (BNYVV). During 2002-03, several sugar beet fields with cultivars partially resistant to BNYVV grown in the Imperial Valley of California were observed with severe rhizomania symptoms, suggesting that resistance conditioned by Rz1 had been compromised. Soil testing with sugar beet baiting plants followed by enzyme-linked immunosorbent assay (ELISA) was used to diagnose virus infection. Resistant varieties grown in BNYVV-infested soil from Salinas, CA, were ELISA-negative. In contrast, when grown in BNYVV-infested soil collected from the Imperial Valley, CA, all resistant varieties became infected and tested positive by ELISA. Based on host reaction, eight distinct BNYVV isolates have been identified from Imperial Valley soil (IV-BNYVV) by single local lesion isolation. Reverse transcription-polymerase chain reaction (RT-PCR) assays showed that the eight IV-BNYVV isolates did not contain RNA-5. Singlestrand conformation polymorphism banding patterns for the IV-BNYVV isolates were identical to A-type and different from P-type. Sequence alignments of PCR products from BNYVV RNA-1 near the 3' end of IV-BNYVV isolates revealed that both IV-BNYVV and Salinas BNYVV isolates were similar to A-type and different from B-type. Our results suggest that the resistancebreaking BNYVV isolates from Imperial Valley likely evolved from existing A-type isolates.

Early detection of endogenous retroviruses in chemically induced mouse cells.

Endogenous retroviral sequences are present as an integral part of eukaryotic genomes. Although the majority of these sequences are defective, a few can produce infectious virus, either spontaneously upon long-term culture or by treatment with various chemical or other agents. Early, extensive studies of retrovirus induction were done in mouse cells; however, similar studies have not been done using state-of-the-art virus detection assays and with cells of other mammalian species. To investigate induction and detection of occult retroviruses in cells of different species, especially primate cells that are used in production of biologics, we have initially determined the optimum conditions for retrovirus induction in chemically treated K-BALB mouse cells using highly sensitive product-enhanced reverse transcriptase (PERT) assays as well as transmission electron microscopy (TEM). Retrovirus induction was detected at day 1 post-drug treatment under all test conditions but was optimum using 30 microg ml(-1) of 5-iododeoxyuridine (IdU) for 24 h. Additionally, the combination of IdU and 5-azacytidine specifically enhanced activation of type C particles. RT activity was detected by PERT assays in one microliter equivalent of test sample and retroviral particle production was seen by TEM analysis. The induction of infectious murine leukemia retroviruses was confirmed by infectivity assays and correlated with PERT activity. These results indicate that strategies for detection of occult viral agents should include optimization of induction conditions using multiple viral detection assays to evaluate virus activation.

The reverse transcriptase activity in cell-free medium of chicken embryo fibroblast cultures is not associated with a replication-competent retrovirus.

BACKGROUND: Reverse transcriptase (RT) activity has previously been reported in concentrated medium of primary chicken embryo cell cultures using the traditional RT assay. Recently, using the newly-developed and highly-sensitive product-enhanced reverse transcriptase (PERT) assay, RT activity has been detected in live, attenuated vaccines grown in chicken cell substrates. Furthermore, this activity has been associated with particles that contain RNA related to an ancient, endogenous avian retrovirus family designated as EAV-0. OBJECTIVE: To investigate whether the RT activity present in vaccines produced in specific pathogen-free chicken cell substrates is associated with an infectious retrovirus that can replicate in human cells. STUDY DESIGN: The kinetics of RT activity produced by 10-day-old chicken embryo fibroblast (CEF) cultures was determined by analyzing cell-free medium in a PCR-based RT (PBRT) assay. Material containing the peak PBRT activity was used as the inoculum to infect various human cell lines and peripheral blood mononuclear cells. Filtered supernatants from control and test cultures were analyzed for the presence of replication-competent retroviruses by the PBRT assay. The cells were monitored for other adventitious agents by routine observation for cytopathic effect (CPE) and by transmission electron microscopy (TEM) at culture termination. RESULTS: The PBRT activity did not increase above the background level in the human target cells through at least five cell passages, thus indicating the absence of a replicating retrovirus. No other adventitious agents were detected based upon TEM analysis and the absence of CPE. CONCLUSION: The RT activity produced by chicken primary cell cultures is not associated with a retrovirus that can replicate in human cells.

Inherited retinal arteriolar tortuosity with retinal hemorrhages.

BACKGROUND: Familial arteriolar tortuosity is an autosomal dominant disorder affecting the retinal arterioles. OBJECTIVES: To report a pedigree with this disorder and describe a systemic workup to determine whether this vascular abnormality is limited to the eye. RESULTS: A 58-year-old woman referred for retinal hemorrhages was found to have retinal arteriolar tortuosity of both eyes, especially in the macular area. Her 63-year-old brother had a history of retinal hemmorhages beginning at age 18 years and had similar fundoscopic examination findings. The proband had an extensive systemic workup, including magnetic resonance imaging, and cardiac and renal angiography, that failed to demonstrate any other sequelae of this inherited ocular syndrome. However, each member of the family expressing this phenotype did have hypertension. CONCLUSION: Inherited retinal arteriolar tortuosity is an autosomal dominant disorder limited to the eye, at least in this pedigree, within the sensitivity of the systemic workup we used.

Coagulation defects in neonates during cardiopulmonary bypass.

We examined components of the coagulation system in 30 neonates (age, 1 to 30 days) undergoing deep hypothermic cardiopulmonary bypass (CPB). A coagulation profile consisting of activated clotting time; prothrombin time; partial thromboplastin time; factors II, V, VII, VIII, IX, X, and I (fibrinogen); antithrombin III; platelet count; and heparin levels was evaluated before bypass, at three intervals during bypass (1 minute after initiation of bypass, stable hypothermic CPB, warm CPB), after weaning from CPB and administration of protamine, and 2 to 3 hours after skin closure. The initiation of CPB resulted in a 50% decrease in circulating coagulation factors and antithrombin III levels. Platelet counts were reduced by 70% with CPB initiation. Neither deep hypothermic temperatures nor prolonged exposure to extracorporeal surfaces had any additional effect on the coagulation profiles. This suggests that the coagulation system of a neonate undergoing CPB is profoundly and globally effected by hemodilution. We believe that treatment of post-CPB coagulopathy in neonates must address these global deficits.