Enzyme-instructed and mitochondria-targeting peptide self-assembly to efficiently induce immunogenic cell death

Immunogenic cell death (ICD) plays a major role in cancer immunotherapy by stimulating specific T cell responses and restoring the antitumor immune system. However, effective type II ICD inducers without biotoxicity are still very limited. Herein, a tentative drug- or photosensitizer-free strategy was developed by employing enzymatic self-assembly of the peptide F-pY-T to induce mitochondrial oxidative stress in cancer cells. Upon dephosphorylation catalyzed by alkaline phosphatase overexpressed on cancer cells, the peptide F-pY-T self-assembled to form nanoparticles, which were subsequently internalized. These affected the morphology of mitochondria and induced serious reactive oxygen species production, causing the ICD characterized by the release of danger-associated molecular patterns (DAMPs). DAMPs enhanced specific immune responses by promoting the maturation of DCs and the intratumoral infiltration of tumor-specific T cells to eradicate tumor cells. The dramatic immunotherapeutic capacity could be enhanced further by combination therapy of F-pY-T and anti-PD-L1 agents without visible biotoxicity in the main organs. Thus, our results revealed an alternative strategy to induce efficient ICD by physically promoting mitochondrial oxidative stress.

The complete mitochondrial genome of Cleithenes herzenstein and its phylogenetic analysis.

The complete mitochondrial genome of Stewartia sinensis was obtained with long PCR approach. Amplification primers were designed according to mitogenome sequences of some other fish species. PCR reactions were according to Kong et al. ( 2009 ). The complete mitochondria sequence of Cleithenes herzenstein was deposited in GenBank under the accession number KT223828. Structural and evolutionary analyses were also performed. The length of the complete mitochondrial DNA sequence was 17 175 bp, consisting of 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. Other than D-loop, another non-coding region named ''OL'' region was found ( Table 1 ). The ''OL'' region (CTTTTTCCCGCCTAGTTTAACCAGTAAAAGGCGGGAA) is 38 bp and has the potential to fold into a stem-loop secondary structure. Most of the genes were encoded on the heavy strand (H strand) except for ND6 and eight tRNA genes ( Table 1 ). The base composition and gene arrangement of C. herzenstein mitogenome was identical to typical vertebrate. For sequence alignment, the mitogenome sequence of C. herzenstein was 96% and 95% similar to that of Platichthys stellatus and Verasper moseri, respectively.