RESUMEN
The first absolute experimental determinations of the differential cross sections for the formation of ground-state positronium are presented for He, Ar, H2, and CO2 near 0°. Results are compared with available theories. The ratio of the differential and integrated cross sections for the targets exposes the higher propensity for forward emission of positronium formed from He and H2.
RESUMEN
In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5'-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.
RESUMEN
Hidradenitis suppurativa (HS) is a frustrating disease to treat for both the patient and the practitioner. In severe cases, aggressive management will often have a more tolerable outcome. We present the case of a 46-year-old gentleman with a long-standing history of severe HS, who was treated successfully with wide surgical excision, followed by a full-thickness skin graft and negative pressure wound therapy (both pre- and post-operatively). A review of the literature revealed few reports of HS treatment using these sequential steps.
Asunto(s)
Hidradenitis Supurativa/terapia , Terapia de Presión Negativa para Heridas/métodos , Biopsia , Hidradenitis Supurativa/diagnóstico , Hidradenitis Supurativa/epidemiología , Hidradenitis Supurativa/etiología , Humanos , Masculino , Persona de Mediana Edad , Atención Perioperativa/métodos , Índice de Severidad de la Enfermedad , Cuidados de la Piel/métodos , Trasplante de Piel , Resultado del TratamientoRESUMEN
Macromolecular Crystallography is a powerful and valuable technique to assess protein structures. Samples are commonly cryogenically cooled to minimise radiation damage effects from the X-ray beam, but low temperatures hinder normal protein functions and this procedure can introduce structural artefacts. Previous experiments utilising acoustic levitation for beamline science have focused on Langevin horns which deliver significant power to the confined droplet and are complex to set up accurately. In this work, the low power, portable TinyLev acoustic levitation system is used in combination with an approach to dispense and contain droplets, free of physical sample support to aid protein crystallography experiments. This method facilitates efficient X-ray data acquisition in ambient conditions compatible with dynamic studies. Levitated samples remain free of interference from fixed sample mounts, receive negligible heating, do not suffer significant evaporation and since the system occupies a small volume, can be readily installed at other light sources.
RESUMEN
16-O- Acetylvindoline (1a) was oxidatively transformed into an iminium derivative (2a) by copper oxidases (laccase and human ceruloplasmin), an unknown enzyme system(s) of Streptomyces griseus, and the chemical oxidizing agent 2,3-dichloro-5,6- dicyano -1,4-benzoquinone ( DDQ ). The iminium derivative (2a) was isolated from enzymatic and chemical oxidation mixtures and was identified by spectral and chemical techniques. Reduction of the iminium compound with sodium borodeuteride provided monodeuterated 16-O- acetylvindoline (1b) as the sole product. Mass spectral analysis indicated that the deuterium atom was introduced into position C-3 of the piperidine portion of the alkaloid structure. The location and stereochemistry of the deuterium atom were confirmed by high-field 1H and 2H NMR analyses of the deuterated product to be in the 2H alpha orientation. Hydrolysis of the 16-O-acetyl functional group from the iminium derivative (2a) resulted in the production of a previously identified dimer (5), which forms by intramolecular etherification through the reactive enamine (3). The iminium derivative (2a) reacts with cyanide to provide complex mixtures of products, one of which was identified by mass spectrometry as a cyanide addition product. The results confirm the existence of a reactive iminium intermediate formed by all of the biochemical and chemical systems examined.
Asunto(s)
Benzoquinonas , Iminas/metabolismo , Vinblastina/análogos & derivados , Ceruloplasmina/metabolismo , Lacasa , Espectroscopía de Resonancia Magnética , Oxidorreductasas/metabolismo , Quinonas/farmacología , Streptococcus/enzimología , Vinblastina/metabolismoRESUMEN
These studies suggest categorical perception effects may be much more general than has commonly been believed and can occur in apparently similar ways at dramatically different levels of processing. To test the nature of individual face representations, a linear continuum of "morphed" faces was generated between individual exemplars of familiar faces. In separate categorization, discrimination and "better-likeness" tasks, subjects viewed pairs of faces from these continua. Subjects discriminate most accurately when face-pairs straddle apparent category boundaries; thus individual faces are perceived categorically. A high correlation is found between the familiarity of a face-pair and the magnitude of the categorization effect. Categorical perception therefore is not limited to low-level perceptual continua, but can occur at higher levels and may be acquired through experience as well.
Asunto(s)
Cara , Percepción Visual , Expresión Facial , HumanosRESUMEN
Two nonprotein amino acids, cycasindene and cycasthioamide, along with eight known nonprotein amino acids, were isolated from the seeds of Cycas revoluta Thunb. The structures of cycasindene and cycasthioamide were elucidated as 3-[3'-amino-indenyl-2]-alanine (1) and N-[glycinyl-alaninyl-11-thio]-5-one-pipecolic acid (2) by chemical and spectral methods.
Asunto(s)
Alanina/análogos & derivados , Ácidos Pipecólicos/química , Ácidos Pipecólicos/aislamiento & purificación , Extractos Vegetales/química , Extractos Vegetales/aislamiento & purificación , Plantas/química , Alanina/química , Alanina/aislamiento & purificación , Espectroscopía de Resonancia Magnética , Semillas/químicaRESUMEN
The nature of the solution conformations of the alginic acid components D-mannuronan (poly-ManA) and L-guluronan (poly-GulA) from Azotobacter vinelandii were investigated by both one- and two-dimensional n.m.r. methods. Unequivocal proton assignments for both polymers as well as their constituent monomer units were made based on chemical-shift theory, coupling constant analysis, and nuclear Overhauser enhancement measurements. These data were used to investigate the interactions of poly-GulA and poly-ManA with Ca2+ ion in aqueous medium. Based on relative crosspeak integrals measured in two-dimensional phase-sensitive NOESY spectra of free and calcium-bound polymer, a model for calcium binding is proposed.
Asunto(s)
Alginatos/química , Azotobacter vinelandii/química , Calcio/química , Conformación de Carbohidratos , Secuencia de Carbohidratos , Ácido Glucurónico , Ácidos Hexurónicos/química , Espectroscopía de Resonancia Magnética , Datos de Secuencia Molecular , Ácidos Urónicos/químicaRESUMEN
The structure of colabomycin A (1) was elucidated by a detailed spectroscopic analysis. Two-dimensional NMR spectroscopy experiments provided assignments of the proton and carbon resonances of the tetraene carboxamide chains occurring in 1. The configurations of eight out of nine double bonds were determined by analysis of their coupling constants. The absolute configurations of C-4 (4S), C-5 (5R) and C-6 (6S) were established from the CD spectra of the parent compound and of 2-(6-oxo-2,4-hexadienoylamino)-5,6-epoxy-1,4-benzoquinone (2), which was obtained from 1 by mild chromic acid oxidation.
Asunto(s)
Antibacterianos , Alquenos , Espectroscopía de Resonancia Magnética , Conformación Molecular , Estructura MolecularRESUMEN
The use of 2D NMR techniques on unlabeled and biosynthetically multiple 13C-labeled samples enabled us to refine the 1H and 13C NMR spectral assignments for thiostrepton.
Asunto(s)
Antibacterianos , Tioestreptona , Isótopos de Carbono , Hidrógeno , Espectroscopía de Resonancia Magnética , Estructura Molecular , Tioestreptona/biosíntesisRESUMEN
The biogenetic origin of the angucycline antibiotics urdamycins A-D was studied by feeding experiments with isotope labeled precursors and by NMR analysis. Feeding experiments with [1-13C]acetate and [1,2-13C2]acetate show that the chromophores of urdamycins A and B and the angucycline 4-ring skeleton of the urdamycins C and D chromophores are formed from a single decapolyketide chain. The chromophores of the urdamycins C and D contain additional structural elements which derived from the amino acids tyrosine and tryptophan, respectively. The latter was shown by feeding deuterium-labeled tyrosine and 13C-labeled tryptophan derivatives. Feeding of [1-13C]glucose and of [U-13C3]glycerol proved that the C-glycosidic moiety and the three sugars (2 x L-rhodinose, 1 x D-olivose each) of the urdamycins arise from glucose. Experiments with 14C-labeled urdamycin A, obtained by biosynthesis from [14C]acetate, showed this compound to be a late precursor of the urdamycins C and D.
Asunto(s)
Aminoglicósidos , Antibacterianos/biosíntesis , Streptomyces/metabolismo , Acetatos/metabolismo , Antraquinonas/biosíntesis , Fenómenos Químicos , Química , Fermentación , Glucosa/metabolismo , Glicerol/metabolismo , Espectroscopía de Resonancia Magnética , Espectrometría de Masas , Estructura Molecular , Triptófano/análogos & derivados , Triptófano/metabolismo , Tirosina/metabolismoRESUMEN
The chemical structure of the new angucycline antibiotic landomycin A has been elucidated via chemical and spectroscopic methods, in particular by 2D NMR correlation spectroscopy, e.g., 1H, 1H-COSY, 13C, 1H-COSY, correlation spectroscopy via long-range-couplings and heteronuclear multiple bond connectivity spectroscopy sequences. The spectroscopic investigations were carried out principally with the octaacetyl derivative of landomycin A, which is more soluble in organic solvents than landomycin A itself. The structure consists of a new, unusual angucyclinone, landomycinone A, and of six deoxy sugars, four D-olivoses and two L-rhodinoses, which are all assembled in one chain thus forming the sequence (olivose-4----1-olivose-3----1-rhodinose)2. This long sugar chain is bonded as a phenolic glycoside to the aglycone moiety, a unique structural feature among quinone glycoside antibiotics. By comparison with the main component landomycin A, the structures of three minor congeners, namely landomycins B, C and D, could be proposed.
Asunto(s)
Aminoglicósidos , Antibacterianos , Streptomyces/metabolismo , Acetilación , Antibacterianos/análisis , Antibacterianos/aislamiento & purificación , Conformación de Carbohidratos , Secuencia de Carbohidratos , Cromatografía en Capa Delgada , Hidrólisis , Espectroscopía de Resonancia Magnética , Datos de Secuencia Molecular , Estructura Molecular , Análisis EspectralRESUMEN
The biosynthesis of terrecyclic acid A was investigated using 13C-labeled acetates and mevalonate. 13C NMR spectral analysis of isolated labeled terrecyclic acid demonstrated that the structure is assembled via an isoprene pathway.
Asunto(s)
Antibióticos Antineoplásicos/biosíntesis , Aspergillus/metabolismo , Acetatos/metabolismo , Isótopos de Carbono , Cromatografía Líquida de Alta Presión , Fermentación , Espectroscopía de Resonancia Magnética , Ácido Mevalónico/metabolismo , Sesquiterpenos/biosíntesisRESUMEN
Bacillomycin Lc, a new antifungal antibiotic of the iturin class, was isolated from a strain of Bacillus subtilis as a set of five congeners. The structure as determined by chemical and spectrometric analyses has been shown to differ from that of bacillomycin L by sequence changes from aspartate-1 to asparagine-1 and from glutamine-5 to glutamate-5. The five congeners differ from each other only in the structure of the aliphatic side chain of the constituent beta-amino acid. The hydrophobicity of the beta-amino acid affects the antifungal activity of the congener, as activity increased in the order of increased congener retention on a reversed-phase HPLC column.
Asunto(s)
Antifúngicos/aislamiento & purificación , Bacillus subtilis/metabolismo , Secuencia de Aminoácidos , Aminoácidos/análisis , Aminoácidos/química , Antifúngicos/química , Antifúngicos/farmacología , Fenómenos Químicos , Química Física , Cromatografía Líquida de Alta Presión , Hongos/efectos de los fármacos , Espectroscopía de Resonancia Magnética , Datos de Secuencia Molecular , Estructura Molecular , Péptidos Cíclicos/química , Péptidos Cíclicos/aislamiento & purificación , Péptidos Cíclicos/farmacología , Análisis de Secuencia , Espectrometría de Masa Bombardeada por Átomos VelocesRESUMEN
Feeding experiments with Actinoplanes sp. SN223/29 showed that 3-amino-5-hydroxy-[7-13C]benzoic acid is not incorporated into acarbose (I). The valienamine moiety of I is thus not derived in the same way, from the shikimate pathway, as the m-C7N units in the ansamycin, mitomycin and ansamitocin antibiotics. Feeding experiments with [U-13C3]-glycerol followed by analysis of I by multiple quantum NMR spectroscopy support this conclusion and point to formation of the valienamine moiety by cyclization of a heptulose phosphate which arises from a triose phosphate via successive transfer of two 2-carbon fragments by transketolase, as proposed by Pape and co-workers.
Asunto(s)
Hexosaminas/biosíntesis , Ácido Shikímico/metabolismo , Trisacáridos/biosíntesis , Acarbosa , Actinomycetales/metabolismo , Fenómenos Químicos , Química , Ciclohexenos , Glicerol/metabolismo , Inhibidores de Glicósido Hidrolasas , Espectroscopía de Resonancia MagnéticaRESUMEN
The 1H and 13C NMR spectra of nosiheptide have been assigned by use of 2D NMR techniques on unlabeled samples and biosynthetically multiple-labeled samples from stable isotope feeding experiments.
Asunto(s)
Antibacterianos , Isótopos de Carbono , Hidrógeno , Espectroscopía de Resonancia Magnética , Estructura Molecular , TiazolesRESUMEN
The objective of this research was to examine the speed of onset and effectiveness of pain relief between oral and intravenous morphine in acutely injured children. An observational study of children aged 3 to 13 years with closed forearm fractures was performed in three accident and emergency departments. The study gathered information on age, gender, body weight, time of arrival, dose, route and time of morphine administration. Pain assessment using a Faces Scale was documented on arrival and repeated at 10, 30 and 60 minutes after morphine was given. Forty-seven children were studied. Of these, 25 were given intravenous morphine, 22 were given oral morphine. There was no statistically significant difference in age, body weight or time until morphine was administered. The change in median pain scores was analysed using the Mann-Whitney U test. This showed that there was a statistically significant reduction in pain score in the intravenous group compared with the oral group between arrival and 10 minutes after giving morphine and between arrival and 60 minutes after giving morphine. Intravenous morphine appears to give more rapid onset and more prolonged pain relief than oral morphine for children with acute injuries. We recommend that in accident and emergency departments where staff are experienced in paediatric cannulation, morphine should be given via the intravenous route in acutely injured children. However we do not advocate inexperienced staff attempting multiple venepunctures in a child resulting in increased anxiety.
Asunto(s)
Analgésicos Opioides/administración & dosificación , Huesos de la Extremidad Superior/lesiones , Fracturas Cerradas/complicaciones , Morfina/administración & dosificación , Dolor/tratamiento farmacológico , Administración Oral , Adolescente , Atención Ambulatoria , Niño , Preescolar , Femenino , Humanos , Inyecciones Intravenosas , Masculino , Dolor/etiología , Dimensión del Dolor/métodos , Resultado del TratamientoRESUMEN
There are few data on committing suicide by jumping from a height. Information on suicidal high falls in southeast Scotland was prospectively gathered over 7 years (1992-1998). Data sources included ambulance, police, hospital and forensic records. Injuries sustained were scored according to the Abbreviated Injury Scale, generating Injury Severity Scores (ISS). Sixty-three individuals (50 males), appeared to have committed suicide by falling from a height. The backgrounds were diverse, but 44 individuals had known previous psychiatric illness, 18 having attempted suicide before. The most common locations were high bridges, with two accounting for 23 deaths (37%). Only nine individuals (14%) reached hospital alive. ISS range was 16-75, including 22 scores of 75. These individuals had a total of 24 injuries acknowledged to be unsurvivable, comprising 10 thoracic aortic ruptures, eight massive brain/brainstem injuries, four cardiac injuries, and two high spinal cord transections. The high rate of prehospital death reflects the heights of the falls and consequent major injuries. Prevention of suicide is acknowledged to be difficult - these results suggest that hospital treatment of injuries sustained has little to offer in terms of reducing the death rate from suicidal high falls.
RESUMEN
In the mountain climbing community, conventional prevention of altitude mountain sickness (AMS) relies primarily on a formal acclimatization period. AMS symptoms during mountaineering climbs are managed with medication, oxygen and minor recompression (1524-2438 m altitude) using a portable chamber, such as the Gamow Bag. This is not always an acceptable therapy alternative in a predominantly elderly tourist population. The primary problem with reduced pressure at high altitude is hypoxaemia, which causes increased sympathetic activity, induces pulmonary venous constriction, while increasing pulmonary blood flow and regional perfusion. Rapid assents to altitude contribute to an increased incidence of decompression sickness (DCS). The treatment of choice for DCS is hyperbaric oxygenation, thus, treatment of high-altitude induced hypoxaemia using hyperbaric oxygenation (HBO(2)) is logical. Life Support Technologies group and the Center for Investigation of Altitude Medicine (CIMA, in Cusco, Peru) propose a comprehensive and multidisciplinary approach to AMS management. This approach encompasses traditional and advanced medical interventions including the use of a clinical HBO(2) chamber capable of recompression to three times greater than sea level pressure (3 atmosphere absolute (ATA)). The system uses a series of AMS hyperbaric treatment profiles that LST has previously developed to the US military and NASA, and that take greater advantage of vasoconstrictive effects of oxygen under true hyperbaric conditions of 1.25 ATA. These profiles virtually eliminate AMS rebound after the initial treatment often seen in conventional AMS treatment, where the patient is either treated at altitude, or does not recompress back to sea level or greater pressure (1.25 ATA), but returns directly to the same altitude where AMS symptoms first manifested.
Asunto(s)
Mal de Altura/fisiopatología , Mal de Altura/terapia , Oxigenoterapia Hiperbárica , Mal de Altura/complicaciones , HumanosRESUMEN
Positronium (Ps), a hydrogen-like atom composed of an electron and its antimatter partner, the positron, is formed in considerable quantities whenever positrons interact with matter. It has unexpectedly been found to scatter from a wide variety of atoms and molecules in a way very similar to that of a bare electron moving at the same velocity, despite Ps being neutral and twice the mass.