Arctium lappa is a new Natural Host of Tomato Spotted Wilt Virus in Korea.

Burdock (Arctium lappa L., belongs to the family Asteraceae), is an edible plant and an oriental medicinal herb in Korea (Han and Koo, 1993). In July 2023, burdocks showing chlorotic ringspots and yellowing on the leaves were observed in nine of approximately 4,000 plants in a greenhouse in Daegu, South Korea. To determine the causal virus species, nine symptomatic leaves from each individual plant were collected and tested using commercially available immunostrips (Agdia, Elkhart, USA) for cucumber mosaic virus (CMV) and tomato spotted wilt virus (TSWV). Seven out of nine samples tested positive for TSWV only. TSWV in South Korea was first reported on sweet pepper from Yesan in 2004 (Kim et al., 2004) and has since spread to various crops. The first report of TSWV infecting burdock plants in the world was from Hawaii in 1995 (Bautista et al., 1995), but TSWV-infected burdock has not been reported in Korea. To further confirm the presence of TSWV, total RNA was extracted from TSWV-positive burdock leaves using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used in reverse transcription-polymerase chain reaction (RT-PCR) assays with a specific primer set that amplifies 777 bp of nucleocapsid gene (N gene) of TSWV (Yoon et al., 2014). To obtain the complete genome sequence of this TSWV in the burdock plant, named TSWV-DG, fragments of L, M, and S segments were amplified and sequenced. The complete genome sequences of the L (8914 nt), M (4773 nt), and S (2946 nt) segments were obtained by overlapping RT-PCR amplicons. RT-PCR products were cloned into the pGEM-T Easy vector, and selected DNA clones were sequenced using Sanger method (Bioneer, Korea). The complete genome sequences were deposited to GenBank (LC790665, LC790666, and LC790667, respectively). BLASTn analysis showed that sequences of each TSWV-DG segment had maximum nucleotide identities of 99.5%, 99.5%, and 99.5% with TSWV-L, TSWV-M, and TSWV-S (OM154971, OM154970, and OM154969, respectively), which were isolated from water dropwort (Oenanthe crocata) in China (Qiu et al., 2023). To assess the biological activity of TSWV-DG, A. lappa and Nicotiana benthamiana were inoculated mechanically with sap from infected burdock leaves and maintained for visual inspection of virus symptoms at 25 ℃ at 3 weeks. TSWV-DG produced symptoms on the systemic leaves of A. lappa, that included chlorotic spots and yellowing, and on the leaves of N. benthamiana, that included chlorotic spots and mosaic patterns from 14 days-post-inoculation. Meanwhile, mock-inoculated A.lappa and N.benthamiana remained symptomless. The presence of TSWV on the inoculated leaves was subsequently confirmed through Immunostrip and RT-PCR analyses. TSWV may pose a significant threat to the production of A. lappa, which is cultivated as both leafy greens and root vegetables in Korea. Furthermore, A. lappa may not only be at risk of damage from TSWV infection but also act as a potential source of TSWV infection, thereby posing a risk of transmission to other key crops in Korea, such as pepper or potato (Yoon et al., 2014). This is the first report TSWV infecting burdock in South Korea.

First report of perilla mosaic emaravirus infecting Perilla frutescens in South Korea.

Perilla mosaic virus (PerMV; the genus Emaravirus in the family Fimoviridae) has a multiple, negative-sense, single-stranded RNA genome (ICTV, 2018). PerMV has been reported in Japan, where it was transmitted by an eriophyid mite species (Acari: Eriophyidae) to Perilla frutescens (L.) Britton var. crispa (Kubota et al., 2020). In September 2021, typical symptoms of the virus including yellow flecks, mosaic symptoms, and malformation were observed in leaves of P. frutescens in a cultivated field in Iseo-myeon, Wanju, South Korea (Suppl. Fig. 1). Visual estimates indicated that symptom incidence reached 70%, and the top leaves of perilla plants exhibited more severe symptoms and leaf distortion. To identify the virus species accurately, total RNA was extracted from five symptomatic perilla leaves collected using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) then cDNAs were amplified by reverse-transcription polymerase chain reaction (RT-PCR) using two pairs of primers to PerMV specific primer set designed to amplify 412- and 491-bp cDNAs of the nucleocapsid protein gene RNA 3 and movement protein gene RNA 4, respectively (Suppl. Table). Single-infection of PerMV in symptomatic Korean perilla plants was confirmed by high-throughput sequence (HTS) analysis and de novo transcriptome assembly using the Illumina HiSeq 4000 platform (Macrogen Inc., Seoul, Korea). The assembled sequences were aligned with viral reference genomes through searches performed using the BLASTn tool. Seven contigs (597-7,213 bp) revealed 92.09-97.37% nucleotide homology with RNAs of the isolate PerMV_Kochi_Nankoku_2011 (accession numbers LC496090 to LC496099) in the GenBank database. Other viruses including turnip mosaic virus and cucumber green mottle mosaic virus were not identified by HTS analysis (Cho et al., 2021; Park et al., 2020; Song et al., 2022). Seven RNA genomes of PerMV were confirmed by RT-PCR using specific primer sets designed to amplify part of each genome (Suppl. Table 1 and Fig. 2). The complete nucleotide sequences of PerMV (named IS isolate) RNA 1-7 were determined to be 7,177, 2,089, 1,094, 1,302, 1,079, 1,098, and 995 bp in length, respectively; these were deposited in GenBank (LC721296-LC721303). Sap from a symptomatic leaf sample confirmed for single infection was inoculated mechanically onto the leaves of 10 healthy P. frutescens seedlings, which developed the same PerMV symptoms within 3 weeks. These results indicate that PerMV is the causal agent of viral disease in Korean perilla plants cultivated in South Korea. To our knowledge, this is the first report of a perilla mosaic emaravirus infecting to Korean perilla, P. frutescens in South Korea.

First report of pepino mosaic virus infecting tomato in South Korea.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.

First report of a resistance-breaking strain of Tomato spotted wilt orthotospovirus infecting Capsicum annuum carrying the Tsw resistance gene in South Korea.

Tomato spotted wilt orthotospovirus (TSWV) was first reported in 2004 from paprika in South Korea (Kim et al., 2004), where it is currently widespread. TSWV infections were reported in chili pepper, tomato, weeds, and ornamental plant species in South Korea (Choi et al., 2014; Choi and Choi, 2015; Yoon et al., 2016; Yoon et al., 2018; Yoon et al., 2019). One of the best strategies for TSWV management is planting resistant cultivars containing the Tsw gene. In 2019 virus-like symptoms were observed in chili pepper (Capsicum annuum) plants bearing the Tsw gene in Anseong-si, South Korea. The infected chili peppers showed mosaic and wilting followed by necrosis on leaves and fruits in the field. To identify the causal virus, symptomatic leaf samples were analyzed using ImmunoStrip kits (Agdia, USA); we detected three pepper-infecting viruses: Pepper mild mottle virus, Cucumber mosaic virus, and TSWV. TSWV was only detected from 40 naturally infected chili pepper plants exhibiting virus-like symptoms. To further confirm the presence of TSWV (named TSWV-P1), we amplified reverse-transcription polymerase chain reaction (RT-PCR) products for L, M, and S RNA segments using tospovirus-specific and TSWV-specific primers (Batuman et al., 2014). Expected fragments of 445, 868, and 777 bp in length were amplified and sequenced. The complete genome sequences of TSWV-P1 from a symptomatic chili pepper plant were also determined using TSWV-specific primers (Choi et al., 2014; Lian et al., 2013). The complete genome sequences of TSWV-P1 were deposited to GenBank (LC549179, LC549180, and LC549181). The sequences of each fragment were identical to a consensus sequence, showing 99.1%, 98.5%, and 98.6% identity with TSWV-L, M, and S RNA (KP008132, AY744492, and KP008134), respectively. These results clearly showed only a single TSWV infection among the naturally infected chili pepper plants, without reassortment between TSWV and another tospovirus. To confirm whether TSWV-P1 is a resistance-breaking (RB) strain, Nicotiana rustica was mechanically inoculated with sap from leaves of the infected pepper samples to propagate TSWV-P1. A non-RB TSWV isolate (TSWV-Kor-lisianthus) from lisianthus was used as a control (Yoon et al., 2017). Two resistant (with Tsw) and two susceptible chili pepper cultivars (20 plants per cultivar) were mechanically inoculated with sap from leaves of the TSWV-infected N. rustica. The incidence rates of disease caused by TSWV-P1 were 90-100% for resistant and 95-100% for susceptible cultivars. In contrast, TSWV-Kor-lisianthus caused symptoms only in the susceptible pepper cultivars (90-100% incidence). TSWV infection in representative plants was confirmed using the TSWV- ImmunoStrip kit and RT-PCR. The NSs gene of TSWV-P1 consists of 1,404 nucleotides (468 amino acids); sequence analysis of the TSWV-P1 NSs gene showed high nucleotide (99.7%) and amino acid identities (99.8%) with the NSs sequences of two TSWV isolates (FR693035, CBX24121). Protein sequence analysis of TSWV-P1 NSs revealed that no amino acid mutation was associated with those of a representative TSWV RB strain, as previously described (Almási et al., 2017), suggesting that TSWV-P1 is a RB strain. Because this TSWV-P1 can overcome resistance conferred by the Tsw gene in commercially grown chili pepper cultivars, it represents a potential threat to pepper production in South Korea.

First report of Cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea.

In December 2018, virus-like symptoms (yellowing, vein clearing) were observed on 2% of muskmelon (Cucumis melo L.) plants in plastic houses on a farm in Gyeongsang province, Korea Total RNA from two symptomatic and two asymptomatic plants was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) for high throughput sequencing (HTS). After pre-processing and Ribo-Zero rRNA removal, a cDNA library was prepared (Illumina TruSeq Stranded Total RNA kit) and sequenced (Illumina NovaSeq 6000 system: Macrogen Inc. Korea). De novo assembly of 88,222,684 HTS reads with Trinity software (r20140717) yielded 146,269 contigs of 201-28,442 bp, which were screened against the NCBI viral genome database by BLASTn. Contigs from cucumber mosaic virus (CMV), melon necrotic spot virus (MNSV), tobacco mosaic virus (TMV) and watermelon mosaic virus (WMV) were identified, all previously reported in Korea. Two contigs (8,539 and 8,040 bp) with 99.9% sequence identity to distinct cucurbit chlorotic yellows virus (CCYV) isolates (JN641883, RNA1, Taiwan; MH819191, RNA2, China) were also identified. The ten sequences most closely related to each RNA of the Korean isolate (≥99% coverage, ≥99.6% nt identity) were from Japan, China, Taiwan, or Israel. CCYV presence was confirmed by reverse transcription-PCR (RT-PCR) using newly designed specific primers, RdRp-F/RdRp-R (5'-ACCGAACACTTGGCTATCCAA-3'/5'-CTTAATGCCGCGTATGAACTCA-3') span style="font-family:'Times New Roman'; letter-spacing:-0.5pt">and HSP-F/HSP-R (5'-TGAACGACACTGAGTTCATTCCTA-3'/5'-CGCCAAGATCGTACATGAGGAA-3'), against RNA dependent RNA polymerase (RdRp; RNA1) and the heat shock protein 70 homolog (HSP70h; RNA2). Symptomatic samples yielded products of expected sizes (RdRp,450 bp; HSP70h, 510 bp) while asymptomatic samples did not. The amplicons were cloned, and two clones of each were sequenced (BIONEER, Korea; GenBank acc. nos. LC592226 and LC592227) showing 100% and 99.2% nt identity with RdRp and HSP70h genes of Chinese CCYV isolate SD (MH819190 and MH819191, respectively) and other Asian isolates. Primers specific for CMV, WMV, beet pseudo-yellows virus (BPYV) (Okuda et al., 2007), TMV (Kim et al., 2018), MNSV (F/R, 5'-ATCTCGCATTTGGCATTACTC-3'/5'-ATTTGTAGAGATGCCAACGTA-3'), cucurbit yellow stunting disorder virus (CYSDV; Zeng et al., 2011) and cucurbit aphid-borne yellows virus (CABYV; F/R, 5'-CGGTCTATTGTCTGCAGTACCA-3'/5'- GTAGAGGATCTTGAATTGGTCCTCA-3') were also used. None of these viruses were detected in the symptomatic samples, but both asymptomatic plants were positive for CMV and WMV, and one also for MNSV. In June and September 2020, muskmelon and oriental melon (Cucumis melo L. var. makuwa) plants with yellowing disease (incidence 80-90%) and whiteflies were observed in all investigated plastic houses of one muskmelon and one oriental melon farm in Gyeonggi and Jeolla provinces. Symptomatic samples (14 muskmelon; 6 oriental melon) were collected and RT-PCR tested as above; 19/20 samples were positive for CCYV, but none for the other viruses. The oriental melon sequence (LC592895, LC592230) showed 99.7% and 100% nt identity with the RdRp and HSP70h genes of Chinese isolate SD, respectively. CCYV was first reported in Japan (Okuda et al., 2010), Taiwan, and China (Huang et al., 2010; Gu et al., 2011); to our knowledge, this is the first report of CCYV infecting muskmelon and oriental melon in Korea. Whitefly-transmitted CCYV could present a serious threat of yield losses to cucurbit crops in Korea, requiring control of vector populations to prevent spread of CCYV.

First report of Passiflora latent virus(Passiflora latent virus;PLV) infecting persimmon in Korea.

Passiflora latent virus (PLV), a member of the genus Carlavirus in the family Betaflexiviridae has been reported in Passiflora species in Australia, Germany, Israel, the United States, and New Zealand (Tang et al., 2008). In September 2019, leaves showing a virus-like disease with mosaic, curling and necrosis were collected from ten persimmon (Diospyros kaki Thunb.) orchards in Gyeongsang province, Korea. Total RNA from a pooled sample of leaves from 21 trees was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high throughput sequencing. After pre-processing and Ribo-Zero rRNA Removal, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo assembly of the 74,862,810 reads was performed using Trinity software (r20140717); the initially assembled 213,476 contigs were screened against the NCBI viral genome database using BLASTN. By these means, 12 contigs derived from PLV were identified. Contigs with lengths of 209 to 802 nt shared nt identities of 90.70 to 94.82% with PLV isolates, covering a total of 5,169 nt (~61.6% of the full PLV genome). Two additional viruses were also detected from the pooled sample: persimmon cryptic virus (PeCV) and persimmon virus A (PeVA). To confirm PLV infection, reverse transcription-polymerase chain reaction (RT-PCR) was performed using virus-specific primers, PLV-F (5'-ACACAAAACTGCGTGTTGGA-3') and PLV-R (5'-CAAGACCCACCTACCTCAGTGTG-3'), designed based on a 633 nt contig sequence in the polymerase gene. RT-PCR products of the expected 571 bp were obtained from two of 21 individual original samples; no asymptomatic plants were tested. Amplicons were cloned into the pGEM-T Easy Vector, and two clones per sample Sanger sequenced bidirectionally (BIONEER, Korea). The identical Sequence (GenBank LC556232) showed 99.65% nt identity to the contig, and 93.87% identity with the corresponding polymerase sequence of PLV-Rehovot isolate from passion fruit in Israel (MH379331). The two PLV positive samples showing leaf necrosis were also co-infected with PeVA, identified by RT-PCR using previously reported primers PeVAfor/ PeVArev (Morell et al., 2014), but not with PeCV (mixed with PeVA in only 1/21 plants; PeVA was found in 19/21 plants). None of the tested viruses were detected in two trees, displaying mosaic, and leaf curling, respectively. The foliar symptoms of PLV infection on passionfruit have been reported to vary throughout the year (Spiegel et al., 2007). No such observations in persimmon was possible, as the infected persimmon trees were removed and destroyed because they might pose a threat to the cultivation of passion fruits in Korea. To our knowledge, this is the first report of persimmon as a host of PLV anywhere in the world, and the first report of PLV in Korea in any host. A further survey is needed to determine possible presence of PLV on persimmon and Passiflora species.

Identification of rehmannia virus 1, a novel putative member of the genus Closterovirus, from Rehmannia glutinosa.

Transcriptome sequencing analysis of a symptomatic Rehmannia glutinosa plant revealed a virome containing two known RNA viruses and one novel virus. In this study, we examined the molecular and biological characteristics of the novel virus. The complete genome of the novel virus is composed of monopartite single-stranded RNA of 15,322 nucleotides with 69% nucleotide sequence identity (with 68% coverage) to tobacco virus 1. Its genome organization is typical of the members of the genus Closterovirus, containing nine putative open reading frames. Molecular and phylogenetic analyses of the genome and encoded protein sequences strongly support that the identified virus is a new species of the genus Closterovirus in the family Closteroviridae. The name rehmannia virus 1 (ReV1) is proposed for this novel virus.

Tyrosinase inhibitory components from Aloe vera and their antiviral activity.

A new compound, 9-dihydroxyl-2'-O-(Z)-cinnamoyl-7-methoxy-aloesin (1), and eight known compounds (2-9) were isolated from Aloe vera. Their structures were elucidated using 1D/2D nuclear magnetic resonance and mass spectra. Compound 9 exhibited reversible competitive inhibitory activity against the enzyme tyrosinase, with an IC50 value of 9.8 ± 0.9 µM. A molecular simulation revealed that compound 9 interacts via hydrogen bonding with residues His244, Thr261, and Val283 of tyrosinase. Additionally, compounds 3 and 7 were shown by half-leaf assays to exhibit inhibitory activity towards Pepper mild mottle virus.

Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.

The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.

Defense signaling pathways in resistance to plant viruses: Crosstalk and finger pointing.

Resistance to infection by plant viruses involves proteins encoded by plant resistance (R) genes, viz., nucleotide-binding leucine-rich repeats (NLRs), immune receptors. These sensor NLRs are activated either directly or indirectly by viral protein effectors, in effector-triggered immunity, leading to induction of defense signaling pathways, resulting in the synthesis of numerous downstream plant effector molecules that inhibit different stages of the infection cycle, as well as the induction of cell death responses mediated by helper NLRs. Early events in this process involve recognition of the activation of the R gene response by various chaperones and the transport of these complexes to the sites of subsequent events. These events include activation of several kinase cascade pathways, and the syntheses of two master transcriptional regulators, EDS1 and NPR1, as well as the phytohormones salicylic acid, jasmonic acid, and ethylene. The phytohormones, which transit from a primed, resting states to active states, regulate the remainder of the defense signaling pathways, both directly and by crosstalk with each other. This regulation results in the turnover of various suppressors of downstream events and the synthesis of various transcription factors that cooperate and/or compete to induce or suppress transcription of either other regulatory proteins, or plant effector molecules. This network of interactions results in the production of defense effectors acting alone or together with cell death in the infected region, with or without the further activation of non-specific, long-distance resistance. Here, we review the current state of knowledge regarding these processes and the components of the local responses, their interactions, regulation, and crosstalk.

RT-RPA Assay Combined with a Lateral Flow Strip to Detect Soybean Mosaic Virus.

Soybean (Glycine max L.) is one of the most widely planted and used legumes in the world, being used for food, animal feed products, and industrial production. The soybean mosaic virus (SMV) is the most prevalent virus infecting soybean plants. This study developed a diagnostic method for the rapid and sensitive detection of SMV using a reverse transcription-recombinase polymerase amplification (RT-RPA) technique combined with a lateral flow strip (LFS). The RT-RPA and RT-RPA-LFS conditions to detect the SMV were optimized using the selected primer set that amplified part of the VPg protein gene. The optimized reaction temperature for the RT-RPA primer and RT-RPA-LFS primer used in this study was 38℃ for both, and the minimum reaction time was 10 min and 5 min, respectively. The RT-RPA-LFS was as sensitive as RT-PCR to detect SMV with 10 pg/µl of total RNA. The reliability of the developed RT-RPA-LFS assay was evaluated using leaves collected from soybean fields. The RT-RPA-LFS diagnostic method developed in this study will be useful as a diagnostic method that can quickly and precisely detect SMV in the epidemiological investigation of SMV, in the selection process of SMV-resistant varieties, on local farms with limited resources.

Sequence comparisons of global chrysanthemum stunt viroid variants: multiple polymorphic positions scattered through the viroid genome.

The nucleotide sequences of cDNA clones of three chrysanthemum stunt viroid (CSVd) isolates (one each from the USA, China, and Australia) were determined and analyzed. The sequences of CSVd cDNA clones of the US and Australian isolates were both quasi-species, while the cDNA clones of the Chinese isolate contained only a single variant. A comparison of the nucleotide sequences of 117 isolates and cDNA clones obtained from 16 countries showed that in some cases identical CSVd isolates were found in several countries and from multiple locations within the same country. CSVd isolates differed as much in sequence between countries as within countries. Sequence variation was observed at 103 sites scattered through the CSVd genome, and was not associated predominantly with a single variable region, as was the case with several other viroids. While some sequence changes were associated with CSVd found in other host species, it is unknown if these changes are required for infection of those species.

Engineered resistance in potato against potato leafroll virus, potato virus A and potato virus Y.

Transgenic potato plants of Solanum tuberosum cultivar Vales Sovereign were generated that expressed fused, tandem, 200 bp segments derived from the capsid protein coding sequences of potato virus Y (PVY strain O) and potato leafroll virus (PLRV), as well as the cylindrical inclusion body coding sequences of potato virus A (PVA), as inverted repeat double-stranded RNAs, separated by an intron. The orientation of the expressed double-stranded RNAs was either sense-intron-antisense or antisense-intron-sense RNAs, and the double-stranded RNAs were processed into small RNAs. Four lines of such transgenic potato plants were assessed for resistance to infection by PVY-O, PLRV, or PVA, all transmitted by a natural vector, the green-peach aphid, Myzus persicae. Resistance was assessed by the absence of detectable virus accumulation in the foliage. All four transgenic potato lines tested showed 100% resistance to infection by either PVY-O or PVA, but variable resistance to infection by PLRV, ranging from 72 to 96% in different lines. This was regardless of the orientation of the viral inserts in the construct used to generate the transgenic plants and the gene copy number of the transgene. This demonstrates the potential for using tandem, fused viral segments and the inverted-repeat expression system to achieve multiple virus resistance to viruses transmitted by aphids in potato.

Outbreak of Rice Panicle Blast in Jeonbuk Province of Korea in 2021.

Rice panicle blast is one of the most serious diseases threatening stable rice production by causing severe damage to rice yields and quality. The disease is easy to occur under low air temperature and frequent heavy rainfall during the heading season of rice. In 2021, a rice panicle blast severely occurred in the Jeonbuk province of Korea. The incidence area of panicle blast accounted for 27.7% of the rice cultivation area of Jeonbuk province in 2021, which was 13.7-times higher than in 2019 and 2.6-times higher than in 2020. This study evaluated the incidence areas of rice panicle blast in each region of Jeonbuk province in 2021. The weather conditions during the heading season of rice, mainly cultivated rice cultivars, and the race diversity of the Jeonbuk isolates were also investigated. It will provide important information for the effective control of the rice panicle blast.

Comparative analysis of RNA silencing suppression activities between viral suppressors and an endogenous plant RNA-dependent RNA polymerase.

RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in eukaryotes, including higher plants. To counteract this, several plant viruses express silencing suppressors that inhibit RNA silencing in host plants. Here, we show that both 2b protein from peanut stunt virus (PSV) and a hairpin construct (designated hp-RDR6) that silences endogenous RNA-dependent RNA polymerase 6 (RDR6) strongly suppress RNA silencing. The Agrobacterium infiltration system was used to demonstrate that both PSV 2b and hp-RDR6 suppressed local RNA silencing as strongly as helper component (HC-Pro) from potato virus Y (PVY) and P19 from tomato bush stunt virus (TBSV). The 2b protein from PSV eliminated the small-interfering RNAs (siRNAs) associated with RNA silencing and prevented systemic silencing, similar to 2b protein from cucumber mosaic virus (CMV). On the other hand, hp-RDR6 suppressed RNA silencing by inhibiting the generation of secondary siRNAs. The small coat protein (SCP) of squash mosaic virus (SqMV) also displayed weak suppression activity of RNA silencing. Agrobacterium-mediated gene transfer was used to investigate whether viral silencing suppressors or hp-RDR6 enhanced accumulations of green fluorescence protein (GFP) and ß-glucuronidase (GUS) as markers of expression in leaf tissues of Nicotina benthamiana. Expression of both GFP and GUS was significantly enhanced in the presence of PSV 2b or CMV 2b, compared to no suppression or the weak SqMV SCP suppressor. Co-expression with hp-RDR6 also significantly increased the expression of GFP and GUS to levels similar to those induced by PVY HC-Pro and TBSV P19.

Genetic variability in the coat protein genes of Cymbidium mosaic virus isolates from orchids.

The variability in the nucleotide (nt) and amino acid (aa) sequences of the coat protein (CP) of Cymbidium mosaic virus (CymMV), which naturally infects orchids worldwide, was investigated. The CP genes of 55 CymMV isolates originating from different locations in Korea were amplified using RT-PCR and sequenced. The encoded CP consists of 223 aa. The CP sequences of the Korean isolates were compared with those of previously published CymMV isolates originating from different countries at both nt and aa levels. The Korean isolates shared 74.9-98.3 and 52.7-100% CP homology with CymMV isolates from other countries at the nt and aa levels, respectively. No particular region of variability could be found in either grouping of viruses. In the deduced CymMV CP aa sequence, the C-terminal region was more divergent than the N-terminal. The phylogenetic tree analysis based on nt sequence diversity of CP genes of CymMV isolates supported the hypothesis that CymMV isolates were divided into two subgroups. However, these subgroups were not formed by phylogenetic tree analysis of CP aa sequences. There was no distinct correlation between geographical locations and specific sequence identity, while recombination analysis revealed that there were no intra-specific recombination events among CymMV isolates.

The Virus-Induced Transcription Factor SHE1 Interacts with and Regulates Expression of the Inhibitor of Virus Replication (IVR) in N Gene Tobacco.

The transcription factor SHE1 was induced by tobacco mosaic virus (TMV) infection in tobacco cv. Samsun NN (SNN) and SHE1 inhibited TMV accumulation when expressed constitutively. To better understand the role of SHE1 in virus infection, transgenic SNN tobacco plants generated to over-express SHE1 (OEx-SHE1) or silence expression of SHE1 (si-SHE1) were infected with TMV. OEx-SHE1 affected the local lesion resistance response to TMV, whereas si-SHE1 did not. However, si-SHE1 allowed a slow systemic infection to occur in SNN tobacco. An inhibitor of virus replication (IVR) was known to reduce the accumulation of TMV in SNN tobacco. Analysis of SHE1 and IVR mRNA levels in OEx-SHE1 plants showed constitutive expression of both mRNAs, whereas both mRNAs were less expressed in si-SHE1 plants, even after TMV infection, indicating that SHE1 and IVR were associated with a common signaling pathway. SHE1 and IVR interacted with each other in four different assay systems. The yeast two-hybrid assay also delimited sequences required for the interaction of these two proteins to the SHE1 central 58-79% region and the IVR C-terminal 50% of the protein sequences. This suggests that SHE is a transcription factor involved in the induction of IVR and that IVR binds to SHE1 to regulate its own synthesis.

The Secret Life of the Inhibitor of Virus Replication.

The inhibitor of virus replication (IVR) is an inducible protein that is not virus-target-specific and can be induced by several viruses. The GenBank was interrogated for sequences closely related to the tobacco IVR. Various RNA fragments from tobacco, tomato, and potato and their genomic DNA contained IVR-like sequences. However, IVRs were part of larger proteins encoded by these genomic DNA sequences, which were identified in Arabidopsis as being related to the cyclosome protein designated anaphase-promoting complex 7 (APC7). Sequence analysis of the putative APC7s of nine plant species showed proteins of 558-561 amino acids highly conserved in sequence containing at least six protein-binding elements of 34 amino acids called tetratricopeptide repeats (TPRs), which form helix-turn-helix structures. The structures of Arabidopsis APC7 and the tobacco IVR proteins were modeled using the AlphaFold program and superimposed, showing that IVR had the same structure as the C-terminal 34% of APC7, indicating that IVR was a product of the APC7 gene. Based on the presence of various transcription factor binding sites in the APC7 sequences upstream of the IVR coding sequences, we propose that IVR could be expressed by these APC7 gene sequences involving the transcription factor SHE1.

Inhibitory Effects of Pepper Mild Mottle Virus Infection by Supernatants of Five Bacterial Cultures in Capsicum annuum L.

Pepper mild mottle virus (PMMoV), one of the most prevalent viruses in chili pepper (Capsicum annuum L.) is a non-enveloped, rod-shaped, single-stranded positive-sense RNA virus classified in the genus Tobamovirus. The supernatants of five bacterial cultures (Pseudomonas putida [PP], Bacillus licheniformis [BLI], P. fluorescens [PF], Serratia marcescens [SER], and B. amyloliquifaciens [BA]) were analyzed to find novel antiviral agents to PMMoV in chili pepper. Foliar spraying with supernatants (1:1, v/v) obtained from Luria-Bertani broth cultures of PP, BLI, PF, SER, and BA inhibited PMMoV infection of chili pepper if applied before the PMMoV inoculation. Double-antibody sandwich enzyme-linked immunosorbent assay showed that treatments of five supernatants resulted in 51-66% reductions in PMMoV accumulation in the treated chili pepper. To identify key compounds in supernatants of PP, BLI, PF, SER, and BA, the supernatants were subjected to gas chromatography-mass spectrometry. The 24 different types of compounds were identified from the supernatants of PP, BLI, PF, SER, and BA. The compounds vary from supernatants of one bacterial culture to another which includes simple compounds-alkanes, ketones, alcohols, and an aromatic ring containing compounds. The compounds triggered the inhibitory effect on PMMoV propagation in chili pepper plants. In conclusion, the cultures could be used to further conduct tissue culture and field trial experiments as potential bio-control agents.