Rectangular-shaped expanded phthalocyanines with two central metal atoms.

Expanded phthalocyanine (Pc) congeners with two Mo or W central metal ions and four isoindole ring moieties have been synthesized using normal Pc formation conditions in the presence of urea. The products have been characterized by electrochemistry; mass spectrometry (MS); IR, electron paramagnetic resonance (EPR), NMR, electronic absorption, and magnetic circular dichroism (MCD) spectroscopies; and X-ray analysis. The X-ray structures have rectangular C(2v) symmetry and provide evidence that the central Mo atoms are linked by a single bond and coordinated by two isoindole nitrogen atoms and two nitrogen atoms from the amine moieties. The electronic absorption bands extend into the 1200-1500 nm region. This can be explained using Gouterman's four-orbital theory. The experimental NMR data and theoretical calculations provide evidence for a heteroaromatic 22-π-electron conjugation system for the ring-expanded Pc system, which satisfies Hückel's (4n + 2)π aromaticity.

Photodynamic activity of dibiotinylated aluminum sulfophthalocyanine in vitro and in vivo.

The photodynamic activity of dibiotinylated aluminum sulfophthalocyanine was studied in vitro and in vivo. Dibiotinylated aluminum sulfophthalocyanine provided enhanced phototoxic action on OAT-75 cell monolayers as compared with the parent drug. Photodynamic therapy of mice with Ehrlich carcinoma using dibiotinylated aluminum sulfophthalocyanine (0.25 mg/kg) resulted in enhanced inhibition of tumor growth, pronounced vascular damage (thrombosis and destruction of vascular walls) and eventual tumor necrosis.

Chelation with metal is not essential for antitumor photodynamic activity of sulfonated phthalocyanines.

It is generally assumed that a central metal is essential for the efficiency of phthalocyanines in photodynamic therapy (PDT) of cancer. Contrary to the set opinion, the results of the present study indicate that the metal-free sulfonated phthalocyanines (H2PcSn, where n is the number of sulfonate groups per molecule) possess a considerable photoactivity. The relative phototoxicities of H2PcS1.5, H2PcS2.4, H2PcS3.1 and H2PcS3.8 on HEp2 human epidermoid carcinoma cells were 3.3, 20, 3.3 and 1, respectively, thus demonstrating dependence of the activity on the sulfonation degree, known for metallo-PcSn. A significant delay in tumor growth and a decrease in tumor regrowth rate were observed in mice after PDT with H2PcS2.4. The antitumor effect declined in the order H2PcS2.4 > H2PcS3.1 > H2PcS1.5 and vanished for H2PcS3.8. We demonstrate here that the high photodynamic activity of H2PcS2.4 can be explained by its physicochemical properties in living cells and tissues. Thus, H2PcSn (n is about 2) can be considered as a new alternative in PDT of light-accessible neoplasms and further clinic-oriented studies are warranted.

Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification.

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2) (-), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)-G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.