Assessment of Prickly Sida as a Potential Inoculum Source for Sida Golden Mosaic Virus in Commercial Snap Bean Farms in Georgia, United States.

Sida golden mosaic virus (SiGMV), an obligate pathogen that infects snap beans (Phaseolus vulgaris), is known to infect prickly sida (Sida spinosa L.), which is a common weed in agricultural farms in Georgia. Prickly sida has also been reported as a suitable host of sweetpotato whitefly (Bemisia tabaci), the vector of SiGMV. Despite being a host for both SiGMV and its vector, the role of prickly sida as a reservoir and inoculum source for SiGMV in snap bean farms has not been evaluated. This study was conducted to document the occurrence of SiGMV-infected prickly sida plants and to assess its potential role as a source of SiGMV inoculum in snap bean farms. A survey of 17 commercial snap bean farms conducted in spring 2021 confirmed the presence of SiGMV-infected prickly sida in southern Georgia. In fall 2021 and 2022, on-farm field trials were conducted in four commercial farms where SiGMV-infected prickly sida plants were documented earlier as a part of survey in spring 2021. The spatial distribution and temporal patterns of adult whiteflies and SiGMV on snap bean were compared between macroplots (13.7 × 30.5 m) "with prickly sida" or "without prickly sida" that were at least 232 m apart from each other. We did not observe any consistent differences in counts of adult whiteflies between macroplots with or without prickly sida in the four commercial farms. SiGMV infection was detected earlier and with higher incidences in snap bean macroplots "with prickly sida" compared with macroplots "without prickly sida." An apparent disease gradient was observed in two of the four farms assessed. Higher SiGMV incidences were observed on the edges of macroplots "with prickly sida." These findings indicate prickly sida as a potential natural reservoir and a source for SiGMV spread in snap bean farms in southern Georgia.

Pest status, molecular evolution, and epigenetic factors derived from the genome assembly of Frankliniella fusca, a thysanopteran phytovirus vector.

BACKGROUND: The tobacco thrips (Frankliniella fusca Hinds; family Thripidae; order Thysanoptera) is an important pest that can transmit viruses such as the tomato spotted wilt orthotospovirus to numerous economically important agricultural row crops and vegetables. The structural and functional genomics within the order Thysanoptera has only begun to be explored. Within the > 7000 known thysanopteran species, the melon thrips (Thrips palmi Karny) and the western flower thrips (Frankliniella occidentalis Pergrande) are the only two thysanopteran species with assembled genomes. RESULTS: A genome of F. fusca was assembled by long-read sequencing of DNA from an inbred line. The final assembly size was 370 Mb with a single copy ortholog completeness of ~ 99% with respect to Insecta. The annotated genome of F. fusca was compared with the genome of its congener, F. occidentalis. Results revealed many instances of lineage-specific differences in gene content. Analyses of sequence divergence between the two Frankliniella species' genomes revealed substitution patterns consistent with positive selection in ~ 5% of the protein-coding genes with 1:1 orthologs. Further, gene content related to its pest status, such as xenobiotic detoxification and response to an ambisense-tripartite RNA virus (orthotospovirus) infection was compared with F. occidentalis. Several F. fusca genes related to virus infection possessed signatures of positive selection. Estimation of CpG depletion, a mutational consequence of DNA methylation, revealed that F. fusca genes that were downregulated and alternatively spliced in response to virus infection were preferentially targeted by DNA methylation. As in many other insects, DNA methylation was enriched in exons in Frankliniella, but gene copies with homology to DNA methyltransferase 3 were numerous and fragmented. This phenomenon seems to be relatively unique to thrips among other insect groups. CONCLUSIONS: The F. fusca genome assembly provides an important resource for comparative genomic analyses of thysanopterans. This genomic foundation allows for insights into molecular evolution, gene regulation, and loci important to agricultural pest status.

A C2H2 zinc finger transcription factor of the whitefly Bemisia tabaci interacts with the capsid proteins of begomoviruses and inhibits virus retention.

Begomoviruses are a group of ssDNA viruses exclusively transmitted by the whitefly Bemisia tabaci and constrain vegetable production in the old and new worlds. Although multiple molecular determinants governing the transmission of begomoviruses by whiteflies have been unravelled, factors critical for transmission majorly remain unknown. In this study, a whitefly C2H2 zinc finger (ZF) protein, 100% identical to the vascular endothelial ZF-like gene (vezf) protein was confirmed to interact with the CP of both old- and new-world begomoviruses. This was achieved by a yeast two-hybrid (Y2H) system screening of a whitefly cDNA library using capsid protein (CP) of TYLCV as a bait. In silico annotation of vezf protein revealed that it contains a N-terminal ZF-associated domain (ZAD) alongside multiple C2H2 ZF domains on the C-terminal end. ZAD-ZF proteins form the most abundant class of transcription factors within insects. Herein, we validated the interaction of vezf with four diverse begomoviruses and its functional role in begomovirus transmission. Silencing of the vezf gene of B. tabaci led to increased retention of three diverse begomoviruses tested. Vezf is the first insect transcription factor identified to interact with plant viruses and can be crucial to understand the possible mechanisms by which plant viruses modulate transcription of their insect vectors during transmission.

Whitefly-Mediated Transmission and Subsequent Acquisition of Highly Similar and Naturally Occurring Tomato Yellow Leaf Curl Virus Variants.

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids, resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (variant #2 and variant #4) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants' concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than that of variant #2 in tomato plants. Despite differences in variants' accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Foliar Chemical Protection Against Pantoea ananatis in Onion Is Negated by Thrips Feeding.

Center rot of onion, caused by Pantoea ananatis, is an economically important disease in onion production in Georgia and elsewhere in the United States. Growers rely on frequent foliar applications of bactericides and, in some cases, plant defense inducers to manage this disease. However, regular prophylactic application of these chemicals is not cost-effective and may not be environmentally friendly. Thrips (Thrips tabaci and Frankliniella fusca) are vectors of P. ananatis, and their feeding may compromise the effectiveness of foliar applications against P. ananatis. In this study, foliar treatments with acibenzolar-S-methyl (Actigard 50WG), cupric hydroxide (Kocide 3000), and Actigard plus Kocide were evaluated for their effectiveness in the presence and absence of thrips infestation at two critical onion growth stages: bulb initiation and bulb swelling. Onion growth stage had no impact on the effectiveness of either Kocide or Actigard. In the absence of thrips, Kocide application resulted in reduced center rot incidence compared with Actigard, regardless of the growth stage. However, when thrips were present, the efficacy of both Kocide and Actigard was reduced, with bulb incidence not significantly different from the nontreated control. In independent greenhouse studies in the presence or absence of thrips, it was observed that use of protective chemicals (Kocide, Actigard, and their combinations) at different rates also affected pathogen progression into internal neck tissue and incidence of bulb rot. These results suggest that thrips infestation can reduce the efficacy of protective chemical treatments against P. ananatis. Thrips feeding on onion foliage and resulting feeding scars could facilitate P. ananatis entry and subsequently compromise the efficacy of protective chemical treatments. Therefore, an effective center rot management strategy should likely include thrips management in addition to bactericides at susceptible growth stages of onion.

Low Frequency of Horizontal and Vertical Transmission of Cucurbit Leaf Crumple Virus in Whitefly Bemisia tabaci Gennadius.

Cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus, is transmitted by whiteflies in a persistent and circulative manner. Like other begomoviruses, CuLCrV transmission via feeding is well understood; however, whether and how CuLCrV is transmitted by horizontal and vertical modes in its vector, Bemisia tabaci, remains unexplored. We studied transovarial and mating transmission of CuLCrV, and comparatively analyzed virus accumulation in whiteflies through feeding and nonfeeding modes. Furthermore, we quantified CuLCrV DNA A accumulation at different time points to determine whether this virus propagates in whiteflies. CuLCrV DNA A was transmitted vertically and horizontally by B. tabaci, with low frequency in each case. Transovarial transmission of CuLCrV DNA A was only 3.93% in nymphs and 3.09% in adults. Similarly, only a single viruliferous male was able to transmit CuLCrV DNA A to its nonviruliferous female counterparts via mating. In contrast, viruliferous females were unable to transmit CuLCrV DNA A to nonviruliferous males. Additionally, the recipient adults that presumably acquired CuLCrV transovarially and via mating were not able to transmit the virus to squash plants. We further report that the CuLCrV DNA A viral copy numbers were significantly lower in nonfeeding modes of transmission than in feeding ones. The viral copy numbers significantly decreased at succeeding time points throughout adulthood, suggesting no CuLCrV propagation in B. tabaci. Altogether, the low frequency of nonfeeding transmission, reduced virus accumulation in whiteflies, and absence of plant infectivity through nonfeeding transmission suggest that transovarial and mating CuLCrV transmission might not substantially contribute to CuLCrV epidemics.

Virus Accumulation and Whitefly Performance Modulate the Role of Alternate Host Species as Inoculum Sources of Tomato Yellow Leaf Curl Virus.

Evaluating alternate hosts that facilitate the persistence of a virus in the landscape is key to understanding virus epidemics. In this study, we explored the role of several plant species (eggplant, pepper, and Palmer amaranth) as inoculum sources of tomato yellow leaf curl virus (TYLCV) and as reservoirs for its insect vector, Bemisia tabaci (Gennadius). All inoculated species were infected with TYLCV, but whiteflies acquired fewer viral copies via feeding from pepper and eggplant than from tomato and Palmer amaranth. Further, back-transmission assays to recipient tomato resulted in TYLCV infection only when TYLCV was acquired from Palmer amaranth or tomato. Analysis suggested that the role of plant species as TYLCV inoculum sources may be determined by the accumulation of viral copies in the plant, and consequently in the insect vector. In addition, results showed that all three alternate species could sustain populations of B. tabaci, while differentially influencing fitness of whiteflies. Eggplant was a superior host for whiteflies, whereas whitefly survival was compromised on pepper. Together, we demonstrate that both plant-virus and plant-vector interactions could influence the role of an alternate host in TYLCV epidemics, and in our region of study we highlight the potential risk of hosts such as Palmer amaranth in the spread of TYLCV.

Transcriptome changes associated with Tomato spotted wilt virus infection in various life stages of its thrips vector, Frankliniella fusca (Hinds).

Persistent propagative viruses maintain intricate interactions with their arthropod vectors. In this study, we investigated the transcriptome-level responses associated with a persistent propagative phytovirus infection in various life stages of its vector using an Illumina HiSeq sequencing platform. The pathosystem components included a Tospovirus, Tomato spotted wilt virus (TSWV), its insect vector, Frankliniella fusca (Hinds), and a plant host, Arachis hypogaea (L.). We assembled (de novo) reads from three developmental stage groups of virus-exposed and non-virus-exposed F. fusca into one transcriptome consisting of 72 366 contigs and identified 1161 differentially expressed (DE) contigs. The number of DE contigs was greatest in adults (female) (562) when compared with larvae (first and second instars) (395) and pupae (pre- and pupae) (204). Upregulated contigs in virus-exposed thrips had blastx annotations associated with intracellular transport and virus replication. Upregulated contigs were also assigned blastx annotations associated with immune responses, including apoptosis and phagocytosis. In virus-exposed larvae, Blast2GO analysis identified functional groups, such as multicellular development with downregulated contigs, while reproduction, embryo development and growth were identified with upregulated contigs in virus-exposed adults. This study provides insights into differences in transcriptome-level responses modulated by TSWV in various life stages of an important vector, F. fusca.

Interactions Between Frankliniella fusca and Pantoea ananatis in the Center Rot Epidemic of Onion (Allium cepa).

An Enterobacteriaceae bacterium, Pantoea ananatis (Serrano) Mergaert, is the causal agent of an economically important disease of onion, center rot. P. ananatis is transmitted by an onion-infesting thrips, Frankliniella fusca (Hinds). However, interactions between F. fusca and P. ananatis as well as transmission mechanisms largely remain uncharacterized. This study investigated P. ananatis acquisition by thrips and transstadial persistence. Furthermore, the effects of bacterial acquisition on thrips fitness were also evaluated. When thrips larvae and adults were provided with acquisition access periods (AAP) on peanut leaflets contaminated with the bacterium, an exponentially positive relationship was observed between AAP and P. ananatis acquisition (R(2) ≥ 0.77, P = 0.01). P. ananatis persisted in thrips through several life stages (larvae, pupae, and adult). Despite the bacterial persistence, no significant effects on thrips fitness parameters such as fecundity and development were observed. Immunofluorescence microscopy of adult thrips with P. ananatis-specific antibody after 48 h AAP on contaminated food revealed that the bacterium was localized only in the gut. These results suggested that the pathogen is not circulative and could be transmitted through feces. Mechanical inoculation of onion seedlings with fecal rinsates produced center rot symptoms, whereas inoculation with rinsates potentially containing salivary secretions did not. These results provide evidence for stercorarian transmission (transmission through feces) of P. ananatis by F. fusca.

Thrips Settling, Oviposition and IYSV Distribution on Onion Foliage.

Thrips tabaci Lindeman (Thysanoptera: Thripidae) adult and larval settling and oviposition on onion (Allium cepa L.) foliage were investigated in relation to leaf position and leaf length at prebulb plant growth stages under controlled conditions. In the laboratory, four and six adult females of T. tabaci were released on onion plants at three-leaf stage and six- to eight-leaf stage, respectively, and thrips egg, nymph, and adult count data were collected on each of the three inner most leaves at every 2-cm leaf segment. Thrips settling and oviposition parameters were quantified during the light period on the above ground portion of onion plants from the distal end of the bulb or leaf sheath "neck" through the tips of the foliage. Results from studies confirmed that distribution of thrips adults, nymphs, and eggs were skewed toward the base of the plant. The settling distributions of thrips adults and nymphs differed slightly from the egg distribution in that oviposition occurred all the way to the tip of the leaf while adults and nymphs were typically not observed near the tip. In a field study, the foliage was divided into three equal partitions, i.e., top, middle, basal thirds, and thrips adults by species, primarily Frankliniella fusca (Hinds) and T. tabaci, were collected from each partition to determine if there was a similar bias of all adult thrips toward the base of the plant. The results suggested that adults of different species appear to segregate along leaf length. Finally, thrips oviposition on 2-cm segments and Iris yellow spot virus positive leaf segments were quantified in the field, irrespective of thrips species. Both variables demonstrated a very similar pattern of bias toward the base of the plant and were significantly correlated.

Host plant resistance against tomato spotted wilt virus in peanut (Arachis hypogaea) and its impact on susceptibility to the virus, virus population genetics, and vector feeding behavior and survival.

Tomato spotted wilt virus (TSWV) severely affects peanut production in the southeastern United States. Breeding efforts over the last three decades resulted in the release of numerous peanut genotypes with field resistance to TSWV. The degree of field resistance in these genotypes has steadily increased over time, with recently released genotypes exhibiting a higher degree of field resistance than older genotypes. However, most new genotypes have never been evaluated in the greenhouse or laboratory against TSWV or thrips, and the mechanism of resistance is unknown. In this study, TSWV-resistant and -susceptible genotypes were subjected to TSWV mechanical inoculation. The incidence of TSWV infection was 71.7 to 87.2%. Estimation of TSWV nucleocapsid (N) gene copies did not reveal significant differences between resistant and susceptible genotypes. Parsimony and principal component analyses of N gene nucleotide sequences revealed inconsistent differences between virus isolates collected from resistant and susceptible genotypes and between old (collected in 1998) and new (2010) isolates. Amino acid sequence analyses indicated consistent differences between old and new isolates. In addition, we found evidence for overabundance of nonsynonymous substitutions. However, there was no evidence for positive selection. Purifying selection, population expansion, and differentiation seem to have influenced the TSWV populations temporally rather than positive selection induced by host resistance. Choice and no-choice tests indicated that resistant and susceptible genotypes differentially affected thrips feeding and survival. Thrips feeding and survival were suppressed on some resistant genotypes compared with susceptible genotypes. These findings reveal how TSWV resistance in peanut could influence evolution, epidemiology, and management of TSWV.

Begomovirus Transmission to Tomato Plants Is Not Hampered by Plant Defenses Induced by Dicyphus hesperus Knight.

Plants can respond to insect infestation and virus infection by inducing plant defenses, generally mediated by phytohormones. Moreover, plant defenses alter host quality for insect vectors with consequences for the spread of viruses. In agricultural settings, other organisms commonly interact with plants, thereby inducing plant defenses that could affect plant-virus-vector interactions. For example, plant defenses induced by omnivorous insects can modulate insect behavior. This study focused on tomato yellow leaf curl virus (TYLCV), a plant virus of the family Geminiviridae and genus Begomovirus. It is transmitted in a persistent circulative manner by the whitefly Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae), posing a global threat to tomato production. Mirids (Hemiptera: Miridae) are effective biological control agents of B. tabaci, but there is a possibility that their omnivorous nature could also interfere with the process of virus transmission. To test this hypothesis, this study first addressed to what extent the mirid bug Dicyphus hesperus Knight induces plant defenses in tomato. Subsequently, the impact of this plant-omnivore interaction on the transmission of TYLCV was evaluated. Controlled cage experiments were performed in a greenhouse setting to evaluate the impact of mirids on virus transmission and vector acquisition by B. tabaci. While we observed a reduced number of whiteflies settling on plants exposed to D. hesperus, the plant defenses induced by the mirid bug did not affect TYLCV transmission and accumulation. Additionally, whiteflies were able to acquire comparable amounts of TYLCV on mirid-exposed plants and control plants. Overall, the induction of plant defenses by D. hesperus did not influence TYLCV transmission by whiteflies on tomato.

Aphid gene expression following polerovirus acquisition is host species dependent.

Upon acquisition of persistent circulative viruses such as poleroviruses, the virus particles transcytose through membrane barriers of aphids at the midgut and salivary glands via hemolymph. Such intricate interactions can influence aphid behavior and fitness and induce associated gene expression in viruliferous aphids. Differential gene expression can be evaluated by omics approaches such as transcriptomics. Previously conducted aphid transcriptome studies used only one host species as the source of virus inoculum. Viruses typically have alternate hosts. Hence, it is not clear how alternate hosts infected with the same virus isolate alter gene expression in viruliferous vectors. To address the question, this study conducted a transcriptome analysis of viruliferous aphids that acquired the virus from different host species. A polerovirus, cotton leafroll dwarf virus (CLRDV), which induced gene expression in the cotton aphid, Aphis gossypii Glover, was assessed using four alternate hosts, viz., cotton, hibiscus, okra, and prickly sida. Among a total of 2,942 differentially expressed genes (DEGs), 750, 310, 1,193, and 689 genes were identified in A. gossypii that acquired CLRDV from infected cotton, hibiscus, okra, and prickly sida, respectively, compared with non-viruliferous aphids that developed on non-infected hosts. A higher proportion of aphid genes were overexpressed than underexpressed following CLRDV acquisition from cotton, hibiscus, and prickly sida. In contrast, more aphid genes were underexpressed than overexpressed following CLRDV acquisition from okra plants. Only four common DEGs (heat shock protein, juvenile hormone acid O-methyltransferase, and two unannotated genes) were identified among viruliferous aphids from four alternate hosts. Gene ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations indicated that the acquisition of CLRDV induced DEGs in aphids associated with virus infection, signal transduction, immune systems, and fitness. However, these induced changes were not consistent across four alternate hosts. These data indicate that alternate hosts could differentially influence gene expression in aphids and presumably aphid behavior and fitness despite being infected with the same virus isolate.

Second generation peanut genotypes resistant to thrips-transmitted tomato spotted wilt virus exhibit tolerance rather than true resistance and differentially affect thrips fitness.

Spotted wilt disease caused by Tomato spotted wilt virus (TSWV) (family Bunyaviridae; genus Tospovirus) is a major constraint to peanut (Arachis hypogaea L.) production in the southeastern United States. Reducing yield losses to TSWV has heavily relied on planting genotypes that reduce the incidence of spotted wilt disease. However, mechanisms conferring resistance to TSWV have not been identified in these genotypes. Furthermore, no information is available on how these genotypes influence thrips fitness. In this study, we investigated the effects of newly released peanut genotypes (Georganic, GA-06G, Tifguard, and NC94022) with field resistance to TSWV and a susceptible genotype (Georgia Green) on tobacco thrips, Frankliniella fusca (Hinds), fitness, and TSWV incidence. Thrips-mediated transmission resulted in TSWV infection in both TSWV-resistant and susceptible genotypes and they exhibited typical TSWV symptoms. However, some resistant genotypes had reduced viral loads (fewer TSWV N-gene copies) than the susceptible genotype. F. fusca larvae acquired TSWV from resistant and susceptible genotypes indicating that resistant genotypes also can serve as inoculum sources. Unlike resistant genotypes in other crops that produce local lesions (hypersensitive reaction) upon TSWV infection, widespread symptom development was noticed in peanut genotypes. Results indicated that the observed field resistance in peanut genotypes could be because of tolerance. Further, fitness studies revealed some, but not substantial, differences in thrips adult emergence rates and developmental time between resistant and susceptible genotypes. Thrips head capsule length and width were not different when reared on different genotypes.

Sida Golden Mosaic Virus, an Emerging Pathogen of Snap Bean (Phaseolus vulgaris L.) in the Southeastern United States.

Sida golden mosaic virus (SiGMV) was first detected from snap bean (Phaseolus vulgaris L.) in Florida in 2006 and recently in Georgia in 2018. Since 2018, it has caused significant economic losses to snap bean growers in Georgia. This study, using a SiGMV isolate field-collected from prickly sida (Sida spinosa L.), examined the putative host range, vector-mediated transmission, and SiGMV-modulated effects on host-vector interactions. In addition, this study analyzed the phylogenetic relationships of SiGMV with other begomoviruses reported from Sida spp. Host range studies confirmed that SiGMV can infect seasonal crops and perennial weed species such as snap bean, hollyhock (Alcea rosea L.), marsh mallow (Althaea officinalis L.), okra (Abelmoschus esculentus (L.) Moench), country mallow (Sida cordifolia L.), prickly sida (S. spinosa), and tobacco (Nicotiana tabacum L.). The incidence of infection ranged from 70 to 100%. SiGMV-induced symptoms and virus accumulation varied between hosts. The vector, Bemisia tabaci Gennadius, was able to complete its life cycle on all plant species, irrespective of SiGMV infection status. However, SiGMV infection in prickly sida and country mallow positively increased the fitness of whiteflies, whereas SiGMV infection in okra negatively influenced whitefly fitness. Whiteflies efficiently back-transmitted SiGMV from infected prickly sida, hollyhock, marsh mallow, and okra to snap bean, and the incidence of infection ranged from 27 to 80%. Complete DNA-A sequence from this study shared 97% identity with SiGMV sequences reported from Florida and it was determined to be closely related with sida viruses reported from the New World. These results suggest that SiGMV, a New World begomovirus, has a broad host range that would allow its establishment in the farmscapes/landscapes of the southeastern United States and is an emerging threat to snap bean and possibly other crops.

Characterizing the vector competence of Aphis gossypii, Myzus persicae and Aphis craccivora (Hemiptera: Aphididae) to transmit cotton leafroll dwarf virus to cotton in the United States.

Cotton leafroll dwarf virus (CLRDV) is a yield-limiting, aphid-transmitted virus that was identified in cotton, Gossypium hirsutum L., in the United States of America in 2017. CLRDV is currently classified in the genus Polerovirus, family Solemoviridae. Although 8 species of aphids (Hemiptera: Aphididae) are reported to infest cotton, Aphis gossypii Glover is the only known vector of CLRDV to this crop. Aphis gossypii transmits CLRDV in a persistent and nonpropagative manner, but acquisition and retention times have only been partially characterized in Brazil. The main objectives of this study were to characterize the acquisition access period, the inoculation access period, and retention times for a U.S. strain of CLRDV and A. gossypii population. A sub-objective was to test the vector competence of Myzus persicae Sulzer and Aphis craccivora Koch. In our study, A. gossypii apterous and alate morphs were able to acquire CLRDV in 30 min and 24 h, inoculate CLRDV in 45 and 15 min, and retain CLRDV for 15 and 23 days, respectively. Neither M. persicae nor A. craccivora acquired or transmitted CLRDV to cotton.

Evaluation of Wild Peanut Species and Their Allotetraploids for Resistance against Thrips and Thrips-Transmitted Tomato Spotted Wilt Orthotospovirus (TSWV).

Thrips-transmitted tomato spotted wilt orthotospovirus (TSWV) causes spotted wilt disease in peanut (Arachis hypogaea L.) and limits yield. Breeding programs have been developing TSWV-resistant cultivars, but availability of sources of resistance against TSWV in cultivated germplasm is extremely limited. Diploid wild Arachis species can serve as important sources of resistance, and despite ploidy barriers (cultivated peanut is tetraploid), their usage in breeding programs is now possible because of the knowledge and development of induced interspecific allotetraploid hybrids. This study screened 10 wild diploid Arachis and six induced allotetraploid genotypes via thrips-mediated TSWV transmission assays and thrips' feeding assays in the greenhouse. Three parameters were evaluated: percent TSWV infection, virus accumulation, and temporal severity of thrips feeding injury. Results indicated that the diploid A. stenosperma accession V10309 and its derivative-induced allotetraploid ValSten1 had the lowest TSWV infection incidences among the evaluated genotypes. Allotetraploid BatDur1 had the lowest thrips-inflicted damage at each week post thrips release, while diploid A. batizocoi accession K9484 and A. duranensis accession V14167 had reduced feeding damage one week post thrips release, and diploids A. valida accession GK30011 and A. batizocoi had reduced feeding damage three weeks post thrips releasethan the others. Overall, plausible TSWV resistance in diploid species and their allotetraploid hybrids was characterized by reduced percent TSWV infection, virus accumulation, and feeding severity. Furthermore, a few diploids and tetraploid hybrids displayed antibiosis against thrips. These results document evidence for resistance against TSWV and thrips in wild diploid Arachis species and peanut-compatible-induced allotetraploids.

Effects of Host Plants and Their Infection Status on Acquisition and Inoculation of A Plant Virus by Its Hemipteran Vector.

Whitefly, Bemisia tabaci Gennadius (B cryptic species), transmits cucurbit leaf crumple virus (CuLCrV) in a persistent fashion. CuLCrV affects several crops such as squash and snap bean in the southeastern United States. CuLCrV is often found as a mixed infection with whitefly transmitted criniviruses, such as cucurbit yellow stunting disorder virus (CYSDV) in hosts such as squash, or as a single infection in hosts such as snap bean. The implications of different host plants (inoculum sources) with varying infection status on CuLCrV transmission/epidemics is not clear. This study conducted a series of whitefly mediated CuLCrV transmission experiments. In the first experiment, three plants species: squash, snap bean, and tobacco were inoculated by whiteflies feeding on field-collected mixed-infected squash plants. In the second experiment, three plant species, namely squash, snap bean, and tobacco with varying infection status (squash infected with CuLCrV and CYSDV and snap bean and tobacco infected with CuLCrV), were used as inoculum sources. In the third experiment, squash plants with differential CuLCrV accumulation levels and infection status (either singly infected with CuLCrV or mixed infected with CuLCrV and CYSDV) were used as inoculum sources. Irrespective of plant species and its infection status, CuLCrV accumulation in whiteflies was dependent upon the CuLCrV accumulation in the inoculum source plants. Furthermore, differential CuLCrV accumulation in whiteflies resulted in differential transmission, CuLCrV accumulation, and disease phenotype in the recipient squash plants. Overall, results demonstrate that whitefly mediated CuLCrV transmission between host plants follows a virus density dependent phenomenon with implications for epidemics.

Use of Insect Exclusion Row Cover and Reflective Silver Plastic Mulching to Manage Whitefly in Zucchini Production.

The challenges that sweet potato whitefly (Bemisia tabaci) creates for vegetable production have increased in the southeastern U.S. Growers must use intensive insecticide spray programs to suppress extremely high populations during the fall growing season. Thus, the objective of this study was to evaluate the use of a reflective plastic mulch and an insect row cover as alternative methods to the current grower practices to manage whiteflies in zucchini (Cucurbita pepo) production. Field experiments were conducted with a two-level factorial experimental design of cover and plastic mulch treatments arranged in a randomized complete block design, with four replications in Georgia in 2020 and 2021, and in Alabama in 2021. Cover treatments consisted of an insect row cover installed on zucchini beds at transplanting and removed at flowering and a no-cover treatment, while plastic mulch treatments consisted of reflective silver plastic mulching and white plastic mulching. During all growing seasons, weather conditions were monitored, whitefly populations were sampled weekly, zucchini biomass accumulation was measured at five stages of crop development, and fruit yield was determined at harvesting. Warm and dry weather conditions early in the growing season resulted in increased whitefly populations, regardless of location and year. In general, the reflective silver plastic mulching reduced whitefly populations compared to the conventional white plastic by 87% in Georgia in 2020, 33% in Georgia in 2021, and 30% in Alabama in 2021. The insect row cover treatment reduced whitefly populations to zero until its removal. Consequently, zucchini plants grown with the insect row cover and reflective silver plastic mulching had an increased rate of biomass accumulation due to the lower insect pressure in all locations. Zucchini grown using silver reflective plastic mulch and row covers had an overall increase of 17% and 14% in total yield compared to white plastic mulch and no-cover treatments, respectively. Significant differences in yield among locations were likely due to severe whitefly pressure early in the fall season, and total yields in Georgia in 2020 (11,451 kg ha-1) were 25% lower than in Georgia in 2021 (15,177 kg ha-1) and in Alabama in 2021 (15,248 kg ha-1). In conclusion, silver plastic mulching and row covers reduced the whitefly population and increased biomass accumulation and total yield. These treatments can be considered ready-to-use integrated pest management practices for growers.