Dependence of yeast pre-mRNA 3'-end processing on CFT1: a sequence homolog of the mammalian AAUAAA binding factor.

3'-End formation of pre-mRNA in yeast and mammals follows a similar but distinct pathway. In Saccharomyces cerevisiae, the cleavage reaction can be reconstituted by two activities called cleavage factor I and II (CFI and CFII). A CFII component, designated CFT1 (cleavage factor two) was identified by its sequence similarity to the AAUAAA-binding subunit of the mammalian cleavage and polyadenylation specificity factor (CPSF), even though the AAUAAA signal sequence appears to play no role in yeast pre-mRNA 3' processing. Depletion of a yeast whole-cell extract with antibodies to CFT1 protein abolished cleavage and polyadenylation of pre-mRNAs. Addition of CFII restored cleavage activity, but not polyadenylation. Polyadenylation required the further addition of poly(A) polymerase and polyadenylation factor I, suggesting a close but not necessarily direct association of these two factors with the CFT1 protein.

Yeast pre-mRNA splicing requires a minimum distance between the 5' splice site and the internal branch acceptor site.

We have generated several deletions within the intron of a yeast actin gene construct which have lead to different splicing efficiencies as measured by Northern blot (RNA blot) and primer extension analyses. Our data especially demonstrate that a minimum distance from the 5' splice site to the internal branch acceptor site is required for accurate and efficient splicing. In a construct in which splicing was completely abolished, splicing could be restored by expanding the distance from the 5' splice site to the internal branch acceptor site with heterologous sequences. Alternative splicing, i.e., exon skipping and the use of a cryptic 5' splice site, was observed when the mRNA precursor was derived from a tandem repeat of a truncated intron with flanking exon sequences.

Pre-mRNA topology is important for 3'-end formation in Saccharomyces cerevisiae and mammals.

Various signal motifs that are required for efficient pre-mRNA 3'-end formation in the yeast Saccharomyces cerevisiae have been reported. None of these known signal sequences appears to be of the same general importance as is the mammalian AAUAAA motif. To establish the importance of yeast pre-mRNA termini in 3'-end formation, the ends of a pre-mRNA transcript synthesized in vitro were ligated before incubation in a yeast whole-cell extract. Such covalently closed circular RNAs were not cleaved at their poly(A) sites. Interestingly, pseudocircular RNAs with complementary 3'- and 5'-terminal sequences allowing the formation of panhandle structures were also resistant to cleavage. However, 3'-end processing was impeded neither by terminal hairpins at either or at both ends nor by RNA oligonucleotides complementary to either or both ends of a linear pre-mRNA. Intriguingly mammalian pseudocircular pre-mRNAs also were not cleaved at their poly(A) sites when incubated in a HeLa cell nuclear extract. These results provide evidence for the general importance of RNA topology in the formation of an active 3'-end processing complex in S. cerevisiae and higher eukaryotes. The possibility of a torus-shaped factor involved in 3'-end formation is discussed.

Flexibility and interchangeability of polyadenylation signals in Saccharomyces cerevisiae.

Various signal motifs have been reported to be essential for proper mRNA 3'-end formation in the yeast Saccharomyces cerevisiae. However, none of these motifs has been shown to be sufficient to direct 3'-end processing and/or transcription termination. Therefore, several structural motifs have to act in concert for efficient 3'-end formation. In the region upstream of the three polyadenylation sites of the yeast gene for alcohol dehydrogenase I (ADH1), we have identified a hitherto unknown signal sequence contained within the octamer AAAAAAAA. This motif, located 11 nucleotides upstream of the first ADH1 polyadenylation site, is responsible for the utilization of this site in vitro and in vivo, since mutational alteration drastically reduced 3'-end formation at this position. Insertion of 38 ADH1-derived nucleotides encompassing the (A)8 motif into the 3'-end formation-deficient cyc1-512 deletion mutant restored full processing capacity in vitro. Insertion of the octamer alone did not restore 3'-end formation, although mutation of the (A)8 motif in the functional construct had abolished 3'-end processing activity almost completely. This demonstrates that the sequence AAAAAAAA is a necessary, although not sufficient, signal for efficient mRNA 3'-end formation in S. cerevisiae.

Identification of pre-mRNA polyadenylation sites in Saccharomyces cerevisiae.

In contrast to higher eukaryotes, little is known about the nature of the sequences which direct 3'-end formation of pre-mRNAs in the yeast Saccharomyces cerevisiae. The hexanucleotide AAUAAA, which is highly conserved and crucial in mammals, does not seem to have any functional importance for 3'-end formation in yeast cells. Instead, other elements have been proposed to serve as signal sequences. We performed a detailed investigation of the yeast ACT1, ADH1, CYC1, and YPT1 cDNAs, which showed that the polyadenylation sites used in vivo can be scattered over a region spanning up to 200 nucleotides. It therefore seems very unlikely that a single signal sequence is responsible for the selection of all these polyadenylation sites. Our study also showed that in the large majority of mRNAs, polyadenylation starts directly before or after an adenosine residue and that 3'-end formation of ADH1 transcripts occurs preferentially at the sequence PyAAA. Site-directed mutagenesis of these sites in the ADH1 gene suggested that this PyAAA sequence is essential for polyadenylation site selection both in vitro and in vivo. Furthermore, the 3'-terminal regions of the yeast genes investigated here are characterized by their capacity to act as signals for 3'-end formation in vivo in either orientation.

Cloning and characterization of cDNAs coding for the heavy and light chains of a monoclonal antibody specific for Pseudomonas aeruginosa outer membrane protein I.

A set of seven monoclonal antibodies (MAb) directed against outer membrane proteins of Pseudomonas aeruginosa has been examined by Western blot analysis, indirect immunofluorescence tests and subclass typing. The hybridoma cell line secreting MAb 6A4, which reacts with outer membrane protein I, belongs to the IgG2a subclass and crossreacts with the 17 P. aeruginosa serotypes as listed in the International Antigenic Typing System, was selected as source for the preparation of poly(A)+RNA which in turn was used as template for cDNA synthesis and cloning. Full length cDNA clones of the gamma heavy chain as well as the kappa light chain were obtained and characterized by nucleotide sequence analysis. The complete cDNA sequences coding for the heavy and light chains will be the prerequisite for the construction and heterologous expression of a chimeric human-mouse monoclonal antibody which might be used in therapy of P. aeruginosa infections.

PTF1 encodes an essential protein in Saccharomyces cerevisiae, which shows strong homology with a new putative family of PPIases.

Complementation of a temperature sensitive mutant of the yeast Saccharomyces cerevisiae resulted in the isolation of PTF1 (processing/termination factor 1), an essential gene encoding a putative 3'-end processing or transcription termination factor of pre-mRNAs. Ptf1p shows significant homology to a newly discovered family of PPIases. This family is characterized by its insensitivity to immunosuppressive drugs and the lack of homology with cyclophilins and FK-506 binding proteins [Rahfeld et al. (1994) FEBS Lett. 352, 180-184]. Should Ptf1p display PPIase activity, it would be the first characterized, eukaryotic member of this putative family, which is essential for growth.

Automated sequencing and mapping of cosmid DNA with fluorescently-labeled dideoxynucleotide terminators.

We have established a method for directly sequencing cosmid DNA on an automated DNA sequencer. The major advantage of this method is that only small amounts of cosmid template DNA are needed for the sequencing reactions.

Rapid sequencing of the Sendai virus 6.8 kb large (L) gene through primer walking with an automated DNA sequencer.

The determination of the complete DNA sequence of the large (L) polymerase gene of Sendai virus strain Fushimi was used to explore the potential and feasibility of primer walking with fluorescent dye-labelled dideoxynucleotide terminators on an automated ABI DNA sequencer. The rapid identification of the complete sequence demonstrated that this approach is a time- and cost-saving alternative to classical sequencing techniques. Analysis of the data revealed that the L gene of Sendai virus strain Fushimi consists of exactly 6800 nucleotides and that the deduced amino acid sequence identifies a single open reading frame encoding a protein of 252.876 kDa. In contrast to Sendai virus strain Enders, the L mRNA of strain Fushimi is monocistronic. The comparison of the deduced amino acid sequences of the L genes of three different Sendai virus strains confirmed the existence of conserved as well as variable regions in the L protein and revealed a high grade of conservation in the carboxyterminal third. Furthermore, functional amino acid sequence motifs, like elements of RNA-dependent RNA polymerases and ATP-binding sites as postulated previously, were identified.

A Salmonella typhimurium strain genetically engineered to secrete effectively a bioactive human interleukin (hIL)-6 via the Escherichia coli hemolysin secretion apparatus.

Human interleukin-6 (hIL-6) cDNA was genetically fused with the Escherichia coli hemolysin secretorial signal (hlyA[S]) sequence in a plasmid vector. Recombinant E. coli XL-1 Blue and attenuated Salmonella typhimurium secreted a 30 kDa hIL-6-HlyA(S) fusion protein, with an additional form of higher apparent molecular mass produced by S. typhimurium. In S. typhimurium cultures hIL-6-HlyA(S) concentrations entered a plateau at 500 to 600 ng ml(-1) culture supernatant. In contrast to E. coli XL-1 Blue, in S. typhimurium culture supernatants hIL-6-HlyA(S) was accumulated faster reaching three-fold higher maximal concentrations. The cell proliferating activity of hIL-6-HlyA(S) fusion protein(s) was equivalent to that of mature recombinant hIL-6. Furthermore. hIL-6-secreting S. typhimurium were less invasive than the attenuated control strain. Therefore, the bulky hemolysin secretorial peptide at the C-terminus of the fusion protein does not markably affect hIL-6 activity, suggesting that the hemolysin secretion apparatus provides an excellent system to study immunomodulatory effects of in situ synthesized IL-6 in Salmonella vaccine strains.

Outer membrane proteins of Pseudomonas aeruginosa as vaccine candidates.

We tested the ability of the recombinant outer membrane proteins of Pseudomonas aeruginosa to serve as a protective vaccine against this Gram-negative pathogen in the presence of two main pathophysiological events leading to P. aeruginosa sepsis: (i) systemic infection during immunosuppression; and (ii) bacterial translocation. A hybrid vaccine was cloned which combined the protective epitopes of outer membrane protein F (OprF) and outer membrane protein I (OprI). This vaccine proved to be highly protective against an intraperitoneal challenge with P. aeruginosa in immunosuppressed mice. Oral immunization of mice with recombinant OprI expressing Salmonella dublin, induced s-IgA antibodies in the gut mucosa against OprI. These provided protection against translocation of P. aeruginosa in an immunosuppressed mouse model. To test whether OprI is effective in man, recombinant OprI was purified and used for the immunization of human volunteers. Immunization was tolerated well, and no side effects were observed. Antibody titers against OprI were measured in 90% of the volunteers after immunization.

Immunogenic efficacy of differently produced recombinant vaccines candidates against Pseudomonas aeruginosa infections.

Three different variants of the recombinant hybrid outer membrane protein OprF (aa 190-342)-OprI (aa 21-83) could be obtained in high yield after expression in Escherichia coli. The hybrid protein was modified N terminally, either with a minimal histidine tag or with a homologous sequence of OprF. Both recombinant proteins were purified by nickel chelate affinity chromatography under native and denaturing conditions, and this produced three suitable candidates for a vaccination trial, protein His-F-I, which was purified in its native as well as in its refolded form; and the native purified N terminally extended protein, ex-F-I. In mice, significantly higher antibody titers and survival rates after challenge with Pseudomonas aeruginosa were observed following immunization with protein His-F-I, purified under native conditions.

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

[Genome analysis--current status of knowledge and future perspectives]. / Genomanalyse--aktueller Wissensstand und Zukunftsperspektiven.

The rapid recent progress in molecular biology has placed the complete analysis of the human genome near at hand. This analysis of the human genome is not only restricted to the mapping, i.e. the localization of the genes on the chromosomes, but also involves the complete sequence analysis of the human DNA. Combined with increasingly sophisticated techniques which demand less and less amounts of material, the high resolution genome maps and the availability of a growing set of human genes will also expand the spectrum of possible future applications. Like in other fields these new technological developments will generate problems of social, ethical and legal nature. Therefore it seems absolutely essential not only to advance further technical developments and methodological improvements, but also to integrate these developments within a broad open discussion about their intended and unintended consequences.

Antibody production in baculovirus-infected insect cells.

We have employed the baculovirus expression system for the production of a mouse monoclonal IgG antibody directed against lipoprotein I of Pseudomonas aeruginosa. Both light and heavy chain cDNAs were introduced into the baculovirus genome in a single step of homologous recombination. Insect cells that were infected with the recombinant virus stably secreted antigen-binding and glycosylated antibody molecules capable of binding the complement component C1q.

Antibody production in silkworm cells and silkworm larvae infected with a dual recombinant Bombyx mori nuclear polyhedrosis virus.

We have examined the efficiency of coexpression of two heterologous genes from a recombinant Bombyx mori nuclear polyhedrosis virus for the production of antibodies in silkworm larvae. The cDNAs encoding the light and the heavy chains of a murine immunoglobulin, directed against lipoprotein I of Pseudomonas aeruginosa, were brought under the control of two separate copies of the viral polyhedrin promotor. Infection of silkworm cells with the recombinant baculovirus yielded a maximum of 6.4 micrograms/ml IgG2A in the culture supernatant 72 hours post infection, while 800 micrograms/ml IgG2A was found in the hemolymph of infected fifth instar silkworm larvae seven days after infection with the same construct. The recombinant antibody exhibited a similar antigen specificity and avidity to that of the monoclonal antibody derived from ascites fluid.

Splicing and spliceosome formation of the yeast MATa1 transcript require a minimum distance from the 5' splice site to the internal branch acceptor site.

Small deletions of 6, 7, and 12 nucleotides introduced between the 5' splice site and the internal branch acceptor site of the first intron of the yeast MATa1 gene completely abolish accurate splicing in vitro in these constructs. Splicing only occurs at an alternative 5' splice site which was found in the first exon of the MATa1 gene and which is used both in vivo and in vitro. The splicing defect cannot be cured by expanding the distance from the branch point to the 3' splice site. If the alternative 5' splice site is deleted as well in these constructs, neither spliced products nor spliceosomes are formed. Our findings especially lead to the conclusion that a minimum distance between the 5' splice site and the internal branch acceptor site of the intron is required for the formation of splicing complexes and for accurate splicing.