RESUMEN
C1q is the central pattern-recognition molecule in the classical pathway of the complement system and is known to have a key role in the crossroads between adaptive and innate immunity. Hereditary C1q deficiency is a rare genetic condition strongly associated with systemic lupus erythematosus and increased susceptibility to bacterial infections. However, the clinical symptoms may vary. For long, the molecular basis of C1q deficiency was ascribed to only six different mutations. In the present report, we describe five new patients with C1q deficiency, present the 12 causative mutations described till now and review the clinical spectrum of symptoms found in patients with C1q deficiency. With the results presented here, confirmed C1q deficiency is reported in 64 patients from at least 38 families.
Asunto(s)
Complemento C1q/deficiencia , Complemento C1q/genética , Mutación , Sustitución de Aminoácidos , Niño , Preescolar , Femenino , Enfermedades Genéticas Congénitas/diagnóstico , Genotipo , Humanos , Masculino , LinajeRESUMEN
Chronic granulomatous disease (CGD) is characterized by the failure of phagocytic leukocytes to generate superoxide, needed for the intracellular killing of microorganisms. This is caused by mutations in any one of the four subunits of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. In a rare, autosomal recessive form of CGD, a 67-kD cytosolic component of this enzyme (p67-phox) is missing. We here report on a patient with a mutation in the p67-phox gene that leads to expression of a nonfunctional p67-phox protein. The purified granulocytes of this patient failed to produce superoxide and contained about half of the normal amount of p67-phox. Analysis of the cDNA and genomic DNA of this patient showed that the patient is a compound heterozygote for a triplet nucleotide deletion in the p67-phox gene, predicting an in-frame deletion of lysine 58 in the p67-phox protein and a larger deletion of 11-13 kb in the other allele. Interestingly, the 58Lys deletion in p67-phox disrupts the interaction with p21-rac1, a ras-related protein involved in the activation of the NADPH oxidase. In contrast to normal neutrophils, in which p47-phox and p67-phox translocate to the plasma membrane upon cell activation, the cells of the patient did not show this translocation, indicating that an interaction between p67-phox and p21-rac1 is essential for translocation of these cytosolic proteins and activation of the NADPH oxidase. Moreover, this CGD patient represents the first case of disease caused by a disturbed binding of a ras-related protein to its target protein.
Asunto(s)
Proteínas de Unión al GTP/metabolismo , Enfermedad Granulomatosa Crónica/etiología , Enfermedad Granulomatosa Crónica/genética , Mutación , Fosfoproteínas/genética , Transporte Biológico , Compartimento Celular , Niño , Chile/etnología , Femenino , Enfermedad Granulomatosa Crónica/clasificación , Humanos , NADPH Oxidasas , Fosfoproteínas/metabolismo , Proteínas Recombinantes de Fusión/metabolismo , Análisis de Secuencia de ADN , Proteínas de Unión al GTP racRESUMEN
A clinical comparison of tacrine (THA) and placebo was performed in 15 Alzheimer patients using a double blind crossover technique over 4 plus 4 weeks with one drug-free week in between. Treatment results, as evaluated by clinical rating scales and neuropsychological tests, were mostly negative. Side effects were few, except for elevation liver enzymes which occurred in one third of the patients. CSF levels of the monoamine metabolites HVA and 5-HIAA increased on tacrine as evidence for activation of dopamine and serotonin pathways through cholinergic receptors. Pharmacokinetic investigations showed that the oral bioavailability of tacrine was low and greatly varying between subjects. Patients with high bioavailability of the drug tended to improve more, and also to have more liver enzyme elevations, than those with low bioavailability. A gel preparation for rectal administration was manufactured for comparison of plasma levels attained during one week's treatment with levels attained with oral capsules. Preliminary results indicate that the dose of tacrine can be reduced to 50 per cent when administered rectally, probably as by this route the rapid first-pass metabolism of the drug in the liver is diminished. A clinical trial of tacrine via the rectal route would be justified as this could decrease the number of patients with liver side effects and increase the number of patients improving on the treatment.
Asunto(s)
Enfermedad de Alzheimer/tratamiento farmacológico , Tacrina/uso terapéutico , Administración Rectal , Enfermedad de Alzheimer/diagnóstico , Enfermedad de Alzheimer/metabolismo , Monoaminas Biogénicas/líquido cefalorraquídeo , Estudios Transversales , Método Doble Ciego , Femenino , Ácido Homovanílico/líquido cefalorraquídeo , Ácido Homovanílico/metabolismo , Humanos , Ácido Hidroxiindolacético/líquido cefalorraquídeo , Ácido Hidroxiindolacético/metabolismo , Hígado/efectos de los fármacos , Hígado/enzimología , Masculino , Pruebas Neuropsicológicas , Placebos , Tacrina/administración & dosificación , Tacrina/farmacologíaRESUMEN
Long interspersed nuclear element-1 (LINE-1) or L1 elements are DNA elements present in the genome in high copy number and capable of active retrotransposition. Here we present a patient with severe chronic granulomatous disease (CGD) caused by insertion of an L1 sequence into intron 5 of the X-lined gene CYBB. Due to internal rearrangements, the insert introduced new splice sites into the intron. This resulted in a highly heterogeneous splicing pattern with introduction of two L1 fragments as new exons into the transcripts and concomitant skipping of exonic coding sequence. Because no wild-type cDNA was found, this mechanism is probably responsible for the patient's phenotype. The L1 fragment, which belongs to the Ta subset of transcriptionally active LINEs, illustrates a new mechanism by which these elements can modify the transcribed coding sequence of genes.
Asunto(s)
Exones/genética , Enfermedad Granulomatosa Crónica/genética , Intrones/genética , Elementos de Nucleótido Esparcido Largo/genética , Mutagénesis Insercional/genética , Recombinación Genética , Adulto , Empalme Alternativo/genética , Secuencia de Bases , Preescolar , Resultado Fatal , Enfermedad Granulomatosa Crónica/enzimología , Enfermedad Granulomatosa Crónica/etiología , Humanos , Recién Nacido , Masculino , Glicoproteínas de Membrana/genética , Datos de Secuencia Molecular , NADPH Oxidasa 2 , NADPH Oxidasas/deficiencia , NADPH Oxidasas/genéticaRESUMEN
(S)- and (R)-[11C]nicotine were synthesized by methylation of (S)- and (R)-nornicotine using [11C]methyl iodide. Following their intravenous injection in tracer doses to smoking and nonsmoking healthy males the radioactivity in arterial blood showed a sharp peak at about 1 min followed by a plateau level for the remaining 50 min of recording. Uptake in the brain, as measured by positron emission tomography (PET), was rapid with a peak at 5 min followed by a steady decline towards the end of the measurement. The regional distribution of radioactivity followed essentially the distribution of gray matter with high uptake in the cortex, the thalamus and the basal ganglia and low uptake in the pons, cerebellum and white matter. Levels of the labelled natural enantiomer, (S)-[11C]nicotine, were higher than those of the synthetic enantiomer, (R)-[11C]nicotine, particularly in the smokers. The time-activity curves of (S)-[11C]nicotine uptake were not changed by co-administration of 1.0 mg of unlabelled nicotine with the labelled nicotine. Similarly administration of unlabelled nicotine at the peak of radioactivity, 6 min following (S)-[11C]nicotine, had no effect on the time-activity curves. Thus essential criteria for visualizing receptor binding with the PET technique could not be fulfilled. Calculation of kinetic constants using a two-compartment model gave values indicating that the brain uptake of [11C]nicotine is mainly determined by the cerebral blood flow, extraction of the tracer over the blood-brain barrier and unspecific binding. Thus 11C-labelled nicotine does not seem to be a suitable tracer for PET studies of nicotinic cholinergic receptors in the human brain.
Asunto(s)
Encéfalo/metabolismo , Nicotina/farmacocinética , Receptores Nicotínicos/metabolismo , Adulto , Encéfalo/diagnóstico por imagen , Isótopos de Carbono , Humanos , Masculino , Modelos Biológicos , Nicotina/sangre , Fumar/metabolismo , Estereoisomerismo , Tomografía Computarizada de EmisiónRESUMEN
The presence of macrophages and the induction of c-jun protein and proliferation of non-neuronal cells were studied following implantation of silicone tubes with different diameters (i.e. 0.8 or 1.6 mm) around the rat sciatic nerve. Three days after implantation, numerous EDI and ED2 positive macrophages could be observed around the nerve beneath the 1.6 mm tubes. Some EDI and ED2 positive macrophages were also present in the endoneurium. In contrast, there were numerous EDI and ED2 positive macrophages in the endoneurium beneath the tube and distally in nerves surrounded by the 0.8 mm tube. In these experiments, there was also a massive induction of c-jun protein and DNA synthesis in non-neuronal cells, as visualised by c-jun and BrdU antibodies respectively (e.g. a response similar to that observed after a crush lesion). Such activated cells, albeit few, were also present in the endoneurium beneath the tube of nerves with a 1.6 mm tube, but not distal to the tube in the endoneurium. At 7 days, the responses were somewhat amplified but essentially the same as at 3 days. The results showed that the large diameter implants, which do not cause axonal damage, as does the small diameter tube, but result in conditioning of the nerve [4], induced invasion of macrophages around the nerve and activation of some cells in the endoneurium beneath the tube. We suggest that cell activation is caused by factors released from macrophages and that endoneurial cell activation is important for the conditioning of the nerve by the silicone tube implant.
RESUMEN
One isoform of apolipoprotein E (apoE), a protein primarily involved in transport of lipids, is associated with an increased risk for Alzheimer's disease. Moreover, fragments of apoE are deposited in the amyloid that invariantly are found in brain tissue of disease victims. An intriguing possibility is therefore that increased levels of apoE are involved in the pathogenesis of the disease. Levels of full-length apoE in cerebrospinal fluid from 13 Alzheimer patients and 12 healthy controls were determined using Western blotting technique. Levels of the protein were essentially identical to previously reported findings and no difference between patients and healthy controls was found. Hence, it is concluded that increases in cerebrospinal fluid (CSF) levels of apoE are not involved in the pathogenesis of Alzheimer's disease and that measurement of CSF apoE levels does not seem to be useful as a diagnostic procedure.
Asunto(s)
Enfermedad de Alzheimer/líquido cefalorraquídeo , Apolipoproteínas E/líquido cefalorraquídeo , Anciano , Amiloide/metabolismo , Apolipoproteínas E/análisis , Western Blotting , Cromatografía en Gel , Femenino , Humanos , Masculino , Persona de Mediana Edad , Peso MolecularRESUMEN
In a previous pharmacokinetic study in Alzheimer patients great inter-individual variation and low oral bioavailability of the cholinesterase inhibitor tacrine (tetrahydroaminoacridine, THA) were found. In the present investigation oral and rectal administration of tacrine were compared with the aim to find a route for improved bioavailability through diminished first-pass metabolism in the liver. Eight patients suffering from Alzheimer's dementia were given tacrine by oral (25 and 50 mg b.i.d.) and rectal (12.5 and 25 mg b.i.d.) routes for 1 week with 4-6 weeks washout in between. Drug hydroxylation capacity in the patients was determined using the debrisoquine test. Levels of tacrine in plasma and cerebrospinal fluid (CSF) were determined and the cognitive performance was examined by the Mini-Mental State Examination (MMSE) and the Alzheimer Deficit Assessment Scale (ADAS). Tacrine was well tolerated in all but one patient, a slow hydroxylator, who developed an aplastic anemia. MMSE and ADAS scores did not significantly change, except for word recall which was improved on tacrine when given by the rectal route. Pharmacokinetic analysis of the two administration routes revealed that the drug dose may be reduced by almost 50% when given rectally compared to orally. Concentrations of tacrine in the CSF were significantly lower and correlated linearly with the concentrations in plasma.
Asunto(s)
Enfermedad de Alzheimer/tratamiento farmacológico , Tacrina/uso terapéutico , Administración Oral , Administración Rectal , Anciano , Disponibilidad Biológica , Femenino , Humanos , Masculino , Persona de Mediana Edad , Tacrina/administración & dosificación , Tacrina/farmacocinéticaRESUMEN
The pharmacokinetics of tetrahydroaminoacridine (THA) was studied in patients suffering from Alzheimer's dementia. Single doses of the drug were administered by intravenous (15 mg), oral (50 mg) and rectal routes (25 mg). Pharmacokinetic parameters were related to clinical and biochemical effects in patients who, in a separate study, participated in a clinical trial of oral THA. The bioavailability of THA was low and varied considerably between subjects. Clinical improvement and occurrence of elevated liver enzymes correlated positively with drug bioavailability. Acetyl and butyryl cholinesterase activities in the plasma did not change following THA administration. Rectally administered THA had a higher bioavailability than orally administered THA in three subjects who were given the drug by both routes. These results indicate that a clinical trial of rectal THA would be justified as this administration route may improve resorption and diminish first-pass metabolism of the drug in the liver compared with oral administration.
Asunto(s)
Enfermedad de Alzheimer/tratamiento farmacológico , Tacrina/farmacocinética , Administración Oral , Administración Rectal , Anciano , Enfermedad de Alzheimer/metabolismo , Disponibilidad Biológica , Femenino , Humanos , Inyecciones Intravenosas , Hígado/metabolismo , Masculino , Persona de Mediana Edad , Tacrina/administración & dosificación , Tacrina/sangreRESUMEN
The focus was to describe Swedish psychiatrists' experiences of collaboration with healthcare professionals when treating women with postpartum psychosis (PPP). A qualitative design was used, and semi-structured interviews were performed with nine psychiatrists working in psychiatric hospitals in Sweden. Data were analysed using manifest and latent content analysis. The results of these experiences were categorized in this study as: collaboration related to admission, collaboration during inpatient care and collaboration related to discharge. Collaboration with midwives and obstetricians was important in diagnosing the illness, as this often occurred on postnatal wards; and decisions about the form of care for the woman with PPP and for her baby demanded collaboration with various healthcare professionals. Collaboration with nurses was based on expectations and confidence in nurses' competence, and was exceedingly important during inpatient care. When the woman was to be discharged, collaboration with healthcare teams, e.g. outpatient clinic, child health clinic and community services, was required. The conclusions were that psychiatrists collaborate with different professionals in the various phases of the caring process. They rely extensively on nurses' competence when caring for women with PPP, and consider nurses to be their most important collaborators.
Asunto(s)
Conducta Cooperativa , Rol de la Enfermera , Periodo Posparto , Enfermería Psiquiátrica/métodos , Psiquiatría/métodos , Trastornos Psicóticos/terapia , Anciano , Competencia Clínica , Femenino , Humanos , Masculino , Persona de Mediana Edad , Trastornos Psicóticos/enfermería , SueciaRESUMEN
Several programs for coupling Sirognathograph to personal computer are available on the market (Maruyama's SGG Analyzing System Radke's Bio-Pac-Software, Fabris's Computersystem for Sirognathograph S) or are in various non commercial versions used in research (Lewin, Micheler, Proeschel). The COSIG System consists of the software and the hardware (Sirognathograph S--Siemens, XY 575 Recorder Esterline Angus, Personal computer IBM XT, IBM Graphics, Printer, A/D converter Tecmar Labmaster, Roland Plotter 880 DXY). The COSIG software records simultaneously X, Y, Z data from SGG, store and retrieve them. Mandibular movements are presented in time plot mode, in the three planes, in speed and acceleration plots, using different magnifications, direction color code, deliberate observation times, enables zero adjustments and storing of particular situation with comments on it within the file. Simultaneously graphic presentation goes by XY recorder, while stored data are screen printed by Graphic printer or color and black and white plotted by XY plotter. Standard patient examination using COSIG comprises three files i.e. border movement potential, contact movements and chewing standard bolus has been proposed.
Asunto(s)
Mandíbula/fisiología , Masticación , Diagnóstico por Computador , Humanos , Microcomputadores , Programas InformáticosRESUMEN
Interferon-gamma (IFN-gamma) is recommended as prophylaxis against infections in patients with chronic granulomatous disease (CGD). However, since the optimal dose, the dosing interval, and the mechanisms of action are not well-defined, we studied the effects on CGD neutrophil (PMN) functions ex vivo of interferon-gamma (IFN-gamma). Evaluations were made on oxidative capacity, measured by superoxide anion production and chemiluminescence after stimulation with f-met-leu-phe (f-MLP) or phorbol-myristate-acetate, the killing of Aspergillus fumigatus hyphae (assessed as conversion of the tetrazolium salt MTT to formazan), and on the expression of Fc gammaRI receptor (CD64). After randomization, 9 CGD patients (4 with gp91phox, 3 with p47phox, 1 with p67phox deficiency and 1 with unspecified CGD) were given IFN-gamma, either 50 or 100 microg/m2 subcutaneously on 2 consecutive days after double blinded randomization. Furthermore, one female hyperlyonized X-linked carrier with a CGD phenotype was also studied separately after IFN-gamma treatment. Evaluations were made the day before and on days 1, 3, 8, and 18 after IFN-gamma administration. The killing of A fumigatus hyphae, being close to zero before IFN-gamma, was enhanced on day 3, being 36% higher than pretreatment values in the high-dose CGD group and 17% in the low-dose group. The expression of Fc gammaRI on PMN increased 3.7-fold in the high-dose and 2.3-fold in the low-dose CGD group, being maximal on day 1. Oxidative functions were raised in only selected patients represented by different subtypes of CGD. The hyperlyonized carrier of X-linked CGD responded to IFN-gamma with more enhanced oxidative responses and Aspergillus killing of her PMNs than the other patients. This study suggests that a higher dose of IFN-gamma than currently recommended confers transient enhancements of certain PMN functions in CGD patients.
Asunto(s)
Enfermedad Granulomatosa Crónica/terapia , Interferón gamma/uso terapéutico , NADPH Oxidasas , Neutrófilos/fisiología , Adolescente , Adulto , Aspergillus , Niño , Relación Dosis-Respuesta a Droga , Método Doble Ciego , Femenino , Enfermedad Granulomatosa Crónica/sangre , Enfermedad Granulomatosa Crónica/genética , Humanos , Técnicas In Vitro , Interferón gamma/farmacología , Cinética , Mediciones Luminiscentes , Masculino , Glicoproteínas de Membrana/deficiencia , N-Formilmetionina Leucil-Fenilalanina/farmacología , NADH Deshidrogenasa/deficiencia , NADPH Deshidrogenasa/deficiencia , NADPH Oxidasa 2 , Neutrófilos/efectos de los fármacos , Fagocitosis/efectos de los fármacos , Fosfoproteínas/deficiencia , Proteínas Recombinantes , Superóxidos/sangre , Acetato de Tetradecanoilforbol/farmacología , Factores de TiempoRESUMEN
Fourteen patients suffering from dementia of the Alzheimer type were treated with tacrine (tetrahydroaminoacridine, THA) for 1 year in an open trial. Clinical results were evaluated every third month with neuropsychological tests and rating scales. During the dose-finding, two patients were temporarily withdrawn from medication and one patient was excluded because of elevated levels of liver enzymes. With individualized doses the treatment caused few side effects. Plasma levels of THA varied substantially among patients and correlated with elevation of liver enzymes but not with clinical response. Two patients showed a gradual increase in plasma levels of THA despite unchanged doses. Although results of the neuropsychological tests and clinical ratings were mostly negative, the study indicates that THA can be administered safely for prolonged periods of time. Clinical observations and dose-titration strategy in relation to side effects are discussed.
Asunto(s)
Enfermedad de Alzheimer/tratamiento farmacológico , Pruebas Neuropsicológicas , Nootrópicos/administración & dosificación , Tacrina/administración & dosificación , Anciano , Enfermedad de Alzheimer/sangre , Enfermedad de Alzheimer/psicología , Relación Dosis-Respuesta a Droga , Esquema de Medicación , Femenino , Humanos , Pruebas de Función Hepática , Masculino , Escala del Estado Mental , Tasa de Depuración Metabólica/fisiología , Persona de Mediana Edad , Nootrópicos/efectos adversos , Nootrópicos/farmacocinética , Tacrina/efectos adversos , Tacrina/farmacocinéticaRESUMEN
Activated polymorphonuclear neutrophil granulocytes (PMN) from patients with chronic granulomatous disease (CGD) show reduced electron-proton shifts and an inability to acidify the cell. We studied whether this impaired pH-regulating capacity affected PMN membrane potential changes and the kinetics of homotypic aggregation by changing the extracellular pH over a wide range. At pH 7.4 normal PMN showed a rapid, transient membrane depolarization to leukotriene B4 (LTB4) and a slower response to N-formyl-methionyl-leucyl-phenylalanine. In contrast, PMN from 13 patients with CGD exhibited no or minute depolarization to these stimuli and 77% of tested patients with CGD displayed absence or marked reductions of the disaggregation to LTB4. On acidification of pH 5.0 to 6.4, PMN membrane depolarization appeared in six of nine tested patients. Likewise, disaggregation became evident in all of three patients. On alkalinization of normal PMN to pH 8.0 to 9.0, membrane depolarization and disaggregation to LTB4 disappeared, and cells reacted as CGD PMN. This change was not due to inefficient signal transduction, because normal PMN enhanced the superoxide ion production to N-formyl-methionyl-leucyl-phenylalanine on this alkalinization. Cytosolic pH changes in resting and LTB4-activated CGD cells at pH 6.0, 7.4, and 8.5 were similar those in control cells but for absence of an initial acidification. Thus neutrophil membrane potential changes and aggregation kinetics to LTB4 are abnormal in patients with CGD and return toward normal on extracellular acidification.
Asunto(s)
Enfermedad Granulomatosa Crónica/fisiopatología , Neutrófilos/fisiología , Adolescente , Adulto , Aniones/metabolismo , Agregación Celular/efectos de los fármacos , Niño , Femenino , Humanos , Concentración de Iones de Hidrógeno , Cinética , Leucotrieno B4/farmacología , Mediciones Luminiscentes , Masculino , Potenciales de la Membrana/efectos de los fármacos , Neutrófilos/efectos de los fármacos , Nitroazul de Tetrazolio , Valores de Referencia , Superóxidos/metabolismoRESUMEN
Urogenital specimens from 445 patients, 174 women and 271 men, were tested for antigen to Chlamydia trachomatis by an enzyme amplified immunoassay, IDEIA. The test results for specimens stored at -20 degrees C for means of 9.6 weeks (from each of the first 376 patients) and eight months (from the remaining 69) were compared with results for specimens stored at 4 degrees C and tested within five days. Of 617 specimens (one from the urethra of each patient and one from the cervices of 172 women) cultured for C trachomatis, 90 (15%) gave positive results. The IDEIA results for specimens stored at -20 degrees C were identical with those of specimens analysed without such storage in 96.4% (595/617) of all cases. No difference was seen between urethral specimens from men or women or cervical specimens or between specimens stored for 9.6 weeks compared with those stored for eight months. In 22 cases in which the IDEIA results differed, culture positive results were missed in stored as well as unstored specimens. The median absorbance value above the cut off point for a positive IDEIA result in stored specimens was no lower than in those not stored. The few differences noted probably depended on the sampling technique rather than on the way of storing the specimens.
Asunto(s)
Antígenos Bacterianos/análisis , Chlamydia trachomatis/inmunología , Congelación , Técnicas para Inmunoenzimas , Manejo de Especímenes/métodos , Adolescente , Adulto , Anciano , Femenino , Humanos , Masculino , Persona de Mediana Edad , Sistema Urogenital/microbiologíaRESUMEN
The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.