Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Recent Advances in Synthetic Drugs and Natural Actives Interacting with OAT3.

Organic anion transporter 3 (OAT3) is predominantly expressed in the kidney and plays a vital role in drug clearance. Consequently, co-ingestion of two OAT3 substrates may alter the pharmacokinetics of the substrate. This review summarizes drug-drug interactions (DDIs) and herbal-drug interactions (HDIs) mediated by OAT3, and inhibitors of OAT3 in natural active compounds in the past decade. This provides a valuable reference for the combined use of substrate drugs/herbs for OAT3 in clinical practice in the future and for the screening of OAT3 inhibitors to avoid harmful interactions.

[A consensus on prenatal diagnosis and genetic counseling for chromosomal mosaicism].

With the extensive application of highly sensitive genetic techniques in the field of prenatal diagnosis, prenatal chromosomal mosaicisms including true fetal mosaicisms and confined placental mosaicisms are frequently identified in clinical settings, and the diagnostic criteria and principle of genetic counseling and clinical management for such cases may vary significantly among healthcare centers across the country. This not only has brought challenges to laboratory technician, genetic counselor and fetal medicine doctor, but can also cause confusion and anxiety of the pregnant woman and their family members. In this regard, we have formulated a consensus over the prenatal diagnosis and genetic counseling for chromosomal mosaicisms with the aim to promote more accurate and rational evaluation for fetal chromosomal mosaicisms in prenatal clinics.

200 µJ, 13 ns Er:ZBLAN mid-infrared fiber laser actively Q-switched by an electro-optic modulator.

We report, as far as we know for the first time, on a pulsed 2.7 µm Er:ZBLAN fiber laser Q-switched by an electro-optic modulator. The Q-switched operation was achieved with a repetition rate range of 100 Hz-50 kHz. Pulse energy of 205.7 µJ and pulse width down to 13.1 ns, yielding a peak power of 15.7 kW, were obtained at a repetition rate of 100 Hz. The linewidth of the output spectrum was as narrow as 0.4 nm. The pulse width and the pulse peak power, to the best of our knowledge, are currently the shortest and the highest in the 3-µm-band Q-switched fiber lasers, respectively.

Ionic liquid-based dispersive liquid-liquid microextraction followed by magnetic solid-phase extraction for determination of quinolones.

An ionic liquid-based dispersive liquid-liquid microextraction (IL-DLLME) combined with magnetic solid-phase extraction (MSPE) was developed for extraction of quinolones (quinolones) from honey and milk prior to high-performance liquid chromatography (HPLC) analysis. 1-Butyl-3-methylimidazolium hexafluorophosphate was used as the extraction solvent and an effective adsorbent based on chitosan modified magnetic core-shell functionalized multi-walled carbon nanotube (MWCNTs-Fe3O4@SiO2-CS) nanoparticles was used to assist IL to adsorb quinolone residues in honey and milk samples. Extraction conditions were optimized through one-factor-at-a-time and response surface methodology using a Box-Behnken design. Under optimum conditions satisfactory linearity (R2 > 0.999) and high sensitivity (method limits of quantification were 4-8 µg kg-1 or µg L-1 in honey or milk samples) was achieved. The recoveries of quinolones in honey and milk ranged from 81.2 to 109%. Based on this study, the proposed method was employed for the determination of antibiotic residues in honey and milk samples.

[Consensus on technological standards for non-invasive prenatal screening of pathogenic copy number variations by high-throughput sequencing of maternal plasma cell-free DNA].

Genomic disorders caused by pathogenic copy number variation (pCNV) have proven to underlie a significant proportion of birth defects. With technological advance, improvement of bioinformatics analysis procedure, and accumulation of clinical data, non-invasive prenatal screening of pCNV (NIPS-pCNV) by high-throughput sequencing of maternal plasma cell-free DNA has been put to use in clinical settings. Specialized standards for clinical application of NIPS-pCNV are required. Based on the discussion, 10 pCNV-associated diseases with well-defined conditions and 5 common chromosomal aneuploidy syndromes are recommended as the target of screening in this consensus. Meanwhile, a standardized procedure for NIPS-pCNV is also provided, which may facilitate propagation of this technique in clinical settings.

[A consensus recommendation for the interpretation and reporting of copy number variation and regions of homozygosity in prenatal genetic diagnosis].

Chromosomal microdeletions and microduplications have been proven to be a significant proportion of genetic factors underlying birth defects. Chromosomal microarray analysis (CMA) and next generation sequencing-based copy number variation (CNV-seq) assay have been recommended as first-tier tests for prenatal evaluation of disease-causing CNV across the genome. With the broad application of such technologies in prenatal genetic diagnosis, there is a needed to enhance the consistency in interpretation and reporting of CNV results in clinical laboratories across China. In addition, a standard guideline for prenatal analysis and reporting of regions of homozygosity (ROH) is also required. To assist the classification, interpretation and reporting of CNV/ROH, the following recommendations have been developed, which may enhance a standard application of CMA/CNV-seq techniques in prenatal genetic diagnosis.

[A consensus recommendation for the interpretation and reporting of exome sequencing in prenatal genetic diagnosis].

With the rapid development and adaptation of high-throughput sequencing in clinical settings, application of exome sequencing (ES) has been gradually expanded from pediatric to prenatal diagnosis in recent years. There is an urgent need to establish criteria for clinical grade ES in order to facilitate such a complex testing. The standardization of pre- and post-test consultation, quality control for sample processing process and validation of bioinformatics data analysis, and more importantly data interpretation and reporting, as well as appropriate reporting scope, is of great importance for health care stakeholders. To achieve this, a committee composed of a wide range of healthcare professionals has proposed an ES standard for prenatal diagnosis. This has provided expert opinion on the genetic counseling and reporting standards of prenatal ES for the purpose of applying ES technology in prenatal setting.

Crystal Structures of Candida albicans Phosphodiesterase 2 and Implications for Its Biological Functions.

The cAMP signaling system plays important roles in the physiological processes of pathogen yeast Candida albicans, but its functional mechanism has not been well illustrated. Here, we report the enzymatic characterization and crystal structures of C. albicans phosphodiesterase 2 (caPDE2) in the unliganded and 3-isobutyl-1-methylxanthine-complexed forms. caPDE2 is a monomer in liquid and crystal states and specifically hydrolyzes cAMP with a KM of 35 nM. It does not effectively hydrolyze cGMP as shown by the 1.32 × 105-fold specificity of cAMP/cGMP. The crystal structure of caPDE2 shows significant differences from those of human PDEs. First, the N-terminal fragment of caPDE2 (residues 1-201) tightly associates with the catalytic domain to form a rigid molecular entity, implying its stable molecular conformation for C. albicans to resist environmental stresses. Second, the M-loop, a critical fragment for binding of the substrate and inhibitors to human PDEs, is not a part of the caPDE2 active site. This feature of caPDE2 may provide a structural basis for the design of selective inhibitors for the treatment of yeast infection.

[Application of chromosomal karyotyping analysis and array CGH for fetal abnormalities detected by ultrasonography].

OBJECTIVE: To assess the value of chromosomal karyotyping and array-based comparative genomic hybridization for the diagnosis of fetus with abnormalities detected by ultrasonography. METHODS: Umbilical cord blood samples were derived from 1 603 pregnant women. The samples were cultured for routine G-banding karyotype analysis. Among these, 792 samples have further subjected to array CGH analysis. RESULTS: Among the 1 603 fetuses, 117 (7.30%) were found with chromosomal abnormalities. These included 72 numerical aberrations and 45 structural abnormalities, which respectively accounted for 4.49% and 2.81% of all cases. For those <35 years and ≥ 35 years, a significant difference has been found in terms of fetal chromosomal abnormalities (chi-square is 30.687, P< 0.01). And there was also a significant difference between those with isolated, two or multiple ultrasonographic markers (chi-square is 85.50, P< 0.01). Among 736 fetuses with a normal karyotype, array CGH has detected 17 (2.31%) with a microdeletion or microduplication. CONCLUSION: Karyotype analysis and array CGH should be offered to all fetuses with ultrasonography detected anomalies regardless the number of markers.

Dual specificity and novel structural folding of yeast phosphodiesterase-1 for hydrolysis of second messengers cyclic adenosine and guanosine 3',5'-monophosphate.

Cyclic nucleotide phosphodiesterases (PDEs) decompose second messengers cAMP and cGMP that play critical roles in many physiological processes. PDE1 of Saccharomyces cerevisiae has been subcloned and expressed in Escherichia coli. Recombinant yPDE1 has a KM of 110 µM and a kcat of 16.9 s(-1) for cAMP and a KM of 105 µM and a kcat of 11.8 s(-1) for cGMP. Thus, the specificity constant (kcat/KM(cAMP))/(kcat/KM(cGMP)) of 1.4 indicates a dual specificity of yPDE1 for hydrolysis of both cAMP and cGMP. The crystal structures of unliganded yPDE1 and its complex with GMP at 1.31 Å resolution reveal a new structural folding that is different from those of human PDEs but is partially similar to that of some other metalloenzymes such as metallo-ß-lactamase. In spite of their different structures and divalent metals, yPDE1 and human PDEs may share a common mechanism for hydrolysis of cAMP and cGMP.

[Applied research of combined G-banding and array-CGH in the prenatal diagnosis of ultrasonographic abnormalities in fetuses].

OBJECTIVE: To use combined comparative genome hybridization (array-CGH) and conventional karyotype analysis to study the relationship between ultrasonographic abnormalities of fetuses and chromosomal aberrations. METHODS: One hundred twenty two fetuses with ultrasonographic abnormalities in middle and late trimesters suspected with chromosomal abnormalities were collected between March 2012 and February 2013. RESULTS: The pregnant women had an average age of 31 yr (22-38), among whom 35 were above the age of 35. The average gestational age was 27(+5) weeks (18-37 weeks), and the most common abnormal findings have involved heart, central nervous system and bones. Multiple malformations were found in 49 cases. The success rate of the combined methods was 100%. In 24 (19.7%) of the cases, a chromosomal abnormality was detected. Among all cases, 16 (13.1%) were detected by the combined method (12.3%). Seventeen cases (13.9%) of chromosomal abnormalities and 4 cases (3.3%) of polymorphic variation were detected by karyotype analysis, and 23 cases (8.9%) of abnormalities were detected by array-CGH. Meanwhile, 7 cases (5.7%) of abnormalities were detected by array-CGH, but the results of karyotype analysis were normal. One case (0.8%) with low level of chromosome chimerism detected by the karyotype analysis was missed by array-CGH. CONCLUSION: The results suggested that multiple congenital deformity of the fetus has a strong correlation with chromosomal abnormalities. For fetuses with ultrasonographic abnormalities, array-CGH can improve the detection sensitivity of the chromosomal disease.

Anti-hyperuricemia bioactive peptides: a review on obtaining, activity, and mechanism of action.

Hyperuricemia, a disorder of uric acid metabolism, serves as a significant risk factor for conditions such as hypertension, diabetes mellitus, renal failure, and various metabolic syndromes. The main contributors to hyperuricemia include overproduction of uric acid in the liver or impaired excretion in the kidneys. Despite traditional clinical drugs being employed for its treatment, significant health concerns persist. Recently, there has been growing interest in utilizing protein peptides sourced from diverse food origins to mitigate hyperuricemia. This article provides a comprehensive review of bioactive peptides with anti-hyperuricemia properties derived from animals, plants, and their products. We specifically outline the methods for preparing these peptides from food proteins and elucidate their efficacy and mechanisms in combating hyperuricemia, supported by in vitro and in vivo evidence. Uric acid-lowering peptides offer promising prospects due to their safer profile, enhanced efficacy, and improved bioavailability. Therefore, this review underscores significant advancements and contributions in identifying peptides capable of metabolizing purine and/or uric acid, thereby alleviating hyperuricemia. Moreover, it offers a theoretical foundation for the development of functional foods incorporating uric acid-lowering peptides.

Evaluating Fluorinated-Aniline Units with Functionalized Spiro[Fluorene-9,9'-Xanthene] as Hole-Transporting Materials in Perovskite Solar Cells and Light-Emitting Diodes.

In the field of perovskite optoelectronics, developing hole-transporting materials (HTMs) on the spiro[fluorene-9,9'-xanthene] (SFX) platform is one of the current research focuses. The SFX inherits the merits of spirobifluorene in terms of the configuration and property, but it is more easily derivatized and regulated by virtue of its binary structure. In this work, we design and synthesize four isomeric SFX-based HTMs, namely m-SFX-mF, p-SFX-mF, m-SFX-oF, and p-SFX-oF, through varying the positions of fluorination on the peripheral aniline units and their substitutions on the SFX core, and the optoelectronic performance of the resulting HTMs is evaluated in both perovskite solar cells (PSCs) and light-emitting diodes (PeLEDs) by the vacuum thermal evaporating hole-transporting layers (HTLs). The HTM p-SFX-oF exhibits an improved power conversion efficiency of 15.21% in an inverted PSC using CH3NH3PbI3 as an absorber, benefiting from the deep HOMO level and good HTL/perovskite interface contact. Meanwhile, the HTM m-SFX-mF provides a maximum external quantum efficiency of 3.15% in CsPb(Br/Cl)3-based PeLEDs, which is attributed to its perched HOMO level and shrunken band-gap for facilitating charge carrier injection and then exciton combination. Through elucidating the synergistic position effect of fluorination on aniline units and their substitutions on the SFX core, this work lays the foundation for developing low-cost and efficient HTMs in the future.

Ligand Homogenized Br-I Wide-Bandgap Perovskites for Efficient NiOx-Based Inverted Semitransparent and Tandem Solar Cells.

Phase heterogeneity of bromine-iodine (Br-I) mixed wide-bandgap (WBG) perovskites has detrimental effects on solar cell performance and stability. Here, we report a heterointerface anchoring strategy to homogenize the Br-I distribution and mitigate the segregation of Br-rich WBG-perovskite phases. We find that methoxy-substituted phenyl ethylammonium (x-MeOPEA+) ligands not only contribute to the crystal growth with vertical orientation but also promote halide homogenization and defect passivation near the buried perovskite/hole transport layer (HTL) interface as well as reduce trap-mediated recombination. Based on improvements in WBG-perovskite homogeneity and heterointerface contacts, NiOx-based opaque WBG-perovskite solar cells (WBG-PSCs) achieved impressive open-circuit voltage (Voc) and fill factor (FF) values of 1.22 V and 83%, respectively. Moreover, semitransparent WBG-PSCs exhibit a PCE of 18.5% (15.4% for the IZO front side) and a high FF of 80.7% (79.4% for the IZO front side) for a designated illumination area (da) of 0.12 cm2. Such a strategy further enables 24.3%-efficient two-terminal perovskite/silicon (double-polished) tandem solar cells (da of 1.159 cm2) with a high Voc of over 1.90 V. The tandem devices also show high operational stability over 1000 h during T90 lifetime measurements.

Crystallization Kinetics of Perovskite Films by a Green Mixture Antisolvent for Efficient NiOx-Based Inverted Solar Cells.

Environment-friendly antisolvents are critical for obtaining highly efficient, reproducible, and sustainable perovskite solar cells (PSCs). Here, we introduced a green mixture antisolvent of ethyl acetate-isopropanol (EA/IPA) to finely regulate the crystal grain growth and related film properties, including the morphology, crystal structure, and chemical composition of the perovskite thin film. The IPA with suitable content in EA plays a key role in achieving a smooth and compact high-quality perovskite thin film, leading to the suppression of film defect-induced nonradiative recombination. As a result, the PSCs based on the EA/IPA (5:1) antisolvent showed a power conversion efficiency of 22.9% with an open-circuit voltage of 1.17 V.

Therapeutic Activity of Green Tea Epigallocatechin-3-Gallate on Metabolic Diseases and Non-Alcoholic Fatty Liver Diseases: The Current Updates.

Green tea polyphenols have numerous functions including antioxidation and modulation of various cellular proteins and are thus beneficial against metabolic diseases including obesity, type 2 diabetes, cardiovascular and non-alcoholic fatty liver diseases, and their comorbidities. Epigallocatechin-3-gallate (EGCG) is the most abundant polyphenol in green tea and is attributed to antioxidant and free radical scavenging activities, and the likelihood of targeting multiple metabolic pathways. It has been shown to exhibit anti-obesity, anti-inflammatory, anti-diabetic, anti-arteriosclerotic, and weight-reducing effects in humans. Worldwide, the incidences of metabolic diseases have been escalating across all age groups in modern society. Therefore, EGCG is being increasingly investigated to address the problems. This review presents the current updates on the effects of EGCG on metabolic diseases, and highlights evidence related to its safety. Collectively, this review brings more evidence for therapeutic application and further studies on EGCG and its derivatives to alleviate metabolic diseases and non-alcoholic fatty liver diseases.

Bioactive Compounds in Sea Buckthorn and their Efficacy in Preventing and Treating Metabolic Syndrome.

Sea buckthorn (Hippophae rhamnoides L. or Elaeagnus rhamnoides L.) is a plant that has long been used as a Chinese herbal medicine. This species is known to contain numerous bioactive components, including polyphenols, fatty acids, vitamins, and phytosterols, which may be responsible for its medicinal value. In experiments both in vitro and in vivo (ranging from cell lines to animal models and human patients), sea buckthorn has shown positive effects on symptoms of metabolic syndrome; evidence suggests that sea buckthorn treatment can decrease blood lipid content, blood pressure, and blood sugar levels, and regulate key metabolites. This article reviews the main bioactive compounds present in sea buckthorn and discusses their efficacy in treating metabolic syndrome. Specifically, we highlight bioactive compounds isolated from distinct sea buckthorn tissues; their effects on abdominal obesity, hypertension, hyperglycemia, and dyslipidemia; and their potential mechanisms of action in clinical applications. This review provides key insight into the benefits of sea buckthorn, promoting future research of this species and expansion of sea buckthorn-based therapies for metabolic syndrome.

Urolithins: A Prospective Alternative against Brain Aging.

The impact of host-microbiome interactions on cognitive health and disease has received increasing attention. Microbial-derived metabolites produced in the gut are one of crucial mechanisms of the gut-brain axis interaction, showing attractive perspectives. Urolithins (Uros) are gut microbial-derived metabolites of ellagitannins and ellagic acid, whose biotransformation varies considerably between individuals and decreases greatly with age. Recently, accumulating evidence has suggested that Uros may have specific advantages in preventing brain aging including favorable blood-brain barrier permeability, selective brain distribution, and increasingly supporting data from preclinical and clinical studies. However, the usability of Uros in diagnosis, prevention, and treatment of neurodegenerative diseases remains elusive. In this review, we aim to present the comprehensive achievements of Uros in age-related brain dysfunctions and neurodegenerative diseases and discuss their prospects and knowledge gaps as functional food, drugs, or biomarkers against brain aging.

Ras2 Is Responsible for the Environmental Responses, Melanin Metabolism, and Virulence of Botrytis cinerea.

Ras proteins are monomeric G proteins that are ubiquitous in fungal cells and play important roles in fungal growth, virulence, and environmental responses. Botrytis cinerea is a phytopathogenic fungus that infects various crops. However, under specific environmental conditions, the overripe grapes infected by B. cinerea can be used to brew valuable noble rot wine. As a Ras protein, the role of Bcras2 in the environmental responses of B. cinerea is poorly understood. In this study, we deleted the Bcras2 gene using homologous recombination and examined its functions. Downstream genes regulated by Bcras2 were explored using RNA sequencing transcriptomics. It was found that ΔBcras2 deletion mutants showed significantly reduced growth rate, increased sclerotia production, decreased resistance to oxidative stress, and enhanced resistance to cell wall stress. Additionally, Bcras2 deletion promoted the expression of melanin-related genes in sclerotia and decreased the expression of melanin-related genes in conidia. The above results indicate that Bcras2 positively regulates growth, oxidative stress resistance, and conidial melanin-related genes expression, and negatively regulates sclerotia production, cell wall stress resistance and sclerotial melanin-related genes expression. These results revealed previously unknown functions of Bcras2 in environmental responses and melanin metabolism in B. cinerea.