Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 13 de 13
Filtrar
1.
BMC Ophthalmol ; 22(1): 386, 2022 Sep 26.
Artigo em Inglês | MEDLINE | ID: mdl-36162988

RESUMO

PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.


Assuntos
Síndrome de Alstrom , Hiperopia , Baixa Visão , Síndrome de Alstrom/diagnóstico , Síndrome de Alstrom/genética , Proteínas de Ciclo Celular/genética , China , Defeitos da Visão Cromática , DNA/genética , Feminino , Humanos , Mutação , Linhagem , Fotofobia
2.
Int J Ophthalmol ; 16(12): 1952-1961, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-38111929

RESUMO

AIM: To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32. METHODS: A family with familial exudative vitreoretinopathy (FEVR) phenotype was included in the study. Whole-exome sequencing (WES) was initially used to locate copy number variations (CNVs) on 7q31.31-31.32, but failed to detect the precise breakpoint. The long-read sequencing, Oxford Nanopore sequencing Technology (ONT) was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction (QPCR) and Sanger Sequencing. RESULTS: The proband, along with her father and younger brother, were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32, which included the FEVR-related gene TSPAN12. The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del. The proband exhibited a phase 2A FEVR phenotype, characterized by a falciform retinal fold, macular dragging, and peripheral neovascularization with leaking of fluorescence. These symptoms led to a significant decrease in visual acuity in both eyes. On the other hand, the affected father and younger brother showed a milder phenotype. CONCLUSION: The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype. The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders.

3.
Zhonghua Yan Ke Za Zhi ; 48(10): 893-7, 2012 Oct.
Artigo em Zh | MEDLINE | ID: mdl-23302243

RESUMO

OBJECTIVE: To analyse the mode of inheritance and clinical characteristics of retinitis pigmentosa (RP) patients with consanguineous marriage. METHODS: RP patients were recruited for this study in Ningxia Eye Hospital from September 2009 to July 2011. All patients received complete ophthalmic examination. The mode of inheritance were determined based on family history and marriage history. Clinical features were characterized by complete ophthalmic examinations including visual acuity, macular OCT, visual field and electroretinogram (ERG). RESULTS: A total of 143 individuals with RP (33 families) were recruited. Based on analysis of family history and marriage history, 20 RP families (23 patients) had consanguineous marriage history accounted for 60.6% RP families (16.1% RP patients). There were 4 patients (from 4 families) diagnosed as Usher syndrome. In 20 RP families with consanguineous marriage history, 7 families (35.0%) were Hui ethnicity and 13 families (65%) were Han ethnicity. The marriages of 15 families were between first cousins and 3 families were between second cousins, only 2 families were between half cousins matrimony. Of 23 RP patients, 12 were males and 11 were females. The average age of onset was 11.4 ± 6.8 years and the average age of recruitment was (32.0 ± 13.5) years. The best-corrected visual acuity was less than 0.6 in 78.2% patients. According to the features of the fundus, 13 patients were classical retinitis pigmentosa and 10 patients were retinitis pigmentosa sine pigmento. Visual field examination showed that all patients had varying degrees of peripheral visual field defect. Retinal neuroepithelial layer of macular and peripheral retina became thinner and retinal photoreceptors were disappeared. The average thickness of macular fovea was (186.1 ± 78.7) µm on right eyes and (187.4 ± 76.3) µm on left eyes. CONCLUSIONS: The incidence of RP with consanguineous marriages was high in Ningxia Region. The mode of inheritance of RP patients with consanguinity is autosomal recessive. The common marriage pattern of consanguinity is between first cousins. The age of onset is early and the ocular fundus changes of some patients are atypical, this should be paid attention clinically.


Assuntos
Consanguinidade , Padrões de Herança , Retinose Pigmentar/genética , Adolescente , Adulto , Criança , Pré-Escolar , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Linhagem , Fenótipo , Adulto Jovem
4.
Front Genet ; 13: 978684, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36276932

RESUMO

Purpose: The study aims to identify genetic variants in five Chinese families with Keratoconus (KC) and describe the characteristics of parental corneal topography. Methods: Fifteen participants, including five probands and ten parents from five Chinese families with KC, were recruited for genetic and clinical analyses. Targeted next-generation sequencing using a custom-designed panel for KC was applied on the probands for variant identification. Sanger sequencing and cosegregation analysis of the suspected pathogenic variants were performed on the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Pentacam 3D anterior segment analysis system was applied for keratectasia detection and the Corvis ST for corneal biomechanics measurement. Fifteen parameters were recorded, including nine keratectasia indicators (BAD-D, TP, Kmax, Df, Db, Dp, Dt, Da, ARTH), six corneal biomechanical indicators (CBI, DA ratio, SP-A1, IR, bIOP, TBI). Results: A total of six novel variants, including five missense variants and one frameshift variant, were detected in the HMX1, SLC4A11, TGFBI, PIKFYVE, and ZEB1 genes in five probands, all of which showed co-segregation of genotype and clinical phenotype and were determined to be pathogenic. The genetic model was autosomal dominant (AD) in four families and autosomal recessive (AR) in 1 family. The analysis of keratectasia and corneal biomechanical indicators of the proband's parents (first-generation relatives) in AD families revealed that there were several abnormal indexes in BAD-D, TP, Kmax, Df, Db, Dp, Dt, Da, CBI, DA ratio, SP-A1, IR, bIOP and TBI test indexes, showing clinical characteristics of incipient KC. Conclusion: Our study shows that variants in HMX1, SLC4A11, TGFBI, PIKFYVE, and ZEB1 were associated with KC. Our study extends the gene spectrum associated with KC, provides novel insights into KC phenotypic assessments, and contributes to early diagnosis for these patients.

5.
Zhonghua Yan Ke Za Zhi ; 47(6): 516-20, 2011 Jun.
Artigo em Zh | MEDLINE | ID: mdl-21914266

RESUMO

OBJECTIVE: To screen the mutation in the RPGR gene in a large Chinese family with X-linked recessive retinitis pigmentosa (RP) and to describe the phenotype in affected males and female carriers. METHODS: Ophthalmic examinations were performed in 77 family members of a RP pedigree to identify affected individuals. Polymerase chain reaction (PCR) and direct sequencing were used for screening of mutations in RPGR gene exon ORF15. RESULTS: Mutation screening demonstrated a novel mutation, g.ORF15 + 577_578delAG, which caused an open reading frameshift and resulted in premature truncation of the RPGR protein. This mutation was detected in 8 affected male individuals and 14 obligate female carriers in this family and was found to segregate with the phenotype in this family. This mutation led to a severe RP phenotype in male affected individuals with some variability in the age of onset of night blindness and loss of visual acuity, but was recessive in female carriers without a RP phenotype. However the most striking phenotypic feature in female carriers in this pedigree was moderate to high myopia with refractive error ranging from -5.00 D to -22.00 D in 14 female carriers. CONCLUSIONS: This novel mutation in RPGR ORF15 causes serious RP phenotype in males and no RP phenotype in female carriers. Moderate to high myopia was a particular feature for female carriers in this pedigree. Our finding expands the spectrum of RPGR mutations causing RP and phenotypic spectrum of the disease in Chinese family, which is useful for further genetic consultation and genetic diagnosis.


Assuntos
Proteínas do Olho/genética , Doenças Genéticas Ligadas ao Cromossomo X/genética , Retinose Pigmentar/genética , Povo Asiático/genética , Sequência de Bases , Estudos de Casos e Controles , Éxons , Feminino , Mutação da Fase de Leitura , Humanos , Masculino , Dados de Sequência Molecular , Linhagem , Fenótipo
6.
Front Cell Dev Biol ; 9: 634843, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-33732702

RESUMO

PURPOSE: The purpose of the study is to describe the genetic and clinical features of 17 patients with ABCA4-related inherited retinal degenerations (IRDs) and define the phenotype-genotype correlations. METHODS: In this multicenter retrospective study, 17 patients from 16 families were enrolled, and ABCA4 gene variants were detected using targeted next-generation sequencing using a custom designed panel for IRDs. Sanger sequencing and co-segregation analysis of the suspected pathogenic variants were performed with the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Protein structure modifications mediated by the variants were studied using bioinformatic analyses. RESULTS: The probands were diagnosed with Stargardt disease 1 (7), cone-rod dystrophy type 3 (8), cone dystrophy (1), and retinitis pigmentosa 19 (1). Onset of symptoms occurred between 5 and 27 years of age (median age = 12.4 years). A total of 30 unique ABCA4 suspicious pathogenic variations were observed, including 18 missense mutations, seven frameshift mutations, two nonsense mutations, one canonical splice site mutation, one small in-frame deletion, and one insertion. Four novel ABCA4 variants were identified. Two novel frameshift variants, c.1290dupC (p.W431fs), and c.2967dupT (G990fs), were determined to be pathogenic. A novel missense variant c.G5761T (p.V1921L) was likely pathogenic, and another novel missense c.C170G (p.P57R) variant was of undetermined significance. All ABCA4 variants tested in this study inordinately changed the physico-chemical parameters and structure of protein based on in silico analysis. CONCLUSION: ABCA4-related IRD is genetically and clinically highly heterogeneous. Four novel ABCA4 variants were identified. This study will expand the spectrum of disease-causing variants in ABCA4, which will further facilitate genetic counseling.

7.
Int J Ophthalmol ; 14(4): 504-509, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-33875939

RESUMO

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

8.
Zhonghua Yan Ke Za Zhi ; 46(7): 597-603, 2010 Jul.
Artigo em Zh | MEDLINE | ID: mdl-21054966

RESUMO

OBJECTIVE: To research the Mn(2+) toxicity in vivo rabbit retina. Mn(2+) is used as a tracer in MRI. METHODS: It was an experimental study. Sixty pigmented rabbits (120 eyes) were divided into 5 groups randomly. Manganese chloride solution 25 µl of 10, 15, 20, 30, 40 mmol/L were injected intravitreally in one eye of each rabbit respectively as 5 experimental groups (n = 12). The saline (0.9%) 25 µl was injected intravitreally in other eye of each rabbit as control group (60 eyes). After intravitreal injections, all eyes were examined by color fundus camera, fluorescein angiography, flash electroretinography, light microscopy, and transmission electron microscopy on the 0(th), 7(th), and 28(th) day. RESULTS: On the 7(th) day after intravitreal injection, the average of the F-ERG b-wave amplitude was reduced significantly from 337 µV to 189 µV in the group of 15 mmol/L (F = 20.43, P < 0.05), but the amplitude was returned to normal on the 28(th) day. On the 7(th) day after intravitreal injections, the F-ERG b-wave amplitude was reduced significantly in the group of ≥ 20 mmol/L, and the amplitude was not returned to normal on the 28(th) day. There were abnormal changes in the structure of the retina in ≥ 20 mmol/L group at difference time after intravitreal injections. CONCLUSION: MnCl(2) as a tracer in vivo optic nerve, the concentration of ≤ 15 mmol/L caused only reversible changes in retinal function; The concentration of ≥ 20 mmol/L appears, damages in retinal function and morphology appeared.


Assuntos
Cloretos/toxicidade , Meios de Contraste/toxicidade , Retina/efeitos dos fármacos , Animais , Cloretos/administração & dosagem , Injeções Intravítreas , Compostos de Manganês/administração & dosagem , Coelhos , Retina/patologia , Retina/fisiopatologia
9.
Int J Ophthalmol ; 13(8): 1306-1311, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32821686

RESUMO

AIM: To identify mutations with whole exome sequencing (WES) in a Chinese X-linked retinitis pigmentosa (XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to SureSelect Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiSeq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation. RESULTS: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29_113del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp (D10Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa (RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP. CONCLUSION: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.

10.
Int J Ophthalmol ; 9(10): 1403-1408, 2016.
Artigo em Inglês | MEDLINE | ID: mdl-27803855

RESUMO

AIM: To describe the clinical characteristics with genetic lesions in a Chinese family with Crouzon syndrome. METHODS: All five patients from this family were included and received comprehensive ophthalmic and systemic examinations. Direct sequencing of the FGFR2 gene was employed for mutation identification. Crystal structure analysis was applied to analyze the structural changes associated with the substitution. RESULTS: All patients presented typical Crouzon features, including short stature, craniosynostosis, mandibular prognathism, shallow orbits with proptosis, and exotropia. Intrafamilial phenotypic diversities were observed. Atrophic optic nerves were exclusively detected in the proband and her son. Cranial magnetic resonance imaging (MRI) implied a cystic lesion in her sellar and third ventricular regions. A missense mutation, FGFR2 p.Cys342Trp, was found as disease causative. This substitution would generate conformational changes in the extracellular Ig-III domain of the FGFR-2 protein, thus altering its physical and biological properties. CONCLUSION: We describe the clinical presentations and genotypic lesions in a Chinese family with Crouzon syndrome. The intrafamilial phenotypic varieties in this family suggest that other genetic modifiers may also play a role in the pathogenesis of Crouzon syndrome.

11.
Int J Ophthalmol ; 7(3): 557-62, 2014.
Artigo em Inglês | MEDLINE | ID: mdl-24967208

RESUMO

AIM: To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia, located in the northwest part of China. METHODS: A stratified, randomized sampling procedure was employed in the study, including urban and rural area of all age group. Visual acuity, anterior segment and ocular fundus were checked. Related factor of corneal disease, including age, gender, education status, ethnic group, location and occupation, were identified according to uniform customized protocol. An eye was defined to be corneal blindness if the visual acuity was <20/400 due to a corneal disease. RESULTS: Three thousand individuals (1290 from urban area and 1710 from rural area) participated in the investigation, with a response rate of 80.380%. The prevalence of corneal blindness was 0.023% in both eyes and 0.733% in at least one eye. The blindness in at least one eye with varied causes was present in 106 participants (3.533%) and in bilateral eyes in 34 participants (1.133%). The corneal diseases accounted for 20.754% of blindness in at least one eye and 20.588% of bilateral blindness. The prevalence of corneal disease was higher in older and Han ethnic group, especially those who occupied in agriculture and outdoor work. People with corneal blindness were more likely to be older and lower education. Rural population were more likely to suffer from bilateral corneal blindness than the urban population in ≥59-year group (χ (2)=6.716, P=0.019). Infectious, trauma and immune corneal disease were the three leading causes of corneal disease. Trauma corneal disease was more likely leading to blindness in one eye. However, infectious and immune corneal diseases make more contribution to the bilateral corneal blindness. CONCLUSION: Corneal blindness is a significant burden of in Ningxia population, encompassing a variety of corneal infections and trauma; the majority of those were avoidable. Health promotion strategies and good hygienic conditions have to be developed.

12.
Int J Ophthalmol ; 6(4): 430-5, 2013.
Artigo em Inglês | MEDLINE | ID: mdl-23991373

RESUMO

AIM: To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. METHODS: Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

13.
Int J Ophthalmol ; 5(4): 459-65, 2012.
Artigo em Inglês | MEDLINE | ID: mdl-22937505

RESUMO

AIM: To assess the visual outcomes and possible risk factors associated with axis alignment and rotational stability after implantation of Toric implantable collamer lens (TICL) for the correction of high myopic astigmatism. METHODS: In this prospective, nonrandomized clinical study, 54 consecutive eyes of 29 patients with high myopic astigmatism received TICL implantation. To evaluate postoperative axis deviation from the intended axis, a digital anterior segment photograph was taken. The ultrasound biomicroscopy(UBM) was used to observe footplate-position. RESULTS: After mean follow-up of 8.6 months, mean manifest refractive cylinder (MRC) decreased 79.3% from (-1.88±1.49)D preoperatively to (0.39±0.61)D postoperatively. MRC within 1.00 D occurred in 68.5% (37/54) of eyes, whereas 48.1% (26/54) had MRC within 0.50 D. Mean manifest refraction spherical equivalent (MRSE) changed from (-12.08±4.22)D preoperatively to (-0.41±0.61)D postoperatively. Uncorrected binocular vision of 20/20 or better occurred in 72.2% (39/54) of patients compared with binocular best-corrected visual acuity (BCVA) of 20/20 or better in 44.4% (24/54) preoperatively. The mean difference between intended and achieved TICL axes was (6.96±8.37)°. Footplates of TICLs were in the ciliary sulcus in 22 eyes (46.3%), below the ciliary sulcus in 32 eyes (53.7%). The angle of TICL rotation had significant correlation with the footplates-position (t=2.127; P=0.045) and the postoperative TICL vaulting (r=-0.516; P=0.000). CONCLUSION: The results of our study further support the safety, efficacy and predictability of TICL for the correct high myopic astigmatism. The footplate-position of TICL and vault value should be taken into consideration as two possible risks factors for TICL rotation.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA