RESUMO
To optimize the extraction process of crude polysaccharides from Atractylodes and elaborate the mechanism of Atractylodes polysaccharides in treating diarrhea owing to spleen deficiency, so as to lay a foundation for further development and utilization of Atractylodes lancea, we used an orthogonal test to optimize the extraction process and established a model of spleen deficiency. It was further combined with histopathology and intestinal flora to elaborate the mechanism of Atractylodes polysaccharides in the treatment of spleen-deficiency diarrhea. The optimized extraction conditions were as follows: the ratio of material to liquid was 1:25; the rotational speed was 150 rpm; the extraction temperature was 60°C; the extraction time was 2 h; and the extraction rate was about 23%. The therapeutic effect of Atractylodes polysaccharides on a spleen-deficiency diarrhea model in mice showed that the water content of stools and diarrhea grade in the treatment group were alleviated, and the levels of gastrin, motilin and d-xylose were improved. The analysis results based on gut microbiota showed that the model group had a higher diversity of gut microbiota than the normal group and treatment group, and the treatment group could correct the diversity of gut microbiota in model mice. Analysis based on the level of phylum and genus showed that the treatment group could inhibit the abundance of Helicobacter pylori genus and increase beneficial bacteria genera. The conclusion was that the optimized extraction process of Atractylodes polysaccharides was reasonable and feasible, and had a good therapeutic effect on spleen deficiency diarrhea.
Assuntos
Atractylodes , Microbioma Gastrointestinal , Camundongos , Animais , Baço , Atractylodes/química , Rizoma/química , Polissacarídeos , Diarreia/tratamento farmacológicoRESUMO
Hermetia illucens larvae showcases remarkable bioremediation capabilities for both antibiotics and heavy metal contaminants. However, the distinctions in larval intestinal microbiota arising from the single and combined effects of antibiotics and heavy metals remain poorly elucidated. In this study, we delved into the details of larval intestinal bacterial communities and microbial metabolites when exposed to single and combined contaminants of oxytetracycline (OTC) and hexavalent chromium (Cr(VI)). After conversion, single contaminant-spiked substrate showed 75.5% of OTC degradation and 95.2% of Cr(VI) reductiuon, while combined contaminant-spiked substrate exhibited 71.3% of OTC degradation and 93.4% of Cr(VI) reductiuon. Single and combined effects led to differences in intestinal bacterial communities, mainly reflected in the genera of Enterococcus, Pseudogracilibacillus, Gracilibacillus, Wohlfahrtiimonas, Sporosarcina, Lysinibacillus, and Myroide. Moreover, these effects also induced differences across various categories of microbial metabolites, which categorized into amino acid and its metabolites, benzene and substituted derivatives, carbohydrates and its metabolites, heterocyclic compounds, hormones and hormone-related compounds, nucleotide and its metabolites, and organic acid and its derivatives. In particular, the differences induced OTC was greater than that of Cr(VI), and combined effects increased the complexity of microbial metabolism compared to that of single contaminant. Correlation analysis indicated that the bacterial genera, Preudogracilibacillus, Enterococcus, Sporosarcina, Lysinibacillus, Wohlfahrtiimonas, Ignatzschineria, and Fusobacterium exhibited significant correlation with significant differential metabolites, these might be used as indicators for the resistance and bioremediation of OTC and Cr(VI) contaminants. These findings are conducive to further understanding that the metabolism of intestinal microbiota determines the resistance of Hermetia illucens to antibiotics and heavy metals.
Assuntos
Antibacterianos , Biodegradação Ambiental , Microbioma Gastrointestinal , Larva , Metais Pesados , Animais , Antibacterianos/farmacologia , Larva/efeitos dos fármacos , Larva/crescimento & desenvolvimento , Microbioma Gastrointestinal/efeitos dos fármacos , Bactérias/metabolismo , Bactérias/efeitos dos fármacos , Cromo/metabolismoRESUMO
Pinelliae rhizoma is the dried tuber of Pinellia ternata (Thunb.) Breit., and has been used for thousand of years in traditional Chinese medicine as an antivomit, anticough, and analgesic (Ying et al. 2007). In September 2022, P. ternata planted in Bijie, Guizhou Province, showed severe soft rot symptoms with incidence of about 50%. The diseased plants showed water-soaked symptoms and produced a foul soft rot smell, and finally the whole plant collapsed. Lesions were first observed at the tip of a leaf or wound, and symptoms of the disease spread rapidly, with the entire plant collapsing and dying within a week. The tissue sections of six plants with typical symptoms from the diseased field were disinfected with 75% ethanol for 30 seconds and 0.3% NaClO for 3 minutes. The tissue sections were then washed with sterile water for three times. A small piece of tissue (5x5mm) was removed from the edge of the lesion and mashed in a 1.5 ml centrifuge tube containing 20 µl of sterile water. The tissue liquid was then diluted 100 times with prepared sterile water. The bacteria were streaked on LB (tryptone/yeast extract/NaCl) AGAR medium and cultured at 37°C for 48 h (Kravitz, 1962). Isolated colonies were streaked on Luria-Bertani (LB) AGAR medium to obtain single colonies for further identification. A total of 13 representative isolates were selected for PCR amplification using primers targeting the conserved region of the 16S rDNA gene, which were in turn analyzed via the BLASTn search engine on the NCBI website. The results of the analysis revealed that seven of the isolates were similar to P. aroidearum strain SCRI 109 (GenBank accession no. NR_159926), with strain BX13 exhibiting the highest similarity to P. aroidearum (99.93% similarity), and therefore, this strain was selected for further investigation. The strain BX13 was incubated on LB solid medium for 24 h at 37 °C, and the single colonies were creamy white, translucent and round, slightly elevated in the center, with smooth surfaces and neat edges (Figure S1 B1). Then,the Scanning Electron Microscope revealed that the thalli of strain BX13 were short rod-shaped and somewhat blunt round at both ends (Figure S1 B2). The steward genes (icdA, gapA, proA) of BX13 were amplified and sequenced for further identification. The sequences of the amplified fragments were all deposited in GenBank 16S rDNA (OQ874505,) icdA (OQ954122)ï¼gapA (OQ954123), proA (OQ954124). Sequence analysis using the BLASTn program at the NCBI revealed gene icdA, gapA, and proA had 100% identity to P. aroidearum strain QJ002 (GenBank accession no. CP090597).. Meanwhile, a maximum likelihood phylogenetic tree was constructed based on multigene sequence analysis of BX13 16S rDNA and steward genes (gapA, icdA, proA) by MEGA X (Liang et al. 2022). Phylogenetic results also showed that BX13 and P. aroidearum strain QJ002 gathered in the same clade(Figure S2). Accordingly, the morphological and molecular characteristics of strain BX13 indicate that it is P. aroidearum. (Nabhan S., et al.2013,Xu et al. 2020). In order to confirm the pathogenicity of strain BX13, a bacterial suspension containing 107 CFU/ml (10 ml/ inoculation point) was injected into the base of a one-week-old P. ternata stems, control seedlings were inoculated with sterile water, inoculated and control seedlings (each of six plants) were kept in a growth chamber maintained at 26°C with a relative humidity range of 70% to 80%. Plants were watered as needed. After 3 days, the stem base of the plants inoculated with bacteria solution showed water-soaked necrosis and stems began to rot, while the plants inoculated with water did not show this symptom. The strains were then successfully re-isolated from the symptomatic P. ternata. Then the strain re-isolated was identified using the BLASTn program at the NCBI and found that it has the same 16S rDNA, icdA, gapA, and proA sequences as strain BX13, thus completing the Koch's postulates. To our knowledge, this is the first report of P. aroidearum causing P. ternata soft rot in China, which expands its known host range. Accordingly, this study provides essential information for the breeding of P. ternata resistant to bacterial soft rot and the development of control measures in China.
RESUMO
Astragalus mongholicus Bge. [A. membranaceus Bge. var. mongholicus (Bge.) Hsiao] is a highly valuable perennial medicinal plant mainly distributed in China, whose dry roots are known as Huangqi in traditional Chinese medicine for reinforcing vital energy, strengthening superficial resistance, and promoting tissue regeneration (Lin et al. 2000). A. mongholicus roots of high quality are produced in Northwest and North China. Since July 2021, powdery mildew outbreaks happened annually on the leaves of A. mongholicus in a plantation (123° 56' 40'' E, 47° 22' 20'' N) in Qiqihar city, Heilongjiang Province, China. Disease incidence reached 100% by October (Fig. 1A-C), causing severe impairment of growth. Powdery mildew spots of circular or irregular shapes emerged on upper surface of leaf, resulting in plentiful lesion specks. Dense white hyphae appeared chaotically intertwined. Hyphae were hyaline and highly flexuous, 5.3 - 10.7 µm in diameter (n = 20). Chasmothecia were globose or slightly ovoid-shaped and turned dark brown when matured. Chasmothecia (diameter: 135.2 - 222.9 µm, n = 20) existed abundantly on the diseased leaves in the fields. Conidiophores were 89.0 - 129.9 µm in length (n = 20) and composed of one cylindrical, straight foot cell, followed by two cells and one to three conidia. Conidia were slim ellipsoid-shaped, occasionally ovoid-shaped, measuring 14.6 - 24.7 µm by 6.4 to10.4 µm, length/width ratio was 1.8 - 3.0 (n = 30). Hyphal appressoria were nipple-shaped and appeared in singular, occasionally in pairs. Unbranched germ tube emerged reaching out of the germinating conidia while forming an acute angle with the long axis. Comprehensively, the pathogen exhibited micro-morphology of the genus Erysiphe. For molecular identification, pathogen was carefully scraped off diseased leaves for DNA extraction. We used the DNA samples of three biological replicates for the sequencing of the ITS rDNA fragment (primers by (White et al. 1990). All the samples resulted in an identical ITS sequence (deposited in GenBank as OQ390098.1). It displayed 99.83% identity with OP806835.1 of an E. astragali voucher collected in Iran (Fig. 1D-M, O). Hence, our pathogen was identified as an E. astragali stain. Additionally, we amplified the Mcm7 sequence (using primers by (Ellingham et al. 2019), deposited as OQ397582.1). We propagated 40-day-old A. mongholicus plants via germinating seeds in pot soil and performed pathogenicity tests. Firstly, we incubated detached healthy leaves of propagated plants with severely symptomatic leaves collected from the fields in petri dishes under saturated moisture content and room temperature. Powdery mildew symptoms emerged on each healthy leaf (n = 5) after two weeks. Further, we infected healthy plants (n = 5) by gently pressing and rubbing symptomatic leaves on each healthy leaf, and kept them in a greenhouse (24 â, 80% humidity, 16/8-hour light/dark cycle). After a month, symptoms emerged on a number of leaves of each infected plant. We performed micromorphology observation (Fig. 1N-P) and ITS sequencing to confirm that the results fulfilled Koch's postulates. Powdery mildew caused by E. astragali on A. strictus in Tibet (Wang and Jiang 2023) and on A. scaberrimus in Inner Mongolia (Sun et al. 2023) have been reported. Here we report powdery mildew caused by E. astragali on Astragalus mongholicus for the first time. These Astragalus spp. are all acknowledged to have medicinal values in China but their usages are quite different.
RESUMO
We previously described the discovery of a novel indole series compounds as oral SERD for ER positive breast cancer treatment. Further SAR exploration focusing on substitutions on indole moiety of compound 12 led to the discovery of a clinical candidate LX-039. We report herein its profound anti-tumor activity, desirable ER antagonistic characteristics combined with favorable pharmacokinetic and preliminary safety properties. LX-039 is currently in clinical trial (NCT04097756).
Assuntos
Neoplasias da Mama , Receptores de Estrogênio , Administração Oral , Neoplasias da Mama/tratamento farmacológico , Neoplasias da Mama/patologia , Ensaios Clínicos como Assunto , Receptor alfa de Estrogênio , Feminino , Humanos , Indóis/farmacologia , Indóis/uso terapêutico , Moduladores Seletivos de Receptor Estrogênico/farmacologiaRESUMO
Black soldier fly larvae (larvae) can digest organic wastes and degrade contaminants such as oxytetracycline (OTC). However, compared to the kinetic processes and enhanced mechanisms used in the traditional microbial degradation of OTC, those employed by larvae are largely uncharacterized. To obtain further details, a combined analysis of larval development, larval nutritional values (crude protein, crude fat and the composition of fatty acids) and the expression of tetracycline resistance genes (TRGs) in the larval gut was performed for the degradation of OTC added to substrates and for oxytetracycline bacterial residue (OBR). When the larvae were exposed to the substrates, the degradation processes were enhanced significantly (P < 0.01), with a 4.74-7.86-fold decrease in the degradation half-life (day-1) and a 3.34-5.74-fold increase in the final degradation efficiencies. This result was attributed to the abundant TRGs (with a detection rate of 35.90%â¼52.14%) in the larval gut. The TRGs presented the resistance mechanisms of cellular protection and efflux pumps, which ensured that the larvae could tolerate elevated OTC concentrations. Investigation of the TRGs indicated that enzymatic inactivation enhanced OTC degradation by larvae. These findings demonstrate that the larval degradation of antibiotic contaminants is an efficient method based on abundant TRGs in the larval gut, even though OTC degradation results in OBR. In addition, a more optimized system for higher reductions in antibiotic levels and the expansion of larval bioremediation to other fields is necessary.
Assuntos
Dípteros , Oxitetraciclina , Animais , Antibacterianos/farmacologia , Bactérias/genética , Larva , Tetraciclina/farmacologia , Resistência a Tetraciclina/genéticaRESUMO
Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L) â¯= 609.0⯠±â¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0 ⯱⯠28.6 µm (329.7 to 436.1 µm); stylet length â¯=⯠17.0 ⯱⯠1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =⯠3.3 ⯱⯠0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n⯠=⯠20) were measured (mean ± SD; range) as follows: L â¯=⯠401.2⯠±â¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W â¯= 28.6⯠±â¯ 1.0 (26.7 to 30.4); stylet length =⯠10.3 ⯱⯠0.6 µm (9.1 to 11.2 µm); DGO⯠=⯠2.4 ⯱⯠0.1 µm (2.1 to 2.6 µm); and tail length â¯= â¯49.3⯠± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.
RESUMO
Alpinia oxyphylla Miq. is mainly distributed in Hainan, Guangdong and Guangxi provinces of China. Between July and August 2021, a leaf spot disease was observed in Ledong, Hainan Province, China (18°70'20.50â³ N, 109°25'25.47â³E) on A.oxyphylla. The incidence of infected leaves ranged from 8% to 10%, and the incidence rate of infected plants was about 50%. Symptoms appeared as primary yellow-brown withered spots on the diseased leaves, which further developed into irregular red-brown spots. The center of the lesions was gray-black, and the tissue was irregularly necrotic, ruptured or perforated, and there were yellow chlorotic halos around the edges of the lesions (Figure 1A). Tissues 5 mm in diameter were taken from the junction of diseased and healthy tissue for pathogen isolation, Successively, a total of 8 isolates were obtained from the affected leaves. Three single spore isolates (YZ-HN-001, YZ-HN-043 and YZ-HN-051) were obtained and confirmed to be identical based on morphological characteristics. Therefore, the representative isolate YZ-HN-001 was selected for morphological and molecular identification. On Potato Dextrose Agar(PDA), the colony was gray-white at first and gradually turned dark green to dark brown with lead gray on the back, growth was slow, and mycelium was short and dense (Figure 1B and Figure 1C). Pycnidia were epiphyllous, globose, brown (about 120-140 µm in diameter), and conidia were elliptical, colorless, single celled and smooth (8-12×4-7 µm) (Figure 1D). Molecular identification was performed by partially sequencing the internal transcribed spacer gene (ITS), 18S rRNA gene and the actin gene (ACT) by using the primers ITS1/ITS4 (White et al. 1990), EF4/Fungi5 (Khodaparase et al. 2005) and ACT-512F/ACT-783R (Carbone and Kohn. 1999). The sequences of the amplified fragments were deposited in GenBank, the ITS sequence (ON005130, 616 bp) showed 100% identity with Phyllosticta capitalensis strain CGMCC3.14345 (JN791605.1), the 18S rRNA sequence (ON005129, 541 bp) showed 99% identity with P. capitalensis isolate MUCC0029 (AB454185.1) and the ACT sequence (ON049348, 251 bp) showed 100% identity with P. capitalensis strain DZSN202005-2 (MW533248.1). A phylogenetic analysis was conducted in MEGA X using the neighbor-joining method and showed that isolate YZ-HN-001 clustered together with P. capitalensis (Figure 2). Based on the above morphological and molecular characteristics, the isolate was determined to be P. capitalensis. Pathogenicity tests were conducted in three replicates by inoculating surface-sterilized leaves of A. oxyphylla. The leaves were wounded and inoculated with colonized PDA plugs (5×5 mm) from 15-day-old cultures. Control leaves wounded in the same way and were inoculated with sterile PDA plugs (5×5 mm). Leaves were moisturized by spraying with sterile water every three days. After 20 days at room temperature (23 to 28â), similar symptoms were observed in the inoculated leaves as in the field (Figure 1E), but no symptoms were observed on the control leaves (Figure 1F). The same P. capitalensis was reisolated in the inoculated leaves, confirming Koch's postulates. Phyllosticta capitalensis has been reported to cause leaf spots or black spots on various host plants around the world (Wikee et al. 2013), including on oil palm (Nasehi et al. 2020), tea plant (Cheng et al. 2019 ), and castor (Tang et al. 2020). Nevertheless, to our knowledge, this is the first report of leaf spot caused by P. capitalensis on A. oxyphylla worldwide.
RESUMO
INTRODUCTION: In addition to the mycotoxin swainsonine, the locoweed endophytic fungus Alternaria oxytropis (Pleosporaceae) also produces a series of rarely reported, highly oxygenated bicyclic guaiane sesquiterpenoids. Few investigations on the electrospray tandem mass fragmentation pattern of this sesquiterpenoid have been reported. OBJECTIVES: We aimed to analyze and detect new guaiane sesquiterpenoid analogues from crude extracts of the locoweed endophytic fungus A. oxytropis by UPLC-Q-TOF-MS/MS experiments. MATERIALS AND METHODS: Oxytropiols A-J (1-10) and the extract of the locoweed endophytic fungus A. oxytropis were analyzed by UPLC-Q-TOF-MS/MS in positive mode. RESULTS: Typical neutral losses, McLafferty rearrangement, 1,2-rearrangement, and 1,3-rearrangement were considered to be the main fragmentation patterns for the [M + H]+ /[M + Na]+ ions of 1-10 by UPLC-Q-TOF-MS/MS experiments, and possible fragmentation pathways of 1-10 were suggested. A unique and undescribed analogue named oxytropiol K (11) was found in the extract based on UPLC-Q-TOF-MS/MS analysis. Compound 11 was isolated and elucidated by NMR spectrometry, and its UPLC-Q-TOF-MS/MS analysis was consistent with the fragmentation pathways of 1-10. CONCLUSION: The results further support that UPLC-Q-TOF-MS/MS is a powerful and sensitive tool for the characterization of known compounds (dereplication) and the detection of new analogues from crude extracts and imply that the locoweed endophytic fungus A. oxytropis, with few chemical investigations, is an important resource for undescribed metabolites.
Assuntos
Oxytropis , Sesquiterpenos , Alternaria/química , Alternaria/metabolismo , Cromatografia Líquida de Alta Pressão , Oxytropis/microbiologia , Sesquiterpenos de Guaiano , Espectrometria de Massas em TandemRESUMO
In Hezhang county, Guizhou province, black spot tends to occur to Aconitum carmichaelii in the hot rainy summer, with the incidence up to 50%-70%, seriously impacting the yield and quality of the medicinal material. Thus, this study aims to clarify the pathogen and the occurrence characteristics. To be specific, the pathogen was isolated and identified according to Koch's postulates and the pathogenicity and biological characteristics were determined. In addition, the sensitivity of the pathogen to four microbial fungicides, four botanical fungicides, and five chemical fungicides was determined with the mycelium growth rate method for the purpose of screening out optimal fungicides. The pathogen was identified as Alternaria alternate, as evidenced by the similar colony morphology and microscopic characteristics and 99.55%-100% similarity in sequences of rDNA-ITS, LSU, 18S, and TEF of the two. The optimum growth conditions for A. alternata were 28 â, pH 8, and continuous darkness. Bacillus subtilis had strong inhibitory effect on the pathogen, and the inhibition rate was more than 90% when the concentration was 1 mg·L~(-1). In addition, difenoconazole and quinoline copper can also control the pathogen, with median effective concentration(EC_(50)) of 2.92 and 9.02 mg·L~(-1), respectively. This study lays a theoretical basis for the field control of black spot in A. carmichaelii.
Assuntos
Aconitum , Fungicidas Industriais , Alternaria , Fungicidas Industriais/farmacologia , MicélioRESUMO
This study aims to clarify the species and biological characteristics of the pathogen causing southern blight in Aster tataricus and screen out effective fungicides for the prevention and control of this disease. We collected the typical diseased plants and sclerotia on soil surface for the isolation of the pathogen, and identified the pathogen based on morphological characteristics, molecular biological characteristics, and pathogenicity. Further, we evaluated the inhibitory effects of 12 fungicides on the pathogen by plate growth inhibition assay. In the diseased plants, watery brown spots first appeared at the stem base and then spread upward, which were covered with white mycelia and surrounded by white to yellow-brown sclerotia. From the diseased plants, 15 strains with consistent traits were isolated. The pathogen was identified as Athelia rolfsii based on morphological characteristics and ITS and TEF sequences. The pathogenicity test was carried out according to Koch's rule, which showed the disease symptoms consistent with those in the field. The pathogen presented the optimum growth at 28-30 â, pH 5-8, and full darkness. The preliminary indoor screening demonstrated that four chemical fungicides(taifujin, hymexazol, flusilazole, and lime-sulphur-synthelic-solution), two botanical fungiticides(ethylicin and garlic oil), and a microbial agent(Bacillus subtilis) had good inhibitory effects on A. rolfsii. The results of gradient inhibition experiments showed that B. subtilis, flusilazole, and ethylicin had stronger inhibitory activity. The further in vivo screening indicated that ethylicin can be used as the main fungicide for the prevention and treatment of southern blight in A. tataricus.
Assuntos
Fungicidas Industriais , Fungicidas Industriais/farmacologia , Pesquisa , VirulênciaRESUMO
Medicinal plants are the main source of clinical medication in traditional Chinese medicine(TCM). China has achieved large-scale cultivation and production of medicinal plants. As an important resource for the sustainable development of agriculture in the future, microorganisms can also promote the green, ecological and high-quality development of Chinese medicine agriculture. However, research on the medicinal plant microbiome is still limited. Therefore, based on the development timeline of microbiome research, the present study reviewed the origin, technology, and hotspots of microbiome research and proposed some suggestions for future research according to the advances in medicinal plant microbiome.(1)Systematic investigation of medicinal plant microbiome on the species, genus, and family levels should be carried out on the medicinal plants of different chemotypes in order to reveal the coevolution of the microorganisms and their host plants.(2)Spatial and temporal research on medicinal plant microbiome should be performed to reveal the effects of microorganisms on the growth, development, and secondary metabolite accumulation of medicinal plants, as well as the underlying mechanisms.(3)Model medicinal plant species should be selected and microorganism-plant interaction research models should be established.(4)Core microbiome of medicinal plants should be explored for the future application of crucial microbes in the sustaina-ble agriculture of Chinese medicine.(5)Breeding of medicinal plant-associated microbes should be carried out to lay the foundation for novel medicinal plant breeding strategies.(6)High-throughput sequencing, traditional incubation, and isolation of microbes should be combined to study medicinal plant microbiome, thereby promoting the exploitation and application of uncultured microbial strains.(7)Platforms for the preservation of medicinal plant-associated microbe strains and data of their metabolites should be established and the exchange of information and cooperation between these platforms should be subsequently enhanced. With these suggestions, the efficient and rapid development of medicinal plant microbiome research is expected to be promoted.
Assuntos
Microbiota , Plantas Medicinais , Melhoramento Vegetal , Medicina Tradicional Chinesa , AgriculturaRESUMO
Quantitative acetyl-proteomics, a newly identified post-translational modification, is known to regulate transcriptional activity in different organisms. Neurospora crassa is a model ascomycete fungus maintained for biochemistry and molecular biology research; however, extensive studies of the functions of its acylation proteins have yet to be performed. In this study, using LC-MS/MS qualitative proteomics strategies, we identified 1909 modification sites on 940 proteins in N. crassa and analysed the functions of these proteins using GO enrichment, KEGG pathway, and subcellular location experiments. We classified the acetylation protein involvement in diverse pathways, and protein-protein interaction (PPI) network analysis further demonstrated that these proteins participate in diverse biological processes. In summary, our study comprehensively profiles the crosstalk of modified sites, and PPI among these proteins may form a complex network with both similar and distinct regulatory mechanisms, providing improved understanding of their biological functions in N. crassa.
Assuntos
Neurospora crassa , Proteoma , Acetilação , Cromatografia Líquida , Lisina/metabolismo , Neurospora crassa/metabolismo , Processamento de Proteína Pós-Traducional , Proteoma/metabolismo , Espectrometria de Massas em TandemRESUMO
LuxR-type transcriptional regulators are essential for many physiological processes in bacteria, including pathogenesis. Acidovorax citrulli is a seedborne bacterial pathogen responsible for bacterial fruit blotch, which causes great losses in melon and watermelon worldwide. However, the LuxR-type transcriptional factors in A. citrulli have not been well studied, except for the previously reported LuxR-type regulatory protein, AcrR, involved in regulating virulence and motility. Here, we characterized a second LuxR-type regulator, AclR, in the group II strain Aac-5 of A. citrulli by mutagenesis, virulence and motility assays, and transcriptomic analysis. Deletion of aclR resulted in impaired twitching and swimming motility and flagellar formation and diminished virulence but increased biofilm formation. Transcriptomic analysis revealed that 1,379 genes were differentially expressed in the aclR mutant strain, including 29 genes involved in flagellar assembly and 3 involved in pili formation, suggesting a regulatory role for AclR in multiple important biological functions of A. citrulli. Together, our results not only indicate that AclR plays a global role in transcriptional regulation in A. citrulli influencing motility, biofilm formation, and virulence but also provide perspective regarding the regulatory network of biological functions in A. citrulli.[Formula: see text] Copyright © 2021 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.
Assuntos
Comamonadaceae , Proteínas Repressoras/fisiologia , Transativadores/fisiologia , Transcriptoma , Comamonadaceae/genética , Proteínas Repressoras/genética , Transativadores/genética , Transcriptoma/genética , VirulênciaRESUMO
Porous liquids, a new porous material with fluidity, can be applied in numerous fields, such as gas storage and/or separation. In this work, the separation of binary gas mixtures CO2/N2 and CO2/CH4 with porous liquids was examined by molecular dynamics (MD) simulations. The pure gas adsorption capacity was analyzed with different concentrations of porous liquids. The dependence of the separation effect of a gas mixture on the total pressure and temperature was investigated. Meanwhile, for both CO2/N2 and CO2/CH4 systems, the adsorption and separation effects of porous liquids with a cage:solvent ratio of 1:12 are better than those of 1:91 and 1:170. The results of the spatial distribution function and/or trajectories indicated that porous liquids prefer CO2, leading to the location of CO2 in the channels formed in porous liquids. However, N2 and CH4 are hardly adsorbed into the bulk. The diffusion of gas molecules follows the order of CO2 > N2 (for CO2/N2) and CH4 > CO2 (for CO2/CH4) in the bulk and N2 > CO2 (for CO2/N2) and CH4 > CO2 (for CO2/CH4) at the interface of porous liquids. Upon increasing the concentrations of porous liquids, the working capacities of CO2 show small decreases in CO2/N2 and CO2/CH4 systems, but the sorbent selection parameters are higher in pressure- and temperature-swing adsorption processes. The porous liquid with a cage:solvent ratio of 1:12 is more suitable for the separation of CO2/N2 and CO2/CH4 systems than ratios of 1:91 and 1:170.
RESUMO
During the high-temperature and rainy season from June to October in 2017-2019,serious southern blight broke out in the Cynanchum stauntonii planting area in Tuanfeng county,Hubei province,which had a great impact on the yield and quality of medicinal materials. In this study,the pathogen of C. stauntonii was isolated,purified,and identified,and the pathogenicity was tested according to Koch's postulates. Meanwhile,the biological characteristics of the pathogen were analyzed. On this basis,the effective fungicides were screened in laboratory. Finally,the pathogen( BQ-1) was identified as Athelia rolfsii( Deuteromycotina,Basidiomycota,anamorph: Sclerotium rolfsii). The optimum growth conditions for BQ-1 were 25-30 â,p H 5-8,and alternating light and dark.The effective chemical fungicides were lime-sulphur-synthelic-solution( LSSS) and flusilazole,and the effective botanical fungicide was osthole. BQ-1 was highly homologous to the pathogen HS-1 of peanut southern blight,with the similarity of 18 S r DNA and TEF sequences at 99. 09%. The southern blight in C. stauntonii might be resulted from that in peanut. In the production of C. stauntonii,the following measures should be taken: avoiding rotation or neighboring with peanut,draining water from June to October to reduce humidity,and reasonably applying fungicides.
Assuntos
Basidiomycota , Cynanchum , Fungicidas Industriais , Fungicidas Industriais/farmacologia , UmidadeRESUMO
Ecological agriculture is a crucial way for agriculture of Chinese materia medica, which emphasizes the application of ecological principles in the cultivation of traditional Chinese medicine. While long-term intensive farming and modern chemical agriculture have threatened soil health, the sustainable development of ecological agriculture of Chinese materia medica is constrained. No-til-lage can reduce both frequency and intensity of tillage. Compared with conventional agriculture, no-tillage can reduce soil disturbance, maintain no-tillage for a long or permanent period and keep mulching. The application of no-tillage has a long history. More and more studies have shown that no-tillage has many advantages over conventional tillage, and the ecological and economic benefits of no-tillage are particularly outstandingin long-term. The cultivation of Chinese medicinal materials adheres to the principle of not grabbing land from farmland, making full use of the soil resources under forests, mountains and wasteland. Reducing the risk of soil loss and sustai-nable utilization are the core issues in the process of new land cultivation. No-tillage application, which not only inherits the traditional Chinese concept of natural farming, but also integrates the laws of ecological agriculture, will become the core strategies of sustainable development of Chinese materia medica ecological agriculture. This study will introduce the basic concepts and development process of no-tillage, analyze their ecological benefits in ecological agriculture of Chinese materia medica, and put forward their application strategies.
Assuntos
Medicamentos de Ervas Chinesas , Materia Medica , Agricultura , China , Medicina Tradicional Chinesa , Desenvolvimento SustentávelRESUMO
Rhizome rot disease is one of the main disease of planted Polygonatum kingianum. In this study, six strains of pathogenic fungus was isolated from P. kingianum samples with rhizome rot disease collected from six counties in Yunnan province. Its pathogenicity was confirmed by inoculation to healthy P. kingianum rhizome according to Koch's postulates. The colonies of the isolated fungi on potato dextrose agar(PDA) were orange with abundant crescentic conidia which were eseptate with a mean size of 19. 3-24. 9 µm×5. 2-5. 9 µm and a L/W ratio of 3. 4-4. 5. There was an oil ball in the center of the conidium. It's easy to see setae on PDA colony.The phylogenetic tree based on ITS, GAPDH, CHS-1, HIS3, ACT, and TUB2 sequences by maximum likelihood(ML) method indicated that the pathogenic fungus for P. kingianum rhizome rot disease was clustered into the clade of Colletotrichum spaethianum species complex, and was close to C. spaethianum. However, there were some differences in morphological and genetic characteristics between the pathogenic fungus and C. spaethianum. Therefore, the pathogenic fungus for rhizome rot disease of P. kingianum was identified as a new Colletotrichum species named C. kingianum. The disease spreads primarily due to the plantation of infected seedlings of P. kingianum. It is necessary to choose healthy seedlings and take rigorous disinfection measures for the disease prevention.
Assuntos
Colletotrichum , Polygonatum , China , Colletotrichum/genética , Filogenia , RizomaRESUMO
In order to identify the species and biological characteristics of the pathogen of southern blight from three kinds of Chinese medicine of Iridaceae(Belamcanda chinensis, Iris tectorum and I. japonica) in Dabie Mountains, the isolation, identification, pathogenicity and biological characteristics of the pathogens were studied according to Koch's postulates. In addition, 9 chemical fungicides, 3 botanical fungicides and 5 microbial fungicides were used to evaluate their inhibition to the isolates in vitro. The results showed that all the strains(SG-Q, YW-Q, and HDH-Q) isolated and purified from the diseased plants of B. chinensis, I. tectorum and I. japonica, respectively, were identified as Sclerotium rolfsii through morphological observation and sequence aligement of 18 S rDNA, rDNA-ITS and TEF. Field observations showed that the intensity of the disease incidence of three Iridaceae plants was B. chinensis>I. japonica> I. tectorum, and the pathogenicity of the strains was SG-Q>YW-Q>HDH-Q. For biological characteristics, SG-Q strain was suitable for growth under the 12 h light/12 h dark cycle, with the optimal growth temperature of 30 â and pH of 5. Among the 9 tested chemical fungicides, 29% lime sulphure and 10% flusilazole had stronger inhibitory effect on mycelia growth of SG-Q. For 3 botanical fungicides, 1% osthol, 20% eugenol and 0.5% berberine could effectively inhibt the mycelial growth of SG-Q and cause the morphological variation of the pathogen. For 5 microbial fungicides, Trichoderma harzianum and Bacillus subtilis had better inhibition on the mycelium growth of SG-Q.
Assuntos
Basidiomycota , Iridaceae , Medicina , HypocrealesRESUMO
Coptis chinensis is one of bulk traditional herbal medicines in China. In recent years, the occurrence of various diseases has caused great yield loss and quality reduction of C. chinensis, which has become an important threat of herbal medicine industry. Here we reviewed the symptoms, pathogens, epidemiology and control methods of 6 common diseases of C. chinensis including root rot, southern blight, violet root rot, leaf spot, powdery mildew, and anthracnose. This review aims at providing guidance for the disease diagnostic, pathogen identification, and control strategies of the diseases on C. chinensis, and facilitate the growth of traditional medicine industry.