RESUMO
Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.
Assuntos
DNA , Conformação de Ácido Nucleico , Cinética , Motivos de Nucleotídeos , DNA/genética , DNA/química , Concentração de Íons de HidrogênioRESUMO
We have identified seven putative guanine quadruplexes (G4) in the RNA genome of tick-borne encephalitis virus (TBEV), a flavivirus causing thousands of human infections and numerous deaths every year. The formation of G4s was confirmed by biophysical methods on synthetic oligonucleotides derived from the predicted TBEV sequences. TBEV-5, located at the NS4b/NS5 boundary and conserved among all known flaviviruses, was tested along with its mutated variants for interactions with a panel of known G4 ligands, for the ability to affect RNA synthesis by the flaviviral RNA-dependent RNA polymerase (RdRp) and for effects on TBEV replication fitness in cells. G4-stabilizing TBEV-5 mutations strongly inhibited RdRp RNA synthesis and exhibited substantially reduced replication fitness, different plaque morphology and increased sensitivity to G4-binding ligands in cell-based systems. In contrast, strongly destabilizing TBEV-5 G4 mutations caused rapid reversion to the wild-type genotype. Our results suggest that there is a threshold of stability for G4 sequences in the TBEV genome, with any deviation resulting in either dramatic changes in viral phenotype or a rapid return to this optimal level of G4 stability. The data indicate that G4s are critical elements for efficient TBEV replication and are suitable targets to tackle TBEV infection.
Assuntos
Antivirais , Vírus da Encefalite Transmitidos por Carrapatos , Quadruplex G , Antivirais/farmacologia , Antivirais/uso terapêutico , Vírus da Encefalite Transmitidos por Carrapatos/efeitos dos fármacos , Vírus da Encefalite Transmitidos por Carrapatos/genética , Encefalite Transmitida por Carrapatos/tratamento farmacológico , Encefalite Transmitida por Carrapatos/genética , Humanos , Ligantes , RNA Viral/genética , RNA Polimerase Dependente de RNA/genéticaRESUMO
Non-canonical forms of nucleic acids represent challenging objects for both structure-determination and investigation of their potential role in living systems. In this work, we uncover a structure adopted by GA repetition locked in a parallel homoduplex by an i-motif. A series of DNA oligonucleotides comprising GAGA segment and C3 clip is analyzed by NMR and CD spectroscopies to understand the sequence-structure-stability relationships. We demonstrate how the relative position of the homopurine GAGA segment and the C3 clip as well as single-base mutations (guanine deamination and cytosine methylation) affect base pairing arrangement of purines, i-motif topology and overall stability. We focus on oligonucleotides C3GAGA and methylated GAGAC3 exhibiting the highest stability and structural uniformity which allowed determination of high-resolution structures further analyzed by unbiased molecular dynamics simulation. We describe sequence-specific supramolecular interactions on the junction between homoduplex and i-motif blocks that contribute to the overall stability of the structures. The results show that the distinct structural motifs can not only coexist in the tight neighborhood within the same molecule but even mutually support their formation. Our findings are expected to have general validity and could serve as guides in future structure and stability investigations of nucleic acids.
Assuntos
Repetições de Dinucleotídeos , Conformação de Ácido Nucleico , Purinas/química , Metilação de DNA , Espectroscopia de Ressonância Magnética , Oligonucleotídeos/químicaRESUMO
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Assuntos
Quadruplex G , Sequência de Bases , DNA/genética , Guanina , Regiões Promotoras GenéticasRESUMO
The formation of intercalated motifs (iMs) - secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.
Assuntos
DNA/química , Conformação de Ácido Nucleico , Motivos de Nucleotídeos , Pareamento de Bases , Sequência de Bases , Citosina/química , Citosina/metabolismo , DNA/metabolismo , Concentração de Íons de Hidrogênio , Cinética , TermodinâmicaRESUMO
i-Motif (iM) is a four stranded DNA structure formed by cytosine-rich sequences, which are often present in functionally important parts of the genome such as promoters of genes and telomeres. Using electronic circular dichroism and UV absorption spectroscopies and electrophoretic methods, we examined the effect of four naturally occurring DNA base lesions on the folding and stability of the iM formed by the human telomere DNA sequence (C3TAA)3C3T. The results demonstrate that the TAA loop lesions, the apurinic site and 8-oxoadenine substituting for adenine, and the 5-hydroxymethyluracil substituting for thymine only marginally disturb the formation of iM. The presence of uracil, which is formed by enzymatic or spontaneous deamination of cytosine, shifts iM formation towards substantially more acidic pH values and simultaneously distinctly reduces iM stability. This effect depends on the position of the damage sites in the sequence. The results have enabled us to formulate additional rules for iM formation.
Assuntos
DNA/química , Telômero/química , Adenina/análogos & derivados , Adenina/química , Citosina/química , Dano ao DNA , Humanos , Pentoxil (Uracila)/análogos & derivados , Pentoxil (Uracila)/química , Uracila/químicaRESUMO
Recently, we reported an inhibitory effect of guanine substitutions on the conformational switch from antiparallel to parallel quadruplexes (G4) induced by dehydrating agents. As a possible cause, we proposed a difference in the sensitivity of parallel and antiparallel quadruplexes to the guanine substitutions in the resulting thermodynamic stability. Reports on the influence of guanine substitutions on the biophysical properties of intramolecular parallel quadruplexes are rare. Moreover, such reports are often complicated by the multimerisation tendencies of parallel quadruplexes. To address this incomplete knowledge, we employed circular dichroism spectroscopy (CD), both as stopped-flow-assisted fast kinetics measurements and end-point measurements, accompanied by thermodynamic analyses, based on UV absorption melting profiles, and electrophoretic methods. We showed that parallel quadruplexes are significantly more sensitive towards guanine substitutions than antiparallel ones. Furthermore, guanine-substituted variants, which in principle might correspond to native genomic sequences, distinctly differ in their biophysical properties, indicating that the four guanines in each tetrad of parallel quadruplexes are not equal. In addition, we were able to distinguish by CD an intramolecular G4 from intermolecular ones resulting from multimerisation mediated by terminal tetrad association, but not from intermolecular G4s formed due to inter-strand Hoogsteen hydrogen bond formation. In conclusion, our study indicates significant variability in parallel quadruplex structures, otherwise disregarded without detailed experimental analysis.
Assuntos
Substituição de Aminoácidos , DNA/química , Guanina/química , Dicroísmo Circular , DNA/genética , Quadruplex G , Ligação de Hidrogênio , Modelos Moleculares , Conformação de Ácido Nucleico , TermodinâmicaRESUMO
Guanine quadruplexes, recently reported to form in vivo, represent a broad spectrum of non-canonical conformations of nucleic acids. The actual conformation might differ between water solutions and crowding or dehydrating solutions that better reflect the conditions in the cell. Here we show, using spectroscopic techniques, that most guanine substitutions prevent the conformational switch from antiparallel or hybrid forms to parallel ones when induced by dehydrating agents. The inhibitory effect does not depend on the position of the substitution, but, interestingly, on the type of substitution and, to some extent, on its destabilising potential. A parallel form might be induced in some cases by ligands such as N-methyl mesoporphyrin IX and even this ligand-induced switch is inhibited by guanine substitution. The ability or inability to have a conformation switch, based on actual conditions, might significantly influence potential conformation-dependent quadruplex interactions.
RESUMO
Ionizing radiation produces clustered damage to DNA which is difficult to repair and thus more harmful than single lesions. Clustered lesions have only been investigated in dsDNA models. Introducing the term 'clustered damage to G-quadruplexes' we report here on the structural effects of multiple tetrahydrofuranyl abasic sites replacing loop adenines (A/AP) and tetrad guanines (G/AP) in quadruplexes formed by the human telomere d[AG3(TTAG3)3] (htel-22) and d[TAG3(TTAG3)3TT] (htel-25) in K+ solutions. Single to triple A/APs increased the population of parallel strands in their structures by stabilizing propeller type loops, shifting the antiparallel htel-22 into hybrid or parallel quadruplexes. In htel-25, the G/APs inhibited the formation of parallel strands and these adopted antiparallel topologies. Clustered G/AP and A/APs reduced the thermal stability of the wild-type htel-25. Depending on position, A/APs diminished or intensified the damaging effect of the G/APs. Taken together, clustered lesions can disrupt the topology and stability of the htel quadruplexes and restrict their conformational space. These in vitro results suggest that formation of clustered lesions in the chromosome capping structure can result in the unfolding of existing G-quadruplexes which can lead to telomere shortening.
Assuntos
Adenina/química , DNA/química , Furanos/química , Quadruplex G , Encurtamento do Telômero , Telômero/ultraestrutura , Dicroísmo Circular , DNA/genética , Humanos , Modelos Moleculares , Ressonância Magnética Nuclear Biomolecular , Oligonucleotídeos/química , Soluções , Telômero/genéticaRESUMO
BACKGROUND: The DNA lesions, resulting from oxidative damage, were shown to destabilize human telomere four-repeat quadruplex and to alter its structure. Long telomere DNA, as a repetitive sequence, offers, however, other mechanisms of dealing with the lesion: extrusion of the damaged repeat into loop or shifting the quadruplex position by one repeat. METHODS: Using circular dichroism and UV absorption spectroscopy and polyacrylamide electrophoresis, we studied consequences of lesions at different positions of the model five-repeat human telomere DNA sequences on the structure and stability of their quadruplexes in sodium and in potassium. RESULTS: The repeats affected by lesion are preferentially positioned as terminal overhangs of the core quadruplex structurally similar to the four-repeat one. Forced affecting of the inner repeats leads to presence of variety of more parallel folds in potassium. In sodium the designed models form mixture of two dominant antiparallel quadruplexes whose population varies with the position of the affected repeat. The shapes of quadruplex CD spectra, namely the height of dominant peaks, significantly correlate with melting temperatures. CONCLUSION: Lesion in one guanine tract of a more than four repeats long human telomere DNA sequence may cause re-positioning of its quadruplex arrangement associated with a shift of the structure to less common quadruplex conformations. The type of the quadruplex depends on the loop position and external conditions. GENERAL SIGNIFICANCE: The telomere DNA quadruplexes are quite resistant to the effect of point mutations due to the telomere DNA repetitive nature, although their structure and, consequently, function might be altered.
Assuntos
Quadruplex G/efeitos dos fármacos , Estresse Oxidativo/genética , Telômero/química , Dicroísmo Circular , Guanina/química , Humanos , Conformação de Ácido Nucleico/efeitos dos fármacos , Mutação Puntual , Sequências Repetitivas de Ácido Nucleico/genética , Sódio/toxicidade , Espectroscopia de Luz Próxima ao Infravermelho , Telômero/efeitos dos fármacos , Telômero/genéticaRESUMO
There are two basic mechanisms that are associated with the maintenance of the telomere length, which endows cancer cells with unlimited proliferative potential. One mechanism, referred to as alternative lengthening of telomeres (ALT), accounts for approximately 10-15% of all human cancers. Tumours engaged in the ALT pathway are characterised by the presence of the single stranded 5'-C-rich telomeric overhang (C-overhang). This recently identified hallmark of ALT cancers distinguishes them from healthy tissues and renders the C-overhang as a clear target for anticancer therapy. We analysed structures of the 5'-C-rich and 3'-G-rich telomeric overhangs from human and Caenorhabditis elegans, the recently established multicellular in vivo model of ALT tumours. We show that the telomeric DNA from C. elegans and humans forms fundamentally different secondary structures. The unique structural characteristics of C. elegans telomeric DNA that are distinct not only from those of humans but also from those of other multicellular eukaryotes allowed us to identify evolutionarily conserved properties of telomeric DNA. Differences in structural organisation of the telomeric DNA between the C. elegans and human impose limitations on the use of the C. elegans as an ALT tumour model.
Assuntos
DNA/química , Evolução Molecular , Telômero/química , Animais , Caenorhabditis elegans/genética , Humanos , Conformação de Ácido NucleicoRESUMO
Retrotransposons with long terminal repeats (LTR) form a significant proportion of eukaryotic genomes, especially in plants. They have gag and pol genes and several regulatory regions necessary for transcription and reverse transcription. We searched for potential quadruplex-forming sequences (PQSs) and potential triplex-forming sequences (PTSs) in 18 377 full-length LTR retrotransposons collected from 21 plant species. We found that PQSs were often located in LTRs, both upstream and downstream of promoters from which the whole retrotransposon is transcribed. Upstream-located guanine PQSs were dominant in the minus DNA strand, whereas downstream-located guanine PQSs prevailed in the plus strand, indicating their role both at transcriptional and post-transcriptional levels. Our circular dichroism spectroscopy measurements confirmed that these PQSs readily adopted guanine quadruplex structures-some of them were paralell-stranded, while others were anti-parallel-stranded. The PQS often formed doublets at a mutual distance of up to 400 bp. PTSs were most abundant in 3'UTR (but were also present in 5'UTR). We discuss the potential role of quadruplexes and triplexes as the regulators of various processes participating in LTR retrotransposon life cycle and as potential recombination sites during post-insertional retrotransposon-based genome rearrangements.
Assuntos
DNA de Plantas/química , Quadruplex G , Retroelementos , Sequências Repetidas Terminais , Genoma de Planta , Análise de Sequência de DNARESUMO
Abasic (AP) lesions are the most frequent type of damages occurring in cellular DNA. Here we describe the conformational effects of AP sites substituted for 2'-deoxyadenosine in the first (ap7), second (ap13) or third (ap19) loop of the quadruplex formed in K(+) by the human telomere DNA 5'-d[AG3(TTAG3)3]. CD spectra and electrophoresis reveal that the presence of AP sites does not hinder the formation of intramolecular quadruplexes. NMR spectra show that the structural heterogeneity is substantially reduced in ap7 and ap19 as compared to that in the wild-type. These two (ap7 and ap19) sequences are shown to adopt the hybrid-1 and hybrid-2 quadruplex topology, respectively, with AP site located in a propeller-like loop. All three studied sequences transform easily into parallel quadruplex in dehydrating ethanol solution. Thus, the AP site in any loop region facilitates the formation of the propeller loop. Substitution of all adenines by AP sites stabilizes the parallel quadruplex even in the absence of ethanol. Whereas guanines are the major determinants of quadruplex stability, the presence or absence of loop adenines substantially influences quadruplex folding. The naturally occurring adenine-lacking sites in the human telomere DNA can change the quadruplex topology in vivo with potentially vital biological consequences.
Assuntos
Adenina/química , Dano ao DNA , Quadruplex G , Telômero/química , Guanina/química , Humanos , Modelos Moleculares , Ressonância Magnética Nuclear Biomolecular , Potássio/químicaRESUMO
In this study we have chosen a new approach and characterized three miRNAs (miR-23a, miR-34a and miR-320a) related to prostate cancer and head and neck cancer by spectral (circular dichroic and UV-absorption spectra) and electrochemical (voltammetry at graphite and mercury electrodes) methods. The spectral and voltammetric results, reflecting different nucleotide sequences of miRNAs, were complemented by the results of DNAs(U) having the same oligonucleotide sequences as miRNAs. The effect of the substitution of ribose for deoxyribose was shown and structural diversity was confirmed. The stability of RNA and DNA(U) was studied using CD and UV-absorption spectroscopy and melting points were calculated. MiRNA-320a with the highest content of guanine provided the highest melting point. With respect to the rapid progress of miRNA electrochemical sensors, our results will be useful for the research and development of sensitive, portable and time-efficient miRNA sensors, which will be able to diagnose cancer and other diseases.
Assuntos
Biomarcadores Tumorais/sangue , Dicroísmo Circular/métodos , Eletroquímica/métodos , Neoplasias de Cabeça e Pescoço/sangue , MicroRNAs/sangue , Espectroscopia Fotoeletrônica/métodos , Neoplasias da Próstata/sangue , Estudos de Casos e Controles , Feminino , Humanos , MasculinoRESUMO
Electrochemical methods, particularly when applied in connection with mercury-containing electrodes, are excellent tools for studying nucleic acids structure and monitoring structural transitions. We studied the effect of the length of the central (dG) n stretch (varying from 0 to 15 guanine residues) in 15-mer oligodeoxynucleotides (ODN, G0 to G15) on their electrochemical and interfacial behavior at mercury and carbon electrodes. The intensity of guanine oxidation signal at the carbon electrode (peak G(ox)) was observed to increase continuously with number of guanines between 0 and 15, with only a slight positive shift for ODNs with seven or more guanines in the central segment. Very different effects were observed when the peak G(HMDE) was measured at the mercury electrode. Intensity of the latter signal increased with number of guanines up to G5, and decreased sharply with further elongation of the (dG) n stretch. CD spectroscopy and electrophoresis experiments revealed formation of parallel intermolecular quadruplex structures for ODNs containing five or more G residues. Further measurements made by cyclic and alternating-current voltammetry revealed a strong influence of the ODN structure on their behavior at electrically charged surfaces.
Assuntos
DNA/química , Técnicas Eletroquímicas/métodos , Quadruplex G , Conformação de Ácido NucleicoRESUMO
DNA concentration has been recently suggested to be the reason why different arrangements are revealed for K(+)-stabilized human telomere quadruplexes by experimental methods requiring DNA concentrations differing by orders of magnitude. As Raman spectroscopy can be applied to DNA samples ranging from those accessible by absorption and CD spectroscopies up to extremely concentrated solutions, gels and even crystals; it has been used here to clarify polymorphism of a core human telomeric sequence G(3)(TTAG(3))(3) in the presence of K(+) and Na(+) ions throughout wide range of DNA concentrations. We demonstrate that the K(+)-structure of G(3)(TTAG(3))(3) at low DNA concentration is close to the antiparallel fold of Na(+)-stabilized quadruplex. On the increase of G(3)(TTAG(3))(3) concentration, a gradual transition from antiparallel to intramolecular parallel arrangement was observed, but only for thermodynamically equilibrated K(+)-stabilized samples. The transition is synergically supported by increased K(+) concentration. However, even for extremely high G(3)(TTAG(3))(3) and K(+) concentrations, an intramolecular antiparallel quadruplex is spontaneously formed from desalted non-quadruplex single-strand after addition of K(+) ions. Thermal destabilization or long dwell time are necessary to induce interquadruplex transition. On the contrary, Na(+)-stabilized G(3)(TTAG(3))(3) retains its antiparallel folding regardless of the extremely high DNA and/or Na(+) concentrations, thermal destabilization or annealing.
Assuntos
DNA/química , Quadruplex G , Telômero/química , Humanos , Potássio/química , Análise Espectral Raman , TemperaturaRESUMO
5-Hydroxymethylcytosine (5-hmC) was recently identified as a relatively frequent base in eukaryotic genomes. Its physiological function is still unclear, but it is supposed to serve as an intermediate in DNA de novo demethylation. Using X-ray diffraction, we solved five structures of four variants of the d(CGCGAATTCGCG) dodecamer, containing either 5-hmC or 5-methylcytosine (5-mC) at position 3 or at position 9. The observed resolutions were between 1.42 and 1.99 Å. Cytosine modification in all cases influences neither the whole B-DNA double helix structure nor the modified base pair geometry. The additional hydroxyl group of 5-hmC with rotational freedom along the C5-C5A bond is preferentially oriented in the 3' direction. A comparison of thermodynamic properties of the dodecamers shows no effect of 5-mC modification and a sequence-dependent only slight destabilizing effect of 5-hmC modification. Also taking into account the results of a previous functional study [Münzel et al. (2011) (Improved synthesis and mutagenicity of oligonucleotides containing 5-hydroxymethylcytosine, 5-formylcytosine and 5-carboxylcytosine. Chem. Eur. J., 17, 13782-13788)], we conclude that the 5 position of cytosine is an ideal place to encode epigenetic information. Like this, neither the helical structure nor the thermodynamics are changed, and polymerases cannot distinguish 5-hmC and 5-mC from unmodified cytosine, all these effects are making the former ones non-mutagenic.
Assuntos
5-Metilcitosina/química , Citosina/análogos & derivados , DNA de Forma B/química , Cátions/química , Cristalografia por Raios X , Citosina/química , Epigênese Genética , Modelos Moleculares , Termodinâmica , Água/químicaRESUMO
BACKGROUND: Transposable elements form a significant proportion of eukaryotic genomes. Recently, Lexa et al. (Nucleic Acids Res 42:968-978, 2014) reported that plant long terminal repeat (LTR) retrotransposons often contain potential quadruplex sequences (PQSs) in their LTRs and experimentally confirmed their ability to adopt four-stranded DNA conformations. RESULTS: Here, we searched for PQSs in human retrotransposons and found that PQSs are specifically localized in the 3'-UTR of LINE-1 elements, in LTRs of HERV elements and are strongly accumulated in specific regions of SVA elements. Circular dichroism spectroscopy confirmed that most PQSs had adopted monomolecular or bimolecular guanine quadruplex structures. Evolutionarily young SVA elements contained more PQSs than older elements and their propensity to form quadruplex DNA was higher. Full-length L1 elements contained more PQSs than truncated elements; the highest proportion of PQSs was found inside transpositionally active L1 elements (PA2 and HS families). CONCLUSIONS: Conservation of quadruplexes at specific positions of transposable elements implies their importance in their life cycle. The increasing quadruplex presence in evolutionarily young LINE-1 and SVA families makes these elements important contributors toward present genome-wide quadruplex distribution.
Assuntos
Elementos de DNA Transponíveis , Quadruplex G , Elementos Alu , Mapeamento Cromossômico , Retrovirus Endógenos , Genômica , Humanos , Elementos Nucleotídeos Longos e Dispersos , Sequências Repetitivas de Ácido NucleicoRESUMO
For mimicking macromolecular crowding of DNA quadruplexes, various crowding agents have been used, typically PEG, with quadruplexes of micromolar strand concentrations. Thermal and thermodynamic stabilities of these quadruplexes increased with the concentration of the agents, the rise depended on the crowder used. A different phenomenon was observed, and is presented in this article, when the crowder was the quadruplex itself. With DNA strand concentrations ranging from 3 µM to 9 mM, the thermostability did not change up to â¼2 mM, above which it increased, indicating that the unfolding quadruplex units were not monomolecular above â¼2 mM. The results are explained by self-association of the G-quadruplexes above this concentration. The ΔG(°) 37 values, evaluated only below 2 mM, did not become more negative, as with the non-DNA crowders, instead, slightly increased. Folding topology changed from antiparallel to hybrid above 2 mM, and then to parallel quadruplexes at high, 6-9 mM strand concentrations. In this range, the concentration of the DNA phosphate anions approached the concentration of the K(+) counterions used. Volume exclusion is assumed to promote the topological changes of quadruplexes toward the parallel, and the decreased screening of anions could affect their stability.
Assuntos
DNA/química , Quadruplex G , Telômero/química , Dicroísmo Circular , Densitometria , Eletroforese em Gel de Poliacrilamida , Entropia , Humanos , Microscopia de Força Atômica , Espectrofotometria UltravioletaRESUMO
Armadillo repeat-containing proteins (ARMCs) are a large family found throughout eukaryotes, which play prominent roles in cell adhesion, signaling and cytoskeletal regulation. The ARMC6 protein is highly conserved in primates, including humans, but to date does not have a clear function beyond initial hints of a link to cancer and telomerase activity. We report here in vitro experiments showing ARMC6 binding to DNA promoter sequences from several cancer-related genes (e.g., EGFR, VEGF and c-MYC), and also to the telomeric RNA repeat (TERRA). ARMC6 binding activity appears to recognize G-quadruplex motifs, which are being increasingly implicated as structure-based protein binding sites in chromosome maintenance and repair. In vivo investigation of ARMC6 function revealed that when this protein is overexpressed in human cell lines, there is different expression of genes connected with oncogenic pathways and those implicated in downstream non-canonical telomerase pathways (e.g., VEGF, hTERT, c-MYC, ESM1, MMP3). ARMC6 is already known to interact with human shelterin protein TRF2 and telomerase. The protein binds G-quadruplex structures and does so preferentially to RNA over DNA. As such, this protein may be an example of how a non-canonical nucleic acid structural motif allows mediation between gene regulation and telomeric chromatin rearrangement pathways.