Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 26
Filtrar
1.
J Am Chem Soc ; 2024 Aug 13.
Artigo em Inglês | MEDLINE | ID: mdl-39137918

RESUMO

Alkyl organoborons are powerful materials for the construction of C(sp3)-C(sp2) bonds, predominantly via Suzuki-Miyaura cross-coupling. These species are generally assembled using 2-electron processes that harness the ability of boron reagents to act as both electrophiles and nucleophiles. Herein, we demonstrate an alternative borylation strategy based on the reactivity of amine-ligated boryl radicals. This process features the use of a carboxylic acid containing amine-ligated borane that acts as boryl radical precursor for photoredox oxidation and decarboxylation. The resulting amine-ligated boryl radical undergoes facile addition to styrenes and imines through radical-polar crossover manifolds. This delivers a new class of sp3-organoborons that are stable solids and do not undergo protodeboronation. These novel materials include unprotected α-amino derivatives that are generally unstable. Crucially, these aliphatic organoboron species can be directly engaged in Suzuki-Miyaura cross-couplings with structurally complex aryl halides. Preliminary studies suggest that they enable slow-release of the corresponding and often difficult to handle alkyl boronic acids.

2.
J Am Chem Soc ; 145(50): 27810-27820, 2023 Dec 20.
Artigo em Inglês | MEDLINE | ID: mdl-38059920

RESUMO

Bicyclic amines are important motifs for the preparation of bioactive materials. These species have well-defined exit vectors that enable accurate disposition of substituents toward specific areas of chemical space. Of all possible skeletons, the 2-azabicyclo[3.2.0]heptane framework is virtually absent from MedChem libraries due to a paucity of synthetic methods for its preparation. Here, we report a modular synthetic strategy that utilizes nitroarenes as flat and easy-to-functionalize feedstocks for the assembly of these sp3-rich materials. Mechanistically, this approach exploits two concomitant photochemical processes that sequentially ring-expand the nitroarene into an azepine and then fold it into a rigid bicycle pyrroline by means of singlet nitrene-mediated nitrogen insertion and excited-state-4π electrocyclization. A following hydrogenolysis provides, with full diastereocontrol, the desired bicyclic amine derivatives whereby the aromatic substitution pattern has been translated into the one of the three-dimensional heterocycle. These molecules can be considered rigid pyrrolidine analogues with a well-defined orientation of their substituents. Furthermore, unsupervised clustering of an expansive virtual database of saturated N-heterocycles revealed these derivatives as effective isosteres of rigidified piperidines. Overall, this platform enables the conversion of nitroarene feedstocks into complex sp3-rich heterocycles of potential interest to drug development.

3.
Angew Chem Int Ed Engl ; 62(25): e202301656, 2023 Jun 19.
Artigo em Inglês | MEDLINE | ID: mdl-37016798

RESUMO

Phenols are integral aromatic molecules widely encountered in the structure of natural products and routinely utilised for the synthesis of high-value materials. Accessing highly substituted derivatives can often be difficult, especially when their functionalization pattern does not match the intrinsic reactivity leveraged by electrophilic aromatic substitution (SE Ar) chemistry. Here, we provide an alternative and mechanistically distinct approach for phenol synthesis using saturated cyclohexanone precursors. This process operates at ambient temperature, under simple purple light irradiation, and features a dual catalytic manifold carrying four sequential H-atom transfer processes.


Assuntos
Cicloexanonas , Fenóis , Fenóis/química , Cicloexanonas/química , Cobalto , Catálise
4.
Angew Chem Int Ed Engl ; 60(49): 25680-25687, 2021 12 01.
Artigo em Inglês | MEDLINE | ID: mdl-34558788

RESUMO

Methods for establishing the absolute configuration of sulfur-stereogenic aza-sulfur derivatives are scarce, often relying on cumbersome protocols and a limited pool of enantioenriched starting materials. We have addressed this by exploiting, for the first time, a feature of sulfonimidamides in which it is possible for tautomeric structures to also be enantiomeric. Such sulfonimidamides can readily generate prochiral ions, which we have exploited in an enantioselective alkylation process. Selectivity is achieved using a readily prepared bis-quaternized phase-transfer catalyst. The overall process establishes the capability of configurationally labile aza-sulfur species to be used in asymmetric catalysis.

5.
J Am Chem Soc ; 142(36): 15445-15453, 2020 09 09.
Artigo em Inglês | MEDLINE | ID: mdl-32841007

RESUMO

Sulfoximines and sulfonimidamides are promising compounds for medicinal and agrochemistry. As monoaza analogues of sulfones and sulfonamides, respectively, they combine good physicochemical properties, high stability, and the ability to build complexity from a three-dimensional core. However, a lack of quick and efficient methods to prepare these compounds has hindered their uptake in molecule discovery programmes. Herein, we describe a unified, one-pot approach to both sulfoximines and sulfonimidamides, which exploits the high electrophilicity of sulfinyl nitrenes. We generate these rare reactive intermediates from a novel sulfinylhydroxylamine (R-O-N=S=O) reagent through an N-O bond fragmentation process. Combining sulfinyl nitrenes with carbon and nitrogen nucleophiles enables the synthesis of sulfoximines and sulfonimidamides in a reaction time of just 15 min. Alkyl, (hetero)aryl, and alkenyl organometallic reagents can all be used as the first or second component in the reaction, while primary and secondary amines, and anilines, all react with high efficiency as the second nucleophile. The tolerance of the reaction to steric and electronic factors has allowed for the synthesis of the most diverse set of sulfoximines and sulfonimidamides yet described. Experimental and computational investigations support the intermediacy of sulfinyl nitrenes, with nitrene formation proceeding via a transient triplet intermediate before reaching a planar singlet species.

6.
Science ; 377(6612): 1323-1328, 2022 09 16.
Artigo em Inglês | MEDLINE | ID: mdl-36108027

RESUMO

The generation of carbon radicals by halogen-atom and group transfer reactions is generally achieved using tin and silicon reagents that maximize the interplay of enthalpic (thermodynamic) and polar (kinetic) effects. In this work, we demonstrate a distinct reactivity mode enabled by quantum mechanical tunneling that uses the cyclohexadiene derivative γ-terpinene as the abstractor under mild photochemical conditions. This protocol activates alkyl and aryl halides as well as several alcohol and thiol derivatives. Experimental and computational studies unveiled a noncanonical pathway whereby a cyclohexadienyl radical undergoes concerted aromatization and halogen-atom or group abstraction through the reactivity of an effective H atom. This activation mechanism is seemingly thermodynamically and kinetically unfavorable but is rendered feasible through quantum tunneling.

7.
ACS Catal ; 12(10): 6060-6067, 2022 May 20.
Artigo em Inglês | MEDLINE | ID: mdl-35633900

RESUMO

A plethora of drug molecules and agrochemicals contain the sulfonamide functional group. However, sulfonamides are seldom viewed as synthetically useful functional groups. To confront this limitation, a late-stage functionalization strategy is described, which allows sulfonamides to be converted to pivotal sulfonyl radical intermediates. This methodology exploits a metal-free photocatalytic approach to access radical chemistry, which is harnessed by combining pharmaceutically relevant sulfonamides with an assortment of alkene fragments. Additionally, the sulfinate anion can be readily obtained, further broadening the options for sulfonamide functionalization. Mechanistic studies suggest that energy-transfer catalysis (EnT) is in operation.

8.
Mutagenesis ; 26(2): 253-60, 2011 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-21068206

RESUMO

The ability to detect and quantify specific DNA adducts benefits genome stability research, drug development and the evaluation of environmental mutagens. The trapped in agarose DNA immunostaining (TARDIS) assay was developed as a means of detecting and quantifying melphalan and cisplatin DNA adducts at the single-cell level and has since been adapted to quantify topoisomerase-DNA complexes. The method relies on salt-detergent extraction of agarose-embedded cells. Genomic DNA and any covalently attached molecules remain in place in the agarose, while other cellular constituents are removed. Drug-DNA or topoisomerase-DNA complexes are then detected and quantified by sensitive immunofluorescence using adduct-specific antibodies. Here, we give a perspective of the TARDIS assay including a comparison with other methods for quantifying topoisomerase-DNA covalent complexes and provide technical details required to set up and perform the assay.


Assuntos
Adutos de DNA/análise , DNA/metabolismo , Sefarose/química , Adutos de DNA/metabolismo , DNA Topoisomerases/metabolismo , Imunofluorescência , Humanos , Reprodutibilidade dos Testes , Sensibilidade e Especificidade
9.
Org Lett ; 22(24): 9495-9499, 2020 12 18.
Artigo em Inglês | MEDLINE | ID: mdl-33237777

RESUMO

Sulfonamides have played a defining role in the history of drug development and continue to be prevalent today. In particular, primary sulfonamides are common in marketed drugs. Here we describe the direct synthesis of these valuable compounds from organometallic reagents and a novel sulfinylamine reagent, t-BuONSO. A variety of (hetero)aryl and alkyl Grignard and organolithium reagents perform well in the reaction, providing primary sulfonamides in good to excellent yields in a convenient one-step process.

10.
Inorg Chem ; 47(15): 6880-8, 2008 Aug 04.
Artigo em Inglês | MEDLINE | ID: mdl-18597414

RESUMO

The encapsulation of three platinum(II)-based anticancer complexes, [(5,6-dimethyl-1,10-phenanthroline)(1 S,2 S-diaminocyclohexane)platinum(II)] (2+) ( 56MESS), [(5,6-dimethyl-1,10-phenanthroline)(1 R,2 R-diaminocyclohexane)platinum(II)] (2+) ( 56MERR), and [(5,6-dimethyl-1,10-phenanthroline)(ethylenediamine)platinum(II)] (2+) ( 56MEEN), with carboxylated-beta-cyclodextrin (c-beta-CD) and p-sulfonatocalix[4]arene (s-CX[4]) has been examined by one- and two-dimensional (1)H nuclear magnetic resonance (NMR) spectroscopy, pulsed gradient spin-echo NMR, ultraviolet spectrophotometry, glutathione degradation experiments, and growth inhibition assays. Titration of any of the three metal complexes with c-beta-CD resulted in 1:1 encapsulation complexes with the cyclodextrin located over the intercalating ligand of the metal complexes, with a binding constant of 10 (4)-10 (5) M (-1). In addition to binding over the phenanthroline ligand of 56MEEN, c-beta-CD was also found to portal bind to the ethylenediamine ligand, with fast exchange kinetics on the NMR timescale between the two binding sites. In contrast, the three metal complexes all formed 2:2 inclusion complexes with s-CX[4] where the two metal complexes stacked in a head-to-tail configuration and were capped by the s-CX[4] molecules. Interestingly, the 56MEEN-s-CX[4] complex appeared to undergo a thermodynamically controlled rearrangement to a less soluble complex over time. Encapsulation of the metal complexes in either c-beta-CD or s-CX[4] significantly decreased the metal complexes' rate of diffusion, consistent with the formation of larger particle volumes. Encapsulation of 56MESS within s-CX[4] or c-beta-CD protected the metal complex from degradation by reduced L-glutathione, with a reaction half-life greater than 9 days. In vitro growth inhibition assays using the LoVo human colorectal cancer cell line showed no significant change in the cytotoxicity of 56MESS when encapsulated by either s-CX[4] or c-beta-CD.


Assuntos
Calixarenos/química , DNA/química , Substâncias Intercalantes/química , Compostos Organometálicos/química , Compostos Organometálicos/farmacologia , Fenóis/química , Platina/química , beta-Ciclodextrinas/química , Animais , Antineoplásicos/química , Antineoplásicos/metabolismo , Antineoplásicos/farmacologia , Cápsulas/química , Bovinos , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Difusão , Portadores de Fármacos/química , Glutationa/metabolismo , Humanos , Compostos Macrocíclicos/química , Espectroscopia de Ressonância Magnética , Compostos Organometálicos/metabolismo , Espectrofotometria Ultravioleta
11.
Nucleic Acids Res ; 33(10): 3283-91, 2005.
Artigo em Inglês | MEDLINE | ID: mdl-15944449

RESUMO

SJG-136, a pyrrolo[2,1-c][1,4]benzodiazepine (PBD) dimer, is a highly efficient interstrand crosslinking agent that reacts with guanine bases in a 5'-GATC-3' sequence in the DNA minor groove. SJG-136 crosslinks form rapidly and persist compared to those produced by conventional crosslinking agents such as nitrogen mustard, melphalan or cisplatin which bind in the DNA major groove. A panel of Chinese hamster ovary (CHO) cells with defined defects in specific DNA repair pathways were exposed to the bi-functional agents SJG-136 and melphalan, and to their mono-functional analogues mmy-SJG and mono-functional melphalan. SJG-136 was >100 times more cytotoxic than melphalan, and the bi-functional agents were much more cytotoxic than their respective mono-functional analogues. Cellular sensitivity of both SJG-136 and melphalan was dependent on the XPF-ERCC1 heterodimer, and homologous recombination repair factors XRCC2 and XRCC3. The relative level of sensitivity of these repair mutant cell lines to SJG-136 was, however, significantly less than with major groove crosslinking agents. In contrast to melphalan, there was no clear correlation between sensitivity to SJG-136 and crosslink unhooking capacity measured using a modified comet assay. Furthermore, repair of SJG-136 crosslinks did not involve the formation of DNA double-strand breaks. SJG-136 cytotoxicity is likely to result from the poor recognition of DNA damage by repair proteins resulting in the slow repair of both mono-adducts and more importantly crosslinks in the minor groove.


Assuntos
Antineoplásicos/toxicidade , Benzodiazepinonas/toxicidade , Reagentes de Ligações Cruzadas/toxicidade , Reparo do DNA , Proteínas de Ligação a DNA/fisiologia , Endonucleases/fisiologia , Melfalan/análogos & derivados , Pirróis/toxicidade , Recombinação Genética , Animais , Antineoplásicos/química , Benzodiazepinas/química , Benzodiazepinas/toxicidade , Benzodiazepinonas/química , Células CHO , Sobrevivência Celular , Cricetinae , Cricetulus , Reagentes de Ligações Cruzadas/química , Dano ao DNA , Melfalan/química , Melfalan/toxicidade , Pirróis/química
13.
Biochem Pharmacol ; 71(1-2): 13-20, 2005 Dec 19.
Artigo em Inglês | MEDLINE | ID: mdl-16293233

RESUMO

DNA-PK and ATM are members of the phosphatidylinositol 3'-kinase like kinase (PIKK) family of serine/threonine protein kinases and have critical roles in the cellular response to DNA double-strand breaks. Genetic loss of either activity leads to pronounced sensitivity to ionizing radiation (IR). Hence, these enzymes are potential targets to confer enhanced radiosensitivity on tumour cells. We show that novel inhibitors of either DNA-PK or ATM sensitize breast carcinoma cells to IR. Radiosensitization was accompanied by an apparent DNA repair deficit as measured by the persistence of IR-induced foci of phosphorylated histone H2AX (gammaH2AX foci). These specific inhibitors also allowed us to probe the biochemistry and kinetics of histone H2AX phosphorylation following gamma-irradiation in breast cancer cells with the aim of validating H2AX as a biomarker for DNA-PK or ATM inhibition in vivo. ATM inhibition reduced the initial average intensity of gammaH2AX foci while inhibition of DNA-PK had only a small effect on the initial phosphorylation of H2AX. However, simultaneous treatment with both compounds dramatically reduced gammaH2AX focus intensity, consistent with the reported role of ATM and DNA-PK in IR induced phosphorylation of H2AX.


Assuntos
Neoplasias da Mama/patologia , Proteínas de Ciclo Celular/antagonistas & inibidores , Proteína Quinase Ativada por DNA/antagonistas & inibidores , Proteínas de Ligação a DNA/antagonistas & inibidores , Inibidores Enzimáticos/farmacologia , Fármacos Fotossensibilizantes/farmacologia , Proteínas Serina-Treonina Quinases/antagonistas & inibidores , Radiação Ionizante , Radiossensibilizantes/farmacologia , Proteínas Supressoras de Tumor/antagonistas & inibidores , Proteínas Mutadas de Ataxia Telangiectasia , Neoplasias da Mama/enzimologia , Neoplasias da Mama/genética , Linhagem Celular Tumoral , Cromonas/farmacologia , Imunofluorescência , Humanos , Morfolinas/farmacologia , Pironas/farmacologia
14.
Biochem Pharmacol ; 70(12): 1717-25, 2005 Dec 05.
Artigo em Inglês | MEDLINE | ID: mdl-16259963

RESUMO

Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values = from 1 to >100 pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2-7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin-DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence.


Assuntos
Anticorpos Monoclonais/imunologia , Cisplatino/metabolismo , Adutos de DNA/análise , Cromatografia por Troca Iônica , Adutos de DNA/imunologia , Ensaio de Imunoadsorção Enzimática , Humanos , Oligodesoxirribonucleotídeos/imunologia
15.
Clin Cancer Res ; 10(20): 6830-9, 2004 Oct 15.
Artigo em Inglês | MEDLINE | ID: mdl-15501959

RESUMO

PURPOSE: A novel regimen designed to maximize antileukemia activity of carboplatin through inhibiting repair of platinum-DNA adducts was conducted in poor prognosis, acute leukemia patients. EXPERIMENTAL DESIGN: Patients received fludarabine (10 to 15 mg/m(2) x 5 days), carboplatin (area under the curve 10 to 12 by continuous infusion over 5 days), followed by escalated doses of topotecan infused over 72 hours (fludarabine, carboplatin, topotecan regimen). Twenty-eight patients had acute myelogenous leukemia (7 untreated secondary acute myelogenous leukemia, 11 in first relapse, and 10 in second relapse or refractory), 1 patient had refractory/relapsed acute lymphoblastic leukemia, and 2 patients had untreated chronic myelogenous leukemia blast crisis. Six patients had failed an autologous stem cell transplant. Patients ranged from 19 to 76 (median 54) years. Measurement of platinum-DNA adducts were done in serial bone marrow specimens. RESULTS: Fifteen of 31 patients achieved bone marrow aplasia. Clinical responses included 2 complete response, 4 complete response with persistent thrombocytopenia, and 2 partial response. Prolonged myelosuppression was observed with median time to blood neutrophils >/=200/microl of 28 (0 to 43) days and time to platelets >/=20,000/microl (untransfused) of 40 (24 to 120) days. Grade 3 or greater infections occurred in all of the patients, and there were 2 infection-related deaths. The nonhematologic toxicity profile was acceptable. Five patients subsequently received allografts without early transplant-related mortality. Maximum tolerated dose of fludarabine, carboplatin, topotecan regimen was fludarabine 15 mg/m(2) x 5, carboplatin area under the curve 12, and topotecan 2.55 mg/m(2) over 72 hours. An increase in bone marrow, platinum-DNA adduct formation between the end of carboplatin infusion and 48 hours after the infusion correlated with bone marrow response. CONCLUSIONS: Fludarabine, carboplatin, topotecan regimen is a promising treatment based on potential pharmacodynamic interactions, which merits additional study in poor prognosis, acute leukemia patients.


Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/farmacocinética , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Leucemia Mieloide Aguda/tratamento farmacológico , Leucemia-Linfoma Linfoblástico de Células Precursoras/tratamento farmacológico , Vidarabina/análogos & derivados , Adulto , Idoso , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Carboplatina/administração & dosagem , Carboplatina/efeitos adversos , Carboplatina/farmacocinética , Adutos de DNA , Resistencia a Medicamentos Antineoplásicos , Feminino , Humanos , Infusões Intravenosas , Leucemia Mieloide Aguda/patologia , Masculino , Dose Máxima Tolerável , Pessoa de Meia-Idade , Leucemia-Linfoma Linfoblástico de Células Precursoras/patologia , Prognóstico , Recidiva , Topotecan/administração & dosagem , Topotecan/efeitos adversos , Topotecan/farmacocinética , Vidarabina/administração & dosagem , Vidarabina/efeitos adversos , Vidarabina/farmacocinética
16.
Biochem Pharmacol ; 63(10): 1807-15, 2002 May 15.
Artigo em Inglês | MEDLINE | ID: mdl-12034365

RESUMO

Idarubicin (IDA) is an anthracycline used during treatment of acute myelogenous leukaemia (AML) and is clinically important because of its potency and lipophilicity (compared to the related compounds daunorubicin and doxorubicin). These drugs target DNA topoisomerase II (topo II), a nuclear enzyme that regulates DNA topology. Topo II poisoning leads to the trapping of an intermediate in the enzyme's cycle termed the "cleavable complex." This study aims to increase understanding of drug interactions by use of the "TARDIS" (trapped in agarose DNA immunostaining) assay to measure drug-induced topo II cleavable complexes in individual cells treated with anthracyclines. Mammalian cells contain two isoforms of topo II (alpha and beta) and the TARDIS assay enables visualisation of isoform-specific complexes. Drug-treated cells were embedded in agarose, lysed and incubated with anti-topo II antibodies to microscopically detect topo IIalpha or beta complexes. Results for K562 cells (at clinically relevant concentrations) showed that IDA and idarubicinol, its metabolite, formed mainly topo IIalpha cleavable complexes, the level of which decreases at doses > 1 microM for IDA. Our data suggest that this decrease is due to catalytic inhibition by IDA at these doses. Doxorubicin formed low levels of topo IIalpha complexes and negligible topo IIbeta complexes. In cytotoxicity studies, IDA and idarubicinol were equipotent, but both were more potent than daunorubicin and doxorubicin. We showed for the first time that there was a persistent increase in levels of topo IIalpha cleavable complexes after removal of IDA, suggesting that its greater effectiveness may be associated with both the longevity and high levels of these complexes.


Assuntos
Antibióticos Antineoplásicos/farmacologia , DNA Topoisomerases Tipo II/metabolismo , Idarubicina/farmacologia , Domínio Catalítico/efeitos dos fármacos , DNA/efeitos dos fármacos , DNA/metabolismo , Daunorrubicina/farmacologia , Inibidores Enzimáticos/farmacologia , Imunofluorescência , Humanos , Células K562 , Leucemia/patologia , Inibidores da Topoisomerase II
17.
Cancer Chemother Pharmacol ; 53(2): 155-62, 2004 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-14504921

RESUMO

PURPOSE: DNA topoisomerase II (topo II) is an important cellular target for chemotherapeutic agents. Human cells have two isoforms of topo II (alpha and beta), and both are inhibited by the chemotherapeutic agents etoposide, amsacrine (mAMSA) and mitoxantrone. It is known that the cytotoxic importance of topo IIalpha or topo IIbeta drug-induced complexes differs depending on which drug is present. This study was designed to (a) assess isoform-specific formation and reversal of topo IIalpha and beta cleavable complexes, and (b) determine whether the cytotoxic importance of either isoform was related to differences in the longevity of the complexes. METHODS: Mouse embryonic fibroblasts (MEFs) were used to study the cellular response to the topo II poisons etoposide, mitoxantrone and mAMSA. The longevity of topo IIalpha and beta complexes was determined using the TARDIS assay. This immunofluorescence assay can differentiate between the topo II isoforms and thus allowed us to investigate the persistence and importance of topo IIalpha and beta complexes for the first time. RESULTS: In MEFs treated with etoposide, 50% of topo IIalpha complexes dissociated within 40 min whereas dissociation of topo IIbeta complexes took only 20 min. Disappearance of complexes was a slower process for mitoxantrone-treated cells. The time taken to reduce topo IIalpha and topo IIbeta cleavable complexes by 50% was 10 and 6 h, respectively. In contrast, mAMSA-stabilized topo IIalpha and topo IIbeta cleavable complexes were equally stable (dissociation within 15 min for both isoforms). These stability data were confirmed using an in vitro assay. CONCLUSIONS: We previously demonstrated that topo IIalpha is the major target for etoposide and mitoxantrone but that both topo IIalpha and topo IIbeta are important for mAMSA cytotoxicity. The longevity of the topo IIalpha and beta cleavable complexes shown here is therefore an important factor in determining the cytotoxic sensitivity of either isoform to these drugs.


Assuntos
Antineoplásicos/farmacologia , DNA Topoisomerases Tipo II/efeitos dos fármacos , Amsacrina/farmacologia , Animais , Antígenos de Neoplasias , Antineoplásicos Fitogênicos/farmacologia , DNA Topoisomerases Tipo II/química , DNA de Neoplasias/química , DNA de Neoplasias/efeitos dos fármacos , Proteínas de Ligação a DNA , Etoposídeo/farmacologia , Fibroblastos/enzimologia , Fluoresceína-5-Isotiocianato , Imunofluorescência , Corantes Fluorescentes , Meia-Vida , Isoenzimas/química , Isoenzimas/efeitos dos fármacos , Cinética , Camundongos , Mitoxantrona/farmacologia
18.
Biochem Pharmacol ; 83(1): 69-77, 2012 Jan 01.
Artigo em Inglês | MEDLINE | ID: mdl-22015635

RESUMO

Despite an increasing understanding of the molecular mechanisms by which platinum drug DNA adducts interact with cellular processes, the relationship between adduct formation in tumours and clinical response remains unclear. We have determined carboplatin-DNA adduct levels in biopsies removed from ovarian cancer patients following treatment. Reliability of DNA adduct measurements in tissues samples were assessed using experimental animals. Platinum-DNA adduct levels were measured using inductively coupled plasma mass spectrometry (ICP-MS) and plasma drug concentrations determined by atomic absorption spectrometry (AAS). Adduct levels in tissues and plasma pharmacokinetics were determined in Balb/c mice exposed to platinum drugs. Comparisons of adduct levels in tumour and normal tissue were made in nu/nu mice carrying human neuroblastoma xenografts. At 30 min post-cisplatin administration, adduct levels in DNA from kidney and liver were approximately 10- and 6-fold higher than spleen or tumour. By 60 min, levels in liver and kidney, but not spleen or tumour, had fallen considerably. Carboplatin showed high adduct levels only in kidney. Adduct levels in tumour xenografts were comparable to those induced in vitro with similar drug exposures. In clinical samples removed 6h after drug administration, adduct levels ranged from 1.9 to 4.3 and 0.2 to 3.6 nmol Pt/g DNA for tumour biopsies and peripheral blood mononuclear cells, respectively. No correlation was apparent between these two data sets. The present results demonstrate that reliable measurements of adducts in clinical tumours are feasible. Future results should provide insight into drug resistance.


Assuntos
Antineoplásicos/uso terapêutico , Carboplatina/metabolismo , Adutos de DNA/metabolismo , Neoplasias Ovarianas/tratamento farmacológico , Neoplasias Ovarianas/metabolismo , Idoso , Animais , Linhagem Celular Tumoral , Feminino , Humanos , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Nus , Pessoa de Meia-Idade , Neoplasias Ovarianas/patologia , Ensaios Antitumorais Modelo de Xenoenxerto/métodos
19.
Cancer Chemother Pharmacol ; 63(5): 889-901, 2009 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-18679685

RESUMO

PURPOSE: Previous in vitro cleavage data showed that XR11576 and XR5944 stabilised topoisomerase I and topoisomerase II complexes on DNA in a dose-dependent fashion. However, some studies indicated a possible topoisomerase-independent mechanism of action for these drugs. METHODS: Three methods, the TARDIS assay, immunoband depletion and the K(+)/SDS assay have been used to assess topoisomerase complex formation induced by XR11576 or XR5944 in human leukaemic K562 cells. RESULTS: TARDIS and immunoband depletion assays demonstrated that XR11576 and XR5944 induced complex formation for both topoisomerase I and topoisomerase II (alpha and beta) in a dose- and time-dependent manner, following exposure times of 24 and 48 h at concentrations of 1 or 10 microM. The K(+)/SDS assay showed the formation of protein/DNA complexes after a 1 h exposure to 1 or 10 muM XR11576. CONCLUSION: Our data confirm that XR11576 or XR5944 can form topoisomerase complexes, after long periods of exposure.


Assuntos
Dano ao DNA/efeitos dos fármacos , Fenazinas/farmacologia , Inibidores da Topoisomerase I , Inibidores da Topoisomerase II , Animais , Neoplasias da Mama/tratamento farmacológico , Neoplasias da Mama/metabolismo , Neoplasias da Mama/patologia , Células CHO , Células Cultivadas , Neoplasias Colorretais/tratamento farmacológico , Neoplasias Colorretais/metabolismo , Neoplasias Colorretais/patologia , Cricetinae , Cricetulus , Reparo do DNA/efeitos dos fármacos , DNA Topoisomerases Tipo I/química , DNA Topoisomerases Tipo I/metabolismo , DNA Topoisomerases Tipo II/química , DNA Topoisomerases Tipo II/metabolismo , Imunofluorescência , Histonas/genética , Histonas/metabolismo , Humanos , Imunoensaio , Células K562
20.
Biochem Pharmacol ; 77(10): 1586-92, 2009 May 15.
Artigo em Inglês | MEDLINE | ID: mdl-19426695

RESUMO

O(6)-Cyclohexylmethylguanine (NU2058) was developed as an inhibitor of CDK2 and was previously shown to potentiate cisplatin cytotoxicity in vitro. The aim of this study was to investigate the mechanism of cisplatin potentiation by NU2058. SQ20b, head and neck cancer cells were treated for 2h with NU2058 (100 microM) and then for a further 2h with cisplatin and NU2058. NU2058 increased cisplatin cytotoxicity, by clonogenic assay, with a dose modification factor (DMF) of 3.1. NU2058 increased total intracellular platinum levels 1.5-fold, and platinum-DNA adduct levels twofold. Furthermore, the cisplatin-DNA adducts formed were more toxic in the presence of NU2058. To investigate whether the effects of NU2058 on cisplatin adduct levels and toxicity were dependent on CDK2 activity, additional CDK2 inhibitors were tested. NU6230 (CDK2 IC(50) 18 microM) was equipotent to NU2058 (CDK2 IC(50) 17 microM) as a CDK2 inhibitor in cell-free and cell-based assays, yet did not potentiate cisplatin cytotoxicity. Furthermore, NU6102 was >1000-fold more potent than NU2058 as a CDK2 inhibitor (CDK2 IC(50) 5 nM) yet was no more active than NU2058 in potentiating cisplatin. NU2058 also potentiated melphalan (DMF 2.3), and monohydroxymelphalan (1.7), but not temozolomide or ionising radiation. Whilst NU2058 increased melphalan cytotoxicity, it did not increase melphalan-DNA adduct formation. These studies demonstrate that NU2058 alters the transport of cisplatin, causing more Pt-DNA adducts, as well as sensitizing cells to cisplatin- and melphalan-induced DNA damage. However, the effects of NU2058 are independent of CDK2 inhibition.


Assuntos
Antineoplásicos/farmacologia , Sobrevivência Celular/efeitos dos fármacos , Cisplatino/farmacologia , Quinase 2 Dependente de Ciclina/antagonistas & inibidores , Guanina/análogos & derivados , Inibidores de Proteínas Quinases/farmacologia , Antineoplásicos/metabolismo , Western Blotting , Linhagem Celular Tumoral , Cisplatino/metabolismo , Adutos de DNA/metabolismo , Sinergismo Farmacológico , Guanina/farmacologia , Humanos , Ensaio Tumoral de Célula-Tronco
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA