[Impact of the examined number of lymph nodes at N1 station on the prognosis of patients with pT1-3N0M0 non-small cell lung cancer].

Objective: To investigate the relationship between the examined number of lymph nodes at the N1 station and the clinicopathological characteristics and prognosis of patients with pT1-3N0M0 non-small cell lung cancer (NSCLC). Methods: A total of 337 patients with pT1-3N0M0 NSCLC who underwent radical lung cancer surgery at the Provincial Hospital Affiliated to Anhui Medical University from January 2013 to March 2015 were selected. The receiver operating characteristic (ROC) curve analysis was used to determine the optimal cut-off value for predicting 5-year survival in pT1-3N0M0 NSCLC patients by the examined number of lymph nodes at the N1 station. The relationships between the examined number of lymph nodes at the N1 station and the clinicopathological characteristics and prognosis of patients with pT1-3N0M0 NSCLC were analyzed according to the optimal cut-off group. Results: A total of 1 321 lymph nodes at N1 station were examined in 337 patients, with a mean of 3.9 nodes per patient. The median survival time was 42.0 months, with 1-, 3- and 5-year survival rates of 82.2%, 57.1% and 24.9%, respectively. ROC curve analysis showed that the optimal cut-off value of 4.5 lymph nodes examined at the N1 station was used to predict 5-year survival in patients with pT1-3N0M0 NSCLC. After rounding off the number, the number of lymph nodes examined at the N1 station was 5 as the cut-off value, and the patients were divided into the group with <5 lymph nodes examined (212 cases) and the group with ≥5 lymph nodes examined (125 cases). The proportion of patients received adjuvant chemotherapy was 19.2% in the group with ≥5 lymph nodes examined, which was higher than 9.0% in the group with <5 lymph nodes examined (P=0.007), and the differences in other clinicopathological characteristics between the two groups were not statistically significant (P>0.05). The median survival time for patients in the group with <5 lymph nodes examined was 38.0 months, with 1-, 3- and 5-year survival rates of 80.1%, 52.5% and 15.6%, respectively. The median survival time for patients in the group with ≥5 lymph nodes examined was 48.0 months, and the 1-, 3- and 5-year survival rates were 85.6%, 64.0% and 36.0%, respectively. The survival rate of patients in the group with ≥5 lymph nodes examined was better than that in the group with <5 lymph nodes examined (P=0.002). Multifactorial Cox regression analysis showed that T stage (OR=1.408, 95% CI: 1.118-1.670) and the examined number of lymph nodes at N1 station (OR=0.670, 95% CI: 0.526-0.853) were independent influence factors for the prognosis of pT1-3N0M0 NSCLC patients. Conclusion: The examined number of lymph nodes at the N1 station is associated with the prognosis of patients with pT1-3N0M0 NSCLC, and the examination of at least 5 lymph nodes at N1 station at the time of postoperative pathological examination improves the 5-year survival rate of patients.

[Implement of mixed reality navigation based on multimodal imaging in the resection of intracranial eloquent lesions].

Objective: To examine the clinical feasibility of mixed reality navigation (MRN) technology based on multimodal imaging for the resection of intracranial eloquent lesions. Methods: Fifteen patients with intracranial eloquent lesions admitted to the Department of Neurosurgery, the First Medical Center, People's Liberation Army General Hospital from September 2020 to September 2021 were retrospectively enrolled. There were 7 males and 8 females, aged (50±16) years (range: 16 to 70 years). Postoperative pathological diagnosis included meningioma (n=7), metastatic carcinoma (n=3), cavernous hemangioma, glioma, ependymoma, aneurysmal changes and lymphoma (n=1, respectively). The open-source software was used to perform the three-dimensional visualization of preoperative images, and the self-developed MRN system was used to perform the fusion and interaction of multimodal images, so as to formulate the surgical plan and avoid damaging the eloquent white matter fiber tracts. Traditional navigation, intraoperative ultrasound and fluorescein sodium angiography were used to determine the extent of lesion resection. The intraoperative conditions of MRN-assisted surgery were analyzed, and the setup time and localization error of MRN system were measured. The changes of postoperative neurological function were recorded. Results: MRN based on multimodal imaging was achieved in all patients. The MRN system setup time (M(IQR)) was 36 (12) minutes (range: 20 to 44 minutes), and the localization error was 3.2 (2.0) mm (range: 2.6 to 6.7 mm). The reliability of eloquent white matter fiber tracts localization based on MRN was rated as "excellent" in 11 cases, "medium" in 3 cases, and "poor" in 1 case. There were no perioperative death and no new impairment in motor, language, or visual functions after operation. Transient limb numbness occurred in 1 patient after operation, and recovered to the preoperative state in 2 weeks after operation. Conclusion: The MRN system based on multimodal imaging can improve the surgical accuracy and safety, and reduce the incidence of iatrogenic neurological dysfunction.

Study on a new manner of the magnetization switching actuated by a unidirectional pulse current.

A new writing scheme with a unidirectional pulse current is proposed for spin transfer torque (STT) based magnetic random-access memory (MRAM). To investigate the feasibility of the writing scheme, bilayered nano-pillars composed of a soft layer with small in-plane shape anisotropy and a hard layer with either large perpendicular anisotropy (PMA) or in-plane anisotropy (IMA) are designed and their switching behaviors are studied. It is found that in either type of bilayered nano-pillars, with the aid of the attached hard layer, the magnetization of the soft layer can be switched back and forth under a unidirectional pulse current. In an IMA/IMA nano-pillar, the magnetization of the free layer (FL) can achieve excellent alignment, which is in contrast to the IMA/PMA nano-pillar. By optimizing the dimensions and magnetic parameters of the IMA/IMA nano-pillar, a decently low switching current density (4.3 × 1011A m-2) and ultrashort switching time (<1 ns) can be reached. Based on these results, the unidirectional writing scheme is practical if an IMA/IMA bilayer is used to replace the FL in a magnetic tunnel junction. Considering that a unidirectional writing scheme can enable the application of materials with high spin polarization such as half metals, and avoid the injection of writing current into junction using a special design, it may be very promising for STT-MRAM.

Bypassing the Structural Bottleneck in the Ultrafast Melting of Electronic Order.

Impulsive optical excitation generally results in a complex nonequilibrium electron and lattice dynamics that involves multiple processes on distinct timescales, and a common conception is that for times shorter than about 100 fs the gap in the electronic spectrum is not seriously affected by lattice vibrations. Here, however, by directly monitoring the photoinduced collapse of the spectral gap in a canonical charge-density-wave material, the blue bronze Rb_{0.3}MoO_{3}, we find that ultrafast (∼60 fs) vibrational disordering due to efficient hot-electron energy dissipation quenches the gap significantly faster than the typical structural bottleneck time corresponding to one half-cycle oscillation (∼315 fs) of the coherent charge-density-wave amplitude mode. This result not only demonstrates the importance of incoherent lattice motion in the photoinduced quenching of electronic order, but also resolves the perennial debate about the nature of the spectral gap in a coupled electron-lattice system.

A numerical study of spin torque oscillators based on IMA/PMA bilayer nano-pillars.

In this paper, the magnetization dynamics of bilayer structured nano-pillars containing a fixed layer with perpendicular magnetic anisotropy (PMA) and a free layer with in-plane magnetic anisotropy (IMA) are studied using the micro-magnetic simulation method. Unlike typical sandwich-structured spin-torque nano-pillar oscillators (STNOs), the proposed structure does not contain any nonmagnetic spacer layer. It is found that a stable oscillation with a significant amplitude can be established fast after driving out the vortex core by an in-plane magnetic pulse field. The oscillation frequency and amplitude can be easily manipulated by adjusting the side-length of the nanopillar, the thickness and saturation magnetization of the IMA layer, and an applied magnetic field along z axis. In an array with an adequate inter-pillar distance, the mutual interaction between the nano-pillars will lead the oscillations to be phase-locked, resulting in a considerable enhancement of total amplitude. As it is easy to fabricate these kinds of bi-layer nano-pillars and assemble them in arrays, they may have widespread applications in STNOs.

Regulating a novel domain wall oscillator with a steady frequency by changing the current density.

The dynamic behaviors of a domain wall (DW) pinned by a notch pair or a single notch with different notch depths are studied. It is found that, in a relatively large current density range, the oscillation frequency of the DW becomes frozen and independent of current density when pinned by a notch pair with a notch depth larger than 12 nm. The current density range for freezing the frequency can be tuned by the notch depth. A chain of notch pairs is designed to introduce more pinned DWs into the nanowire. By increasing the number of DWs and applying a proper magnetic field, the oscillation amplitude can be greatly enhanced. Our finding suggests that nanowires with a series of deep notch pairs may have an important application in the development of DW based spin-transfer nano-oscillators with a high tolerance for current fluctuation.

[A survey on sexual needs and factors of HIV risky sexual behaviors among elderly men at different ages in two communities of Qiandongnan Miao and Dong autonomous prefecture].

Objective: To understand sexual needs and factors of risky sexual behaviors among elderly men at different ages in two communities of Qiandongnan Miao and Dong autonomous prefecture and provide basis for targeted HIV prevention and intervention. Methods: Two communities in the prefecture were selected as study sites. Questionnaire surveys were carried out among elderly men aged 50 and over who visited or consulted in the communities from June to December 2018, and they were tested for HIV and syphilis antibodies. Results: Among 400 elderly men, 209 (52.2%) were 50-64 years old, and 191(47.8%) were above 65 years old. They were mainly Miao people, accounting for 66.3% (265/400), and 235 (58.8%) had an education no more than 6 years. HIV awareness of the two age groups were only 25.8% (54/199) and 26.2% (50/191), respectively. Among those aged 50-64, 142 (68.0%) felt normal sexual desire, and 153 (73.6%) reported penile erections or erections in most cases whenever sex, and 52.9% (110) ejaculated most of the time. HIV prevalence was 1.0% (4/400). Compared with the over 65-year-old group, the proportion of having sex with spouse/stable partners (89.5%, 179/200), proportion of no condom use with their spouse/stable sexual partners during the most recent sex (93.8%, 168/179), proportion of having casual sex (11.0%, 23/209) and commercial sex (3.8%, 8/209) were all higher among 50-64 age group. In comparison to those aged over 65 years old, average monthly income>3 000, and use of sex helper, aged 50-64 (OR=2.70, 95%CI: 1.22-5.95), average monthly income ≤1 000 yuan (OR=2.79, 95%CI: 1.25-6.21), and no use of sex helper (OR=3.78) (95%CI: 1.65-8.67) were related factors of HIV risky sexual behavior last time. Conclusion: Elderly men in the minority prefecture had low HIV awareness. Compared with those≥65 years old, the 50-64 age group had more active sexual behaviors and higher sexual needs. Those from 50-64 age group, with lower economic level and good sexual ability were more likely to have HIV risky sexual behaviors.

Current driven spin oscillation in PMA/IMA composite nanowires-a novel spin torque based nano-oscillators.

The spin dynamics in composite nanowires possessing both perpendicular magnetic anisotropy and in-plane magnetic anisotropy (IMA) regions are studied. It is found that, driven by proper currents, spin waves can be excited and propagate along the nanowires, leading to sustained oscillations of the magnetic moments. The frequency and amplitude strongly depend on the length of the longitudinal magnetized part (L IMA), and can be effectively tuned by applied current. The assistance of an applied field may help to obtain large frequencies and amplitudes simultaneously. Considering their ease of manufacture, these kinds of composite nanowires hold great promise for nano-oscillator applications.

How the environment shapes animal signals: a test of the acoustic adaptation hypothesis in frogs.

Long-distance acoustic signals are widely used in animal communication systems and, in many cases, are essential for reproduction. The acoustic adaptation hypothesis (AAH) implies that acoustic signals should be selected for further transmission and better content integrity under the acoustic constraints of the habitat in which they are produced. In this study, we test predictions derived from the AAH in frogs. Specifically, we focus on the difference between torrent frogs and frogs calling in less noisy habitats. Torrents produce sounds that can mask frog vocalizations and constitute a major acoustic constraint on call evolution. We combine data collected in the field, material from scientific collections and the literature for a total of 79 primarily Asian species, of the families Ranidae, Rhacophoridae, Dicroglossidae and Microhylidae. Using phylogenetic comparative methods and including morphological and environmental potential confounding factors, we investigate putatively adaptive call features in torrent frogs. We use broad habitat categories as well as fine-scale habitat measurements and test their correlation with six call characteristics. We find mixed support for the AAH. Spectral features of torrent frog calls are different from those of frogs calling in other habitats and are related to ambient noise levels, as predicted by the AAH. However, temporal call features do not seem to be shaped by the frogs' calling habitats. Our results underline both the complexity of call evolution and the need to consider multiple factors when investigating this issue.

[Learning curve of uniportal video-assisted thoracoscopic surgery lobectomy for the treatment of resectable lung cancer].

Objective: To analyze the learning curve of uniportal video-assisted thoracoscopic surgery (VATS) lobectomy for the treatment of resectable lung cancer. Methods: The clinical data of 160 patients with resectable lung cancer who underwent uniportal VATS lobectomy by a single surgical team between May 2016 and April 2017 at Department of Thoracic Surgery, the First Affiliated Hospital of the University of Science and Technology of China were analyzed retrospectively. The study group consisted of 90 male and 70 female patients with age of 28 to 84 years (median: 62 years). The patients were divided into four groups from group A to D according to chronological order. The operation time, incision length, intraoperative blood loss, number of dissected lymph nodes and nodal stations, the proportion of changes in operation mode, postoperative complications, chest drainage duration and hospitalization time were individually compared among the four groups by variance analysis and χ(2) test. Results: The 4 groups were similar in terms of incision length, chest drainage duration, number of dissected lymph nodes and nodal stations and postoperative hospitalization time (P>0.05). The difference of the operation time ((185.9±17.9) minutes vs. (139.9±10.7) minutes vs.(128.7±7.8) minutes vs.(124.0±9.3) minutes, F=219.605, P=0.000), intraoperative blood loss ((233.9±135.8) ml vs. (126.8±18.1) ml vs. (116.4±22.6) ml vs.(112.8±25.3) ml, F=26.942, P=0.000), the proportion of changes in operation mode (17.5% vs.7.5% vs. 5.0% vs. 5.0%, χ(2)=8.300, P=0.040), and the incidence of postoperative complications (27.5% vs. 10.0% vs. 10.0% vs. 7.5%, χ(2)=8.643, P=0.034) among the 4 groups was statistically significant. Conclusions: Uniportal VATS lobectomy can be safely and feasibly performed for resectable lung cancer, learning curve for uniportal VATS lobectomy is approximately 40 cases. Operation time, intraoperative blood loss, postoperative complications and the proportion of changes in operation mode can be used as the main measures during surgery.

[A prospective comparative study examing the impact of uniportal and three portal video-assisted thoracic surgery on short-term quality of life in lung cancer].

Objective: To evaluate the effect of the postoperative short-term quality of life between uniportal and three portal video-assisted thoracic surgery for radical lung cancer resection. Methods: The perioperative data and short-term quality of life of 120 patients received uniportal and three portal video-assisted thoracic surgery for radical lung cancer resection were analyzed from September to November 2017 at Department of Thoracic Surgery, the First Affiliated Hospital of University of Science and Technology of China. There were 64 male and 56 female patients aging of (62±10) years (ranging from 28 to 82 years). There were 60 cases received uniportal (uniportal group) and 60 cases received three portal video-assisted thoracic surgery (three-portal group). Quality of life by measurement of functional and symptom scales was assessed before surgery at baseline, and 1, 2, 4, and 8 weeks after the operation. The t test, χ(2) test, Fisher exact test and Wilcoxon rank-sum test were used to compare the date between the 2 groups. Repeated measurement variance was used for comparison of the quality of life at different time points. Results: There were no statistically significant differences in the clinicopathological features of the two groups (P>0.05). Intraoperative bleeding volume ((92±85) ml vs. (131±91) ml, t=2.387, P=0.019), postoperative catheter time ((4.4±3.1) days vs. (6.0±3.9) days, t=2.401, P=0.018), and postoperative hospitalization time ((6.2±4.0) days vs. (8.3±4.6) days, t=2.626, P=0.010) in the patients with uniportal group were less than that in three-portal group. Preoperative functional areas, symptom areas and overall health scores were similar in the two group. The functional areas such as physical function, role function, emotional function and social function and overall health status of uniportal group were significantly higher than those of three-portal group in postoperative time, while the fatigue and pain of uniportal group were significantly lower than that of three-portal group. Conclusions: Uniportal video-assisted thoracic surgery can achieve the same safety and radical of three-portal video-assisted thoracic surgery. It has advantages in intraoperative bleeding volume, postoperative time after operation, hospitalization time and postoperative life quality.

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China.

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Response and tolerance mechanism of food crops under high temperature stress: a review.

High temperature stress events are critical factors inhibiting crop yield. Meanwhile, world population is growing very rapidly and will be reached up to 9 billion by 2050. To feed increasing world population, it is challenging task to increase about 70% global food productions. Food crops have significant contribution toward global food demand and food security. However, consequences from increasing heat stress events are demolishing their abilities to survive and sustain yield when subjected to extreme high temperature stress. Therefore, there is dire need to better understand response and tolerance mechanism of food crops following exposure to heat stress. Here, we aimed to provide recent update on impact of high temperature stress on crop yield of food crops, pollination, pollinators, and novel strategies for improving tolerance of food crop under high temperature stress. Importantly, development of heat-resistant transgenic food crops can grant food security through transformation of superior genes into current germplasm, which are associated with various signaling pathways as well as epigenetic regulation in response to extreme high temperature stress.

Band-selective Holstein polaron in Luttinger liquid material A0.3MoO3 (A = K, Rb).

(Quasi-)one-dimensional systems exhibit various fascinating properties such as Luttinger liquid behavior, Peierls transition, novel topological phases, and the accommodation of unique quasiparticles (e.g., spinon, holon, and soliton, etc.). Here we study molybdenum blue bronze A0.3MoO3 (A = K, Rb), a canonical quasi-one-dimensional charge-density-wave material, using laser-based angle-resolved photoemission spectroscopy. Our experiment suggests that the normal phase of A0.3MoO3 is a prototypical Luttinger liquid, from which the charge-density-wave emerges with decreasing temperature. Prominently, we observe strong renormalizations of band dispersions, which are recognized as the spectral function of Holstein polaron derived from band-selective electron-phonon coupling in the system. We argue that the strong electron-phonon coupling plays an important role in electronic properties and the charge-density-wave transition in blue bronzes. Our results not only reconcile the long-standing heavy debates on the electronic properties of blue bronzes but also provide a rare platform to study interesting excitations in Luttinger liquid materials.

Structural modulation and hole distribution in Sr(14-x)Ca(x)Cu(24)O(41).

Structural properties and hole distribution in the spin-ladder compound Sr(14-x)Ca(x)Cu(24)O(41) have been extensively investigated by transmission electron microscopy (TEM). The complex electron diffraction patterns and high-resolution TEM observations reveal a clear incommensurate structural modulation along the c-axis direction attributable to two mismatched sublattices; this modulation strongly depends on hole distribution in the compounds. The fine structures of the O K and Cu L(2,3) ionization edges for the Sr(14-x)Ca(x)Cu(24)O(41) compounds recorded under different conditions indicate that more doped holes reside in the chains than the ladders, and that substituting Ca for Sr atoms results in a charge redistribution between the chains and ladders. Based on the experimental findings, the theoretical results, including the partial density of states and optical conductivity spectra calculated by the density functional theory, are also discussed.

Laser-induced vapor nanobubbles improve diffusion in biofilms of antimicrobial agents for wound care.

Being responsible for delayed wound healing, the presence of biofilms in infected wounds leads to chronic, and difficult to treat infections. One of the reasons why antimicrobial treatment often fails to cure biofilm infections is the reduced penetration rate of antibiotics through dense biofilms. Strategies that have the ability to somehow interfere with the integrity of biofilms and allowing a better penetration of drugs are highly sought after. A promising new approach is the use of laser-induced vapor nanobubbles (VNB), of which it was recently demonstrated that it can substantially enhance the penetration of antibiotics into biofilms, resulting in a marked improvement of the killing efficiency. In this study, we examined if treatment of biofilms with laser-induced vapor nanobubbles (VNB) can enhance the potency of antimicrobials which are commonly used to treat wound infections, including povidone-iodine, chlorhexidine, benzalkonium chloride, cetrimonium bromide and mupirocin. Our investigations were performed on Pseudomonas aeruginosa and Staphylococcus aureus biofilms, which are often implicated in chronic wound infections. Pre-treatment of biofilms with laser-induced VNB did enhance the killing efficiency of those antimicrobials which experience a diffusion barrier in the biofilms, while this was not the case for those compounds for which there is no diffusion barrier. The magnitude of the enhanced potency was in most cases similar to the enhancement that was obtained when the biofilms were completely disrupted by vortexing and sonication. These results show that laser-induced VNB are indeed a very efficient way to enhance drug penetration deep into biofilms, and pave the way towards clinical translation of this novel approach for treatment of wound infections.

Chronic but not acute treatment with caffeine attenuates traumatic brain injury in the mouse cortical impact model.

Caffeine, the most consumed psychoactive drug and non-specific adenosine receptor antagonist, has recently been shown to exert a neuroprotective effect against brain injury in animal models of Parkinson's disease (PD) and stroke. However, the effects of caffeine on traumatic brain injury (TBI) are not known. In this study, we investigated the effects of acute and chronic caffeine treatment on brain injury in a cortical-impact model of TBI in mice. Following TBI, neurological deficits, cerebral edema, as well as inflammatory cell infiltration were all significantly attenuated in mice pretreated chronically (for 3 weeks) with caffeine in drinking water compared with the mice pretreated with saline. Furthermore, we found that chronic caffeine treatment attenuated glutamate release and inflammatory cytokine production, effects that were correlated with an upregulation of brain A1 receptor mRNA. By contrast, acute treatment with caffeine (i.p. injection, 30 min before TBI) was not effective in protecting against TBI-induced brain injury. These results suggest that chronic (but not acute) caffeine treatment attenuates brain injury, possibly by A1 receptor-mediated suppression of glutamate release and inhibition of excessive inflammatory cytokine production. These results highlight the potential benefit of chronic caffeine intake for preventing TBI and provide a rationale for the epidemiological investigation of the potential association between TBI and human caffeine intake.

Response and tolerance mechanism of food crops under high temperature stress: a review

Abstract High temperature stress events are critical factors inhibiting crop yield. Meanwhile, world population is growing very rapidly and will be reached up to 9 billion by 2050. To feed increasing world population, it is challenging task to increase about 70% global food productions. Food crops have significant contribution toward global food demand and food security. However, consequences from increasing heat stress events are demolishing their abilities to survive and sustain yield when subjected to extreme high temperature stress. Therefore, there is dire need to better understand response and tolerance mechanism of food crops following exposure to heat stress. Here, we aimed to provide recent update on impact of high temperature stress on crop yield of food crops, pollination, pollinators, and novel strategies for improving tolerance of food crop under high temperature stress. Importantly, development of heat-resistant transgenic food crops can grant food security through transformation of superior genes into current germplasm, which are associated with various signaling pathways as well as epigenetic regulation in response to extreme high temperature stress.

Resumo Eventos de estresse de alta temperatura são fatores críticos que inibem o rendimento das culturas. Enquanto isso, a população mundial está crescendo muito rapidamente e atingirá até 9 bilhões em 2050. Para alimentar a crescente população mundial, é uma tarefa desafiadora aumentar cerca de 70% da produção global de alimentos. As culturas alimentares têm uma contribuição significativa para a procura global de alimentos e a segurança alimentar. No entanto, as consequências do aumento de eventos de estresse por calor estão destruindo suas habilidades de sobreviver e manter a produção quando submetidos a estresse de alta temperatura. Portanto, há uma necessidade urgente de entender melhor o mecanismo de resposta e tolerância das safras de alimentos após a exposição ao estresse por calor. Aqui, nosso objetivo foi fornecer atualizações recentes sobre o impacto do estresse de alta temperatura no rendimento de culturas de alimentos, polinização, polinizadores e novas estratégias para melhorar a tolerância de culturas de alimentos sob estresse de alta temperatura. É importante ressaltar que o desenvolvimento de culturas alimentares transgênicas resistentes ao calor pode garantir segurança alimentar por meio da transformação de genes superiores em germoplasma atual, que estão associados a várias vias de sinalização, bem como à regulação epigenética em resposta ao estresse de alta temperatura extrema.

Response and tolerance mechanism of food crops under high temperature stress: a review / Mecanismo de resposta e tolerância de culturas alimentares sob estresse de alta temperatura: uma revisão

High temperature stress events are critical factors inhibiting crop yield. Meanwhile, world population is growing very rapidly and will be reached up to 9 billion by 2050. To feed increasing world population, it is challenging task to increase about 70% global food productions. Food crops have significant contribution toward global food demand and food security. However, consequences from increasing heat stress events are demolishing their abilities to survive and sustain yield when subjected to extreme high temperature stress. Therefore, there is dire need to better understand response and tolerance mechanism of food crops following exposure to heat stress. Here, we aimed to provide recent update on impact of high temperature stress on crop yield of food crops, pollination, pollinators, and novel strategies for improving tolerance of food crop under high temperature stress. Importantly, development of heat-resistant transgenic food crops can grant food security through transformation of superior genes into current germplasm, which are associated with various signaling pathways as well as epigenetic regulation in response to extreme high temperature stress.

Eventos de estresse de alta temperatura são fatores críticos que inibem o rendimento das culturas. Enquanto isso, a população mundial está crescendo muito rapidamente e atingirá até 9 bilhões em 2050. Para alimentar a crescente população mundial, é uma tarefa desafiadora aumentar cerca de 70% da produção global de alimentos. As culturas alimentares têm uma contribuição significativa para a procura global de alimentos e a segurança alimentar. No entanto, as consequências do aumento de eventos de estresse por calor estão destruindo suas habilidades de sobreviver e manter a produção quando submetidos a estresse de alta temperatura. Portanto, há uma necessidade urgente de entender melhor o mecanismo de resposta e tolerância das safras de alimentos após a exposição ao estresse por calor. Aqui, nosso objetivo foi fornecer atualizações recentes sobre o impacto do estresse de alta temperatura no rendimento de culturas de alimentos, polinização, polinizadores e novas estratégias para melhorar a tolerância de culturas de alimentos sob estresse de alta temperatura. É importante ressaltar que o desenvolvimento de culturas alimentares transgênicas resistentes ao calor pode garantir segurança alimentar por meio da transformação de genes superiores em germoplasma atual, que estão associados a várias vias de sinalização, bem como à regulação epigenética em resposta ao estresse de alta temperatura extrema.