Identification of Maize Kernel Endosperm Proteins Associated with Resistance to Aflatoxin Contamination by Aspergillus flavus.

ABSTRACT Aflatoxins are carcinogens produced mainly by Aspergillus flavus during infection of susceptible crops such as maize (Zea mays). Previously, embryo proteins from maize genotypes resistant or susceptible to A. flavus infection were compared using proteomics, and resistance-associated proteins were identified. Here, we report the comparison of maize endosperm proteins from five resistant and five susceptible genotypes, and the identification of additional resistance-associated proteins using the same approach. Ten protein spots were upregulated twofold or higher in resistant lines compared with susceptible ones. Peptide sequencing of these proteins identified them as a globulin-2 protein, late embryogenesis abundant proteins (LEA3 and LEA14), a stress-related peroxiredoxin antioxidant (PER1), heat-shock proteins (HSP17.2), a cold-regulated protein (COR), and an antifungal trypsin-inhibitor protein (TI). The gene encoding one such upregulated protein, PER1, was cloned and overexpressed in Escherichia coli. The overexpressed PER1 protein demonstrated peroxidase activity in vitro. In addition, per1 expression was significantly higher in the resistant genotype Mp420 than in the susceptible genotype B73 during the late stage of kernel development, and was significantly induced upon A. flavus infection, suggesting that it may play an important role in enhancing kernel stress tolerance and aflatoxin resistance. The significance of other identified proteins to host resistance and stress tolerance also is discussed.

Identification of a Maize Kernel Pathogenesis-Related Protein and Evidence for Its Involvement in Resistance to Aspergillus flavus Infection and Aflatoxin Production.

ABSTRACT Aflatoxins are carcinogens produced by Aspergillus flavus and A. parasiticus during infection of susceptible crops such as maize. Several aflatoxin-resistant maize genotypes have been identified and kernel proteins have been suggested to play an important role in resistance. In the present study, one protein (#717), which was expressed fivefold higher in three resistant lines compared with three susceptible ones, was identified using proteomics. This protein was sequenced and identified as a pathogenesis-related protein (PR-10) based on its sequence homology. To assess the involvement of this PR-10 protein (ZmPR-10) in host resistance of maize against fungal infection and aflatoxin production, the corresponding cDNA (pr-10) was cloned. It encodes a protein of 160 amino acids with a predicted molecular mass of 16.9 kDa and an iso-electric point of 5.38. The expression of pr-10 during kernel development increased fivefold between 7 and 22 days after pollination, and was induced upon A. flavus infection in the resistant but not in the susceptible genotype. The ZmPR-10 overexpressed in Escherichia coli exhibited a ribonucleolytic and antifungal activities. Leaf extracts of transgenic tobacco plants expressing maize pr-10 also demonstrated RNase activity and inhibited the growth of A. flavus. This evidence suggests that ZmPR-10 plays a role in kernel resistance by inhibiting fungal growth of A. flavus.

Identification of unique or elevated levels of kernel proteins in aflatoxin-resistant maize genotypes through proteome analysis.

ABSTRACT Aflatoxins are carcinogens produced by Aspergillus flavus and A. parasiticus during infection of susceptible crops such as maize (Zea mays L.). Resistant maize genotypes have been identified, but the incorporation of resistance into commercial lines has been slow due to the lack of selectable markers. Here we report the identification of potential markers in resistant maize lines using a proteomics approach. Kernel embryo proteins from each of two resistant genotypes have been compared with those from a composite of five susceptible genotypes using large format two-dimensional gel electrophoresis. Through these comparisons, both quantitative and qualitative differences have been identified. Protein spots have been sequenced, and based on peptide sequence homology analysis, are categorized as follows: storage proteins (globulin 1 and globulin 2), late embryogenesis abundant (LEA) proteins related to drought or desiccation (LEA3 and LEA14), water- or osmo-stress related proteins (WSI18 and aldose reductase), and heat-stress related proteins (HSP16.9). Aldose reductase activity measured in resistant and susceptible genotypes before and after infection suggests the importance of constitutive levels of this enzyme to resistance. Results of this study point to a correlation between host resistance and stress tolerance. The putative function of each identified protein is discussed.

Identification of a maize kernel stress-related protein and its effect on aflatoxin accumulation.

ABSTRACT Aflatoxins are carcinogens produced mainly by Aspergillus flavus during infection of susceptible crops such as maize. Through proteomic comparisons of maize kernel embryo proteins of resistant and susceptible genotypes, several protein spots previously were found to be unique or upregulated in resistant embryos. In the present study, one of these protein spots was sequenced and identified as glyoxalase I (GLX-I; EC 4.4.1.5). The full-length cDNA of the glyoxalase I gene (glx-I) was cloned. GLX-I constitutive activity was found to be significantly higher in the resistant maize lines compared with susceptible ones. After kernel infection by A. flavus, GLX-I activity remained lower in susceptible genotypes than in resistant genotypes. However, fungal infection significantly increased methylglyoxal (MG) levels in two of three susceptible genotypes. Further, MG was found to induce aflatoxin production in A. flavus culture at a concentration as low as 5.0 muM. The mode of action of MG may be to stimulate the expression of aflR, an aflatoxin biosynthesis regulatory gene, which was found to be significantly upregulated in the presence of 5 to 20 muM MG. These data suggest that GLX-I may play an important role in controlling MG levels inside kernels, thereby contributing to the lower levels of aflatoxins found in resistant maize genotypes.

Sources of resistance to aflatoxin production in maize.

Drought-tolerant maize genotypes (Huffman, Z08-004, Tuxpan, PH 9, NRC 5348, Chunco, Saint Croix, and Arizona) were compared in the field and laboratory to toxin-resistant GT-MAS:gk and Yellow Creole. SDS-PAGE, scanning electron microscopy of kernel cuticle, amount of kernel wax, Aspergillus flavus kernel colonization, Aspergillus ear rot, insect damage, aflatoxin production, and their relationships were examined. SDS-PAGE showed the presence of a 14 kDa trypsin inhibitor in the kernels of all genotypes except Chunco, which contains a protein of a larger molecular weight. The 14 kDa trypsin inhibitor protein content in these genotypes was higher than in GT-MAS:gk and Yellow Creole. Scanning electron microscopy revealed that Arizona, Huffman, and Chunco genotypes had abundant wax deposits on kernel surfaces and the amount of pericarp wax was equal to or above that from GT-MAS:gk and Yellow Creole. Differences in Aspergillus ear rot ratings, fungal colonization, and insect damage by corn earworm were observed in all drought-tolerant maize genotypes as well as in the controls. Kernel screening assays showed that aflatoxin B(1) levels in inoculated drought-tolerant genotypes differed significantly from those in GT-MAS:gk and Yellow Creole (LSD = 576). Aflatoxin B(1) levels in the inoculated genotypes differed significantly from those of GT-MAS:gk or Yellow Creole (LSD = 1389) when grown under drought stress conditions. Pearson correlation coefficients were significant between ear rot ratings and insect damage (r = 0.75; P = 0.01) and between Aspergillus ear rot and aflatoxin levels (r = 0.54; P = 0.05). On the basis of the parameters studied, there are indications that these genotypes were potential sources of A. flavus resistance.

Nitrogen fertilizer influence on aflatoxin contamination of corn in Louisiana.

Studies were conducted in 1997 and 1998 on a Gigger silt loam at the Macon Ridge Research Station at Winnsboro, LA, to determine the influence of nitrogen (N) rate, timing, and starter nitrogen fertilizer on aflatoxin contamination in corn. Fertilizer N (0, 50, 100, 150, 200, and 250 lb of N/acre), two timings (at planting and six-leaf stage), and starter N fertilizer (a control and 10 lb of N/acre applied in furrow) were evaluated. Application of starter, N rates, and the interaction of starter with N timing and N rates significantly affected aflatoxin levels. Rates of 50-250 lb of N/acre were 34-43% lower in aflatoxin contamination than plots receiving no N. The application of 10 lb of N/acre starter reduced the aflatoxin levels by 20% compared to the no-starter control.

Glufosinate-ammonium reduces growth and aflatoxin B1 production by Aspergillus flavus.

The herbicide glufosinate-ammonium (GA) [butanoic acid, 2-amino-4-(hydroxymethylphosphinyl)-ammonium salt] was tested at concentrations from 2 to 2,000 g GA per ml for activity against growth and aflatoxin B1 (AFB) production by the mycotoxigenic fungus Aspergillus flavus Link:Fr. The highest concentration (2,000 microg GA per ml) reduced colony diameter of A. flavus strain AF13 by 80%. AFB1 production was inhibited by 90% at this concentration. Reduction in mycelial dry weight and AFB1 production in response to GA application ranged from 17.2 to 97.1% and from 39.1 to 90.1%, respectively. Of four concentrations tested, 2 microg GA per ml was weakly inhibitory. In the kernel screening assay, AFB1 production was inhibited 60 to 91% when kernels were preimmersed or immersed 5 days after incubation in 200 microg GA per ml. Both concentrations (2 and 200 microg GA per ml) reduced seed germination by 25 to 50%. Results indicate that GA has an inhibitory effect on growth and AFB1 production by A. flavus.

Spread and Increase of Ratoon Stunting Disease of Sugarcane and Comparison of Disease Detection Methods.

The spread and increase of ratoon stunting disease (RSD) resulting from two mechanical harvests were compared in eight sugarcane cultivars at two locations. RSD spread and increase were detected in the ratoon crops grown after each harvest and varied among cultivars and locations. Disease spread and increase were greater in plants grown from stalks collected at the first harvest than in the first ratoon growth from the harvested field. RSD infection was determined using five disease detection methods: alkaline-induced metaxylem autofluorescence; microscopic examination of xylem sap; and dot blot, evaporative-binding, and tissue blot enzyme immunoassays. The tissue blot enzyme immunoassay was the most accurate RSD detection method. The dot blot and evaporative-binding enzyme immunoassays were the least sensitive for detection of RSD-infected stalks, and alkaline-induced metaxylem autofluorescence was least accurate for correct identification of noninfected stalks. The results indicate that disease spread and increase are variable even among cultivars susceptible to yield loss due to RSD, and the greatest threat of disease spread and increase occurs at planting.

Infectivity Titration for Assessing Resistance to Leaf Scald Among Sugarcane Cultivars.

Greenhouse experiments were conducted to determine potential of infectivity titration to evaluate resistance of sugarcane to leaf scald disease caused by Xanthomonas albilineans. In two experiments, single-bud cuttings were inoculated with suspensions containing 101, 105, or 108 CFU/ml of X. albilineans. The occurrence of symptoms was recorded every 15 days from 45 to 210 days after inoculation. At the final evaluation date, leaf vascular sap was plated onto selective medium to detect latent infections. ED50 (log10 of the bacterial concentration required to infect 50% of inoculated plants) was estimated for each cultivar based on probit analysis of cumulative infection frequency. Frequency of infected plants varied among inoculum doses and cultivars and resulted in ED50 values ranging from 3.0 to 12.3 and 3.1 to 9.8 in the first and second experiments, respectively. Good agreement between experiments was observed for ED50 values of individual cultivars. Differences in ED50 among cultivars agreed with field observations of natural disease incidence. Cultivar responses to leaf scald were compared based on the cumulative frequencies of death and recovery in symptomatic plants, and the frequencies of symptomatic plants observed at different evaluation dates for plants inoculated with 108 CFU/ml of X. albilineans. Good agreement between ED50 values and these responses was observed. Greenhouse inoculation tests using infectivity titration or just one inoculum concentration could provide an alternative to field tests for the assessment of sugarcane resistance to leaf scald.

A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease.

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

Xanthomonas albilineans diversity and identification based on rep-PCR fingerprints.

PCR with BOX and ERIC primers was used to analyze DNA of Xanthomonas albilineans and other bacteria associated with sugarcane. Generated fingerprints permitted clear separation of X. albilineans from other bacteria and revealed variation within the species. Good agreement between fingerprint groups and geographic origin and serovars was observed.