Vimentin binds to G-quadruplex repeats found at telomeres and gene promoters.

G-quadruplex (G4) structures that can form at guanine-rich genomic sites, including telomeres and gene promoters, are actively involved in genome maintenance, replication, and transcription, through finely tuned interactions with protein networks. In the present study, we identified the intermediate filament protein Vimentin as a binder with nanomolar affinity for those G-rich sequences that give rise to at least two adjacent G4 units, named G4 repeats. This interaction is supported by the N-terminal domains of soluble Vimentin tetramers. The selectivity of Vimentin for G4 repeats versus individual G4s provides an unprecedented result. Based on GO enrichment analysis performed on genes having putative G4 repeats within their core promoters, we suggest that Vimentin recruitment at these sites may contribute to the regulation of gene expression during cell development and migration, possibly by reshaping the local higher-order genome topology, as already reported for lamin B.

Nanomechanics of G-quadruplexes within the promoter of the KIT oncogene.

G-quadruplexes (G4s) are tetrahelical DNA structures stabilized by four guanines paired via Hoogsteen hydrogen bonds into quartets. While their presence within eukaryotic DNA is known to play a key role in regulatory processes, their functional mechanisms are still under investigation. In the present work, we analysed the nanomechanical properties of three G4s present within the promoter of the KIT proto-oncogene from a single-molecule point of view through the use of magnetic tweezers (MTs). The study of DNA extension fluctuations under negative supercoiling allowed us to identify a characteristic fingerprint of G4 folding. We further analysed the energetic contribution of G4 to the double-strand denaturation process in the presence of negative supercoiling, and we observed a reduction in the energy required for strands separation.

Double-stranded flanking ends affect the folding kinetics and conformational equilibrium of G-quadruplexes forming sequences within the promoter of KIT oncogene.

G-quadruplexes embedded within promoters play a crucial role in regulating the gene expression. KIT is a widely studied oncogene, whose promoter contains three G-quadruplex forming sequences, c-kit1, c-kit2 and c-kit*. For these sequences available studies cover ensemble and single-molecule analyses, although for kit* the latter were limited to a study on a promoter domain comprising all of them. Recently, c-kit2 has been reported to fold according to a multi-step process involving folding intermediates. Here, by exploiting fluorescence resonance energy transfer, both in ensemble and at the single molecule level, we investigated the folding of expressly designed constructs in which, alike in the physiological context, either c-kit2 or c-kit* are flanked by double stranded DNA segments. To assess whether the presence of flanking ends at the borders of the G-quadruplex affects the folding, we studied under the same protocols oligonucleotides corresponding to the minimal G-quadruplex forming sequences. Data suggest that addition of flanking ends results in biasing both the final equilibrium state and the folding kinetics. A previously unconsidered aspect is thereby unravelled, which ought to be taken into account to achieve a deeper insight of the complex relationships underlying the fine tuning of the gene-regulatory properties of these fascinating DNA structures.

A Screening Protocol for Exploring Loop Length Requirements for the Formation of a Three Cytosine-Cytosine+ Base-Paired i-Motif.

DNA sequences containing at least four runs of repetitive cytosines can fold into tetra-helical structures called i-Motifs (iMs). The interest in these DNA secondary structures is increasing due to their therapeutical and technological applications. Still, limited knowledge of their folding requirements is currently available. We developed a novel step-by-step pipeline for the systematic screening of putative iM-forming model sequences. Focusing on structures comprising only three cytosine-cytosine+ base pairs, we investigated what the minimal lengths of the loops required for formation of an intra-molecular iM are. Our data indicate that two and three nucleotides are required to connect the strands through the minor and majorgrooves of the iM, respectively. Additionally, they highlight an asymmetric behavior according to the distribution of the cytosines. Specifically, no sequence containing a single cytosine in the first and third run was able to fold into intra-molecular iMs with the same stability of those formed when the first and the third run comprise two cytosines. This knowledge represents a step forward toward the development of prediction tools for the proper identification of biologically functional iMs, as well as for the rational design of these secondary structures as technological devices.

Bench to bedside: The ambitious goal of transducing medicinal chemistry from the lab to the clinic.

This paper deals with a critical examination on the possibility of quantitatively predicting the in vivo activity of new chemical entities (NCEs) by making use of in silico and in vitro data including three-dimensional structure of drug-target complex, thermodynamic and crowding parameters, ADME (absorption, distribution, metabolism, excretion) properties, and off-target (toxic) interactions. This formidable challenge is still a dream, given the presently occurring exceedingly high (>95%) attrition rates of NCEs. As a solution we envisage exploiting advanced AI (artificial intelligence) algorithms. In fact, very recent AI implemented programs proved remarkably effective and accurate in predicting the 3D architecture of (any) protein, starting from the amino-acid sequence only. The same accuracy could not be obtained using classical conformational studies. Apart from these breakthrough results, AI algorithms could be profitably used to extract valuable information from the huge amount of data so far accumulated from previous studies. In case of positive results, the drug discovery procedure would be sensibly accelerated, and the relative costs remarkably reduced.

Selective Ligands for Non-Canonical DNA Structures: Do They Have a Future in Medicinal Chemistry?

Winning the war against cancer represents a major goal currently [...].

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

A Gold Nanoparticle Nanonuclease Relying on a Zn(II) Mononuclear Complex.

Similarly to enzymes, functionalized gold nanoparticles efficiently catalyze chemical reactions, hence the term nanozymes. Herein, we present our results showing how surface-passivated gold nanoparticles behave as synthetic nanonucleases, able to cleave pBR322 plasmid DNA with the highest efficiency reported so far for catalysts based on a single metal ion mechanism. Experimental and computational data indicate that we have been successful in creating a catalytic site precisely mimicking that suggested for natural metallonucleases relying on a single metal ion for their activity. It comprises one Zn(II) ion to which a phosphate diester of DNA is coordinated. Importantly, as in nucleic acids-processing enzymes, a positively charged arginine plays a key role by assisting with transition state stabilization and by reducing the pKa of the nucleophilic alcohol of a serine. Our results also show how designing a catalyst for a model substrate (bis-p-nitrophenylphosphate) may provide wrong indications as for its efficiency when it is tested against the real target (plasmid DNA).

Coumarins from Magydaris pastinacea as inhibitors of the tumour-associated carbonic anhydrases IX and XII: isolation, biological studies and in silico evaluation.

In an in vitro screening for human carbonic anhydrase (hCA) inhibiting agents from higher plants, the petroleum ether and ethyl acetate extracts of Magydaris pastinacea seeds selectively inhibited hCA IX and hCA XII isoforms. The phytochemical investigation of the extracts led to the isolation of ten linear furocoumarins (1-10), four simple coumarins (12-15) and a new angular dihydrofurocoumarin (11). The structures of the isolated compounds were elucidated based on 1 D and 2 D NMR, MS, and ECD data analysis. All isolated compounds were inactive towards the ubiquitous cytosolic isoform hCA I and II (Ki > 10,000 nM) while they were significantly active against the tumour-associated isoforms hCA IX and XII. Umbelliprenin was the most potent coumarin inhibiting hCA XII isoform with a Ki of 5.7 nM. The cytotoxicity of the most interesting compounds on HeLa cancer cells was also investigated.

G-Quadruplex Modulation of SP1 Functional Binding Sites at the KIT Proximal Promoter.

The regulation of conformational arrangements of gene promoters is a physiological mechanism that has been associated with the fine control of gene expression. Indeed, it can drive the time and the location for the selective recruitment of proteins of the transcriptional machinery. Here, we address this issue at the KIT proximal promoter where three G-quadruplex forming sites are present (kit1, kit2 and kit*). On this model, we focused on the interplay between G-quadruplex (G4) formation and SP1 recruitment. By site directed mutagenesis, we prepared a library of plasmids containing mutated sequences of the WT KIT promoter that systematically exploited different G4 formation attitudes and SP1 binding properties. Our transfection data showed that the three different G4 sites of the KIT promoter impact on SP1 binding and protein expression at different levels. Notably, kit2 and kit* structural features represent an on-off system for KIT expression through the recruitment of transcription factors. The use of two G4 binders further helps to address kit2-kit* as a reliable target for pharmacological intervention.

Ferulic Acid Esters and Withanolides: In Search of Withania somnifera GABAA Receptor Modulators.

Nine compounds, including two undescribed withanolides, withasomniferolides A and B (1 and 2), three known withanolides (3-5), a ferulic acid dimeric ester (6), and an inseparable mixture of three long alkyl chain ferulic acid esters (7-9), were isolated from a GABAA receptor positive activator methanol extract of the roots of Withania somnifera. The structures of the isolated compounds were elucidated based on NMR, MS, and ECD data analysis. In order to bioassay the single ferulic acid derivatives, compounds 6-9 were also synthesized. The most active compound, docosanyl ferulate (9), was able to enhance the GABAA receptor inhibitory postsynaptic currents with an IC50 value of 7.9 µM. These results, by showing an ability to modulate the GABAA receptor function, cast fresh light on the biological activities of the secondary metabolites of W. somnifera roots.

Conformational profiling of a G-rich sequence within the c-KIT promoter.

G-quadruplexes (G4) within oncogene promoters are considered to be promising anticancer targets. However, often they undergo complex structural rearrangements that preclude a precise description of the optimal target. Moreover, even when solved structures are available, they refer to the thermodynamically stable forms but little or no information is supplied about their complex multistep folding pathway. To shed light on this issue, we systematically followed the kinetic behavior of a G-rich sequence located within the c-KIT proximal promoter (kit2) in the presence of monovalent cations K+ and Na+. A very short-lived intermediate was observed to start the G4 folding process in both salt conditions. Subsequently, the two pathways diverge to produce distinct thermodynamically stable species (parallel and antiparallel G-quadruplex in K+ and Na+, respectively). Remarkably, in K+-containing solution a branched pathway is required to drive the wild type sequence to distribute between a monomeric and dimeric G-quadruplex. Our approach has allowed us to identify transient forms whose relative abundance is regulated by the environment; some of them were characterized by a half-life within the timescale of physiological DNA processing events and thus may represent possible unexpected targets for ligands recognition.

Coexistence of two main folded G-quadruplexes within a single G-rich domain in the EGFR promoter.

EGFR is an oncogene which codifies for a tyrosine kinase receptor that represents an important target for anticancer therapy. Indeed, several human cancers showed an upregulation of the activity of this protein. The promoter of this gene contains some G-rich domains, thus representing a yet unexplored point of intervention to potentially silence this gene. Here, we explore the conformational equilibria of a 30-nt long sequence located at position -272 (EGFR-272). By merging spectroscopic and electrophoretic analysis performed on the wild-type sequence as well as on a wide panel of related mutants, we were able to prove that in potassium ion containing solution this sequence folds into two main G-quadruplex structures, one parallel and one hybrid. They show comparable thermal stabilities and affinities for the metal ion and, indeed, they are always co-present in solution. The folding process is driven by a hairpin occurring in the domain corresponding to the terminal loop which works as an important stabilizing element for both the identified G-quadruplex arrangements.

Targeting Canine KIT Promoter by Candidate DNA G-Quadruplex Ligands.

G-quadruplexes (G4) are nucleic acid secondary structures frequently assumed by G-rich sequences located mostly at telomeres and proto-oncogenes promoters. Recently, we identified, in canine KIT (v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog) promoter, two G-rich sequences able to fold into G4: d_kit1 and d_kit2_A16. In this study, an anthraquinone (AQ1) and an anthracene derivative (AN6), known to stabilize the G4 structures of the corresponding human h_kit1 and h_kit2, were tested on the canine G4 and in two canine mast cell tumor (MCT) cell lines (C2 and NI-1) to verify their capability to down-regulate KIT expression. The cytotoxicity of AQ1 and AN6 was determined using the Alamar Blue test; also the constitutive expression of KIT and other proto-oncogenes containing G4 structures in their promoter (BCL2, VEGFα, VEGFR2, KRAS, and TERT) was assessed by quantitative real-time polymerase chain reaction (qRT-PCR). Then the time- and dose-dependent effects of both ligands on target gene expression were assessed by qRT-PCR. All target genes were constitutively expressed up to 96 hours of culture. Both ligands decreased KIT mRNA levels and c-kit protein amount, and AN6 was comparatively fairly more effective. DNA interaction studies and a dual-luciferase gene reporter assay performed on a noncancerous canine cell line (Madin-Darby Canine Kidney cells) proved that this down-regulation was the result of the interaction of AN6 with KIT proximal promoter. Interestingly, our results only partially overlap with those previously obtained in human cell lines, where AQ1 was found as the most effective compound. These preliminary data might suggest AN6 as a promising candidate for the selective targeting of canine KIT-dependent tumors.

Characterization of G4-G4 Crosstalk in the c-KIT Promoter Region.

The proximal promoter of c-KIT contains a peculiar domain that consists of three short G-rich sequences that are close together and can fold into noncanonical DNA secondary structures called G-quadruplexes (G4). Here, we focused on a sequence containing two consecutive G4 (kit2 and kit*). By electrophoretic, surface plasmon resonance, and spectroscopic techniques, we demonstrated that they retain the ability to fold into G4 upon being inserted into the extended sequence. Here, we highlighted the occurrence of crosstalk between the two forming units. This previously unexplored G4-G4 interaction modulates both the conformation and the stability of the overall arrangement of the c-KIT promoter. It is not supported by stacking of single nucleotides but refers to a G4-G4 interaction surface surrounded by a two-nucleotides loop that might represent a reliable unprecedented target for anticancer therapy.

G-quadruplexes in human promoters: A challenge for therapeutic applications.

BACKGROUND: G-rich sequences undergo unique structural equilibria to form G-quadruplexes (G4) both in vitro and in cell systems. Several pathologies emerged to be directly related to G4 occurrence at defined genomic portions. Additionally, G-rich sequences are significantly represented around transcription start sites (TSS) thus leading to the hypothesis of a gene regulatory function for G4. Thus, the tuning of G4 formation has been proposed as a new powerful tool to regulate gene expression to treat related pathologies. However, up-to date this approach did not provide any new really efficient treatment. SCOPE OF REVIEW: Here, we summarize the most recent advances on the correlation between the structural features of G4 in human promoters and the role these systems physiologically exert. In particular we focus on the effect of G4 localization among cell compartments and along the promoters in correlation with protein interaction networks and epigenetic state. Finally the intrinsic structural features of G4 at promoters are discussed to unveil the contribution of different G4 structural modules in this complex architecture. MAJOR CONCLUSIONS: It emerges that G4s play several roles in the intriguing and complex mechanism of gene expression, being able to produce opposite effects on the same target. This reflects the occurrence of a highly variegate network of several components working simultaneously. GENERAL SIGNIFICANCE: The resulting picture is still fuzzy but some points of strength are definitely emerging, which prompts all of us to strengthen our efforts in view of a selective control of gene expression through G4 modulation. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.

Novel xanthone-polyamine conjugates as catalytic inhibitors of human topoisomerase IIα.

It has been proposed that xanthone derivatives with anticancer potential act as topoisomerase II inhibitors because they interfere with the ability of the enzyme to bind its ATP cofactor. In order to further characterize xanthone mechanism and generate compounds with potential as anticancer drugs, we synthesized a series of derivatives in which position 3 was substituted with different polyamine chains. As determined by DNA relaxation and decatenation assays, the resulting compounds are potent topoisomerase IIα inhibitors. Although xanthone derivatives inhibit topoisomerase IIα-catalyzed ATP hydrolysis, mechanistic studies indicate that they do not act at the ATPase site. Rather, they appear to function by blocking the ability of DNA to stimulate ATP hydrolysis. On the basis of activity, competition, and modeling studies, we propose that xanthones interact with the DNA cleavage/ligation active site of topoisomerase IIα and inhibit the catalytic activity of the enzyme by interfering with the DNA strand passage step.

Indenocinnoline derivatives as G-quadruplex binders, topoisomerase IIα inhibitors and antiproliferative agents.

DNA intercalating agents are a consolidated therapeutic option in the treatment of tumor diseases. Starting from previous findings in the antiproliferative efficacy of a series of indeno[1,2-c]cinnoline-11-one derivatives, we performed a suitable decoration of this scaffold by means of a simple and straightforward chemistry, aiming to a) enlarge the planar core to a pentacyclic benzo[h]indeno[1,2-c]cinnoline-13-one and b) introduce a basic head tethered through a simple polymethylene chain. In fluorescence melting and fluorescence intercalator displacement assays, these new compounds displayed fair to very good intercalating properties on different nucleic acid strands, with preference for G-quadruplex sequences. Inhibition of human topoisomerase IIα and antiproliferative assays on HeLa and MCF7 tumor cell lines outlined a multitarget antiproliferative profile for tetracyclic 6 and pentacyclic derivative 20, both bearing a N,N-dimethylamine as the protonatable moiety. Particularly, compound 6 displayed a very potent inhibition of tumor cell proliferation, while 20 returned the highest thermal stabilization in melting experiments. In summary, these results outlined a potential of such highly planar scaffolds for nucleic acid binding and antiproliferative effects.

Optimized Virtual Screening Workflow for the Identification of Novel G-Quadruplex Ligands.

G-quadruplexes, alternative DNA secondary structures present in telomeres, emerge as promising targets for the treatment of cancer, because they prevent telomere elongation and accordingly cell proliferation. Within this study, theoretically validated pharmacophore- and shape-based models as well as a theoretically validated docking protocol were generated and applied in parallel for virtual screening and the identification of novel G-quadruplex ligands. Top-ranked hits retrieved with all methods independently and in addition in a consensus approach were selected for biological testing. Of the 32 tested virtual hits seven selectively stabilized G-quadruplexes over duplex DNA in the fluorescence melting assay. For the five most active compounds, chemically closely related analogues were collected and subjected to in vitro analysis. Thereby, seven further novel G-quadruplex ligands could be identified. These molecules do not only represent novel scaffolds, but some of them are in addition even more potent G-quadruplex stabilizers than the established reference compound berberine. This study proposes an optimized in silico workflow for the identification of novel G-quadruplex stabilizers, which can also be applied in future studies. In addition, structurally novel and promising lead candidates with strong and selective G-quadruplex stabilizing properties are reported.

Novel insights on the DNA interaction of calicheamicin γ1(I).

Calicheamicin γ1(I) (Cal) is a unique molecule in which a DNA binding motif (aryl-tetrasaccharide) is linked to a DNA cleaving moiety (calicheamicinone). The hallmark of this natural product rests in the impressive optimization of these two mechanisms leading to a drug that is extremely efficient in cleaving DNA at well-defined sites. However, the relative contributions of these two structurally distinct domains to the overall process have not been fully elucidated yet. Here, we used different experimental approaches to better dissect the role of the aryl-tetrasaccharide and the enediyne moieties in the DNA sequence selective binding step as well as the in the cleavage reaction. Our results highlight the remarkable cooperation of the two components in producing an amazing molecular machine. The herein presented molecular details of this concerted mechanism of action can be further applied to rationally design more druggable compounds.