The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic.

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

Effect of rice bran protein concentrate as wall material adjunct on selected physicochemical and release properties of microencapsulated ß-carotene.

Rice bran protein is an emerging protein source from rice milling that possesses health benefits and emulsifying capacity suitable for hypoallergenic encapsulation applications, especially for lipophilic compounds such as ß-carotene. The purpose of this study is to develop and characterize ß-carotene encapsulates with maltodextrin and rice bran protein. Rice bran protein was prepared using conventional alkali extraction. ß-carotene was added to the composite wall materials (50:50 of 4%, 8%, 12%, and 16% solids content) and spray-dried. Encapsulation efficiency (85-98%) and radical scavenging activity (11-43%) varied proportionally with rice bran protein. Across increasing maltodextrin and rice bran protein content of the feed, carbohydrate content of the microcapsules varied proportionally (50-66%) but protein content was uniform (10-13%). Scanning electron microscopy, differential scanning calorimetry, and Fourier transform infrared spectroscopy data suggested successful encapsulation. Release profiles showed decreasing trend with increasing rice bran protein content; co-digestion with rice mitigated negative impacts of rice bran protein. Microcapsules with nutritive potential and health-promoting properties were developed as potential carotenoid delivery systems.

Firearm injuries in a pediatric population: African-American adolescents continue to carry the heavy burden.

BACKGROUND: Firearm injuries have the highest case-fatality rate among pediatric trauma related deaths. We sought to determine whether demographics, mechanism of injury, and outcomes were age specific. METHODS: We performed a 5 year retrospective analysis of patients 0-19 years old with firearm related injuries. Children were divided into two cohorts based on age. Mann-Whitney and Pearson's X2 were used to compare continuous and categorical variables, respectively. Significance was established at p < 0.05. DATA: Compared to their younger counterparts, children >15 years old were more likely to be male (82% vs. 90%, p = 0.02), African-American (71% vs 89%, p < 0.0001), and injured due to assault (76.9% vs 44.6%, p < 0.0001). Mortality rates for children <14 was 1.4 times the national average (10.7% vs. 7.5%) while the rate for children >15 was 3.9 times the national average (12.4% vs. 3.2%). CONCLUSION: Firearm injuries continue to be a prevalent public health concern greatly affecting African-American adolescent males. Prevention strategies and trauma related healthcare resource utilization should target this group in order to reduce the risk of injury and improve outcomes and case-fatality in our population.

Steroid-responsive inclusion body myositis associated with endometrial cancer.

Inclusion body myositis (IBM) is an uncommon chronic inflammatory myopathy. Although the association between other myopathies and cancer has been well established, the relationship between IBM and neoplasia is not completely understood. Unlike polymyositis (PM) or dermatomyositis (DM), IBM rarely responds to immunosuppressive treatment and the response is seldom long-lasting. We describe a case of IBM associated with endometrial carcinoma that also demonstrated a unique response to steroids alone which persisted despite cancer relapse. The factors that are associated with a response of IBM to steroids are discussed. An atypical, steroid-responsive form of the disease is delineated.

Metastatic solid-pseudopapillary tumour of the pancreas: clinico-biological correlates and management.

Solid-pseudopapillary tumour of the pancreas is a rare neoplasm of young women, currently categorised in the World Health Organization classification under exocrine pancreatic tumours. Increased awareness of this condition correlated recently with an apparent rise in incidence as well as recognition of more aggressive clinical courses. We describe two patients with solid-pseudopapillary tumour of the pancreas. A smaller, localised tumour in an unusually young white man was surgically excised with no evidence of recurrence after 2 years. The other case also had an uncommon presentation, with an aggressive course resulting in vascular encasement of the superior mesenteric bundle and aorta, and local involvement of the mesenteric lymph nodes. A literature review was carried out, and the main clinico-pathological features and strategies of treatment of solid-pseudopapillary tumour of the pancreas are presented. Pathological, genetic and molecular features distinguish solid-pseudopapillary tumours from pancreatic ductal adenocarcinoma. Furthermore, neuroendocrine differentiation can be found focally in occasional cases of solid-pseudopapillary tumour. Patients with localised disease are usually cured by surgery. Prolonged survival can be seen in the presence of distant metastasis, if such lesions are resected surgically. Chemotherapy and radiation therapy are used in rare cases when resection is not possible. No current chemotherapy regimens are considered standard in the treatment of this tumour. A rational chemotherapy protocol for such a rare tumour needs to consider its origin and clinical behaviour. However, the indolent clinical progression of solid-pseudopapillary tumours is similar to that of pancreatic neuroendocrine tumour.

p53 expression and DNA ploidy of cartilage lesions.

The aim of this study was to investigate the expression of a tumor suppressor gene (p53) in cartilage lesions of bone and its relationship to their histological grade and DNA ploidy. An immunohistochemical assay for p53 and Feulgen-stained DNA preparations was subjected to computerized image analysis. Enchondromas, synovial chondromatosis, and low grade (grade I and II) chondrosarcomas were diploid. High grade (grade III) chondrosarcomas and high grade sarcomatous components of dedifferentiated chondrosarcomas were aneuploid. Well differentiated cartilaginous components of dedifferentiated chondrosarcomas were diploid. Microscopic examination showed weak focal positivity for p53 in one of 10 enchondromas one of six examples of synovial chondromatosis, and three of four low grade (grade I and II) chondrosarcomas. All three high grade (grade III) chondrosarcomas were strongly positive for p53. The high grade sarcomatous component of all four dedifferentiated chondrosarcomas was strongly positive for p53, whereas only focal weak positivity was noted in the well differentiated cartilaginous areas. These results were confirmed by quantitative computer-assisted image analysis, which showed that high grade aneuploid cartilage tumors demonstrated strikingly higher levels of p53 than did diploid low grade malignant tumors or benign cartilage lesions.

Miliary opacities diagnosed as lung metastases of a thyroid carcinoma after 13 years of stability.

A 29-year-old man was hospitalized for the diagnosis of clinically asymptomatic miliary opacities discovered 13 years earlier and unchanged since then. Transbronchial biopsy showed metastatic thyroid carcinoma. Thyroid surgery revealed massive local invasion by a papillary carcinoma. We conclude that thyroid carcinoma, whether clinically detectable or not, should be considered in the diagnostic investigation of stable miliary lesions.

[Reduction of per- and postoperative blood loss with aprotinin (Trasylol) during extracorporeal circulation]. / Réduction des pertes sanguines per et postopératoires par l'aprotinine (Trasylol) au cours de la circulation extracorporelle.

Aprotinin is a pharmacological agent which, when given in high doses during cardiopulmonary bypass (CPB), seems to reduce postoperative blood loss significantly and thereby reduces the need for blood transfusion. This study was undertaken to confirm these claims and to show that there was also decreased peroperative bleeding and a shorter operation time. The immediate postoperative clinical course was also assessed. The study was a prospective, randomised double-blind trial versus placebo in 60 coronary patients undergoing at least 2 aorto-coronary bypass grafts for the first time within a 3 month period. During surgery after stopping the CPB the blood loss recorded by aspiration was 49 +/- 61 ml in the aprotinin group and 90 +/- 84 ml in the placebo group (p less than 0.05). The quality of haemostasis in the operated area evaluated independently by the anaesthetist was judged to be excellent in 30 patients in the aprotinin group compared with only 19 in the placebo group (p less than 0.001). The time between coming off CPB and skin closure was significantly shorter in the aprotinin group (42 +/- 10 min versus 49 +/- 12 min) and the dose of protamine injected at the end of the operation was 19 +/- 38 mg in the aprotinin group compared to 43 +/- 46 mg in the placebo group (p less than 0.05). The blood loss recorded over 48 hours in the intensive care unit was nearly three times less in the aprotinin group (380 +/- 125 ml) than with placebo (852 +/- 523 ml).(ABSTRACT TRUNCATED AT 250 WORDS)

Effects of fludarabine treatment on murine lupus nephritis.

BXSB mice, a murine model of systemic lupus erythematosus (SLE), were treated with two different doses of fludarabine for a four-week period and examined two weeks after the final dose. Control mice were treated with saline or cyclophosphamide. Mice treated with fludarabine had a significant reduction in renal pathology compared to control mice. Fludarabine-treated mice also had an almost 10-fold increase in percentile of CD8+CD25+ T cells in the spleen and a smaller but significant increase in CD4+CD25+ cells. Mice treated with cyclophosphamide had a greater leucopenia compared to the other groups and a significant reduction in percentile of B220+ cells in peripheral blood and spleen. Serum autoantibody levels to dsDNA did not differ significantly among the groups, but were higher in 4/10 mice treated with fludarabine. Although few trials of fludarabine for human SLE have been conducted, additional studies may be warranted.

Algunos aspectos endócrinos-metabólicos en jovenes con obesidad exógena / Some endorine metabolic aspects in children and adolescentes with exogenous obesity

Se seleccionaron 59 jóvenes obesos y 36 jóvenes aparentemente normales y en edades comprendidas entre 2-16 años de edad. Se les determinaron hábitos dietéticos,grado de sobrepeso, antecedentes familiares de enfermedades endocrinas, metabólicas investigadas fueron: Lípidos totales, Colesterol, Triglicéridos, Proteinas Totales, Albúminas, Globulinas, Glicemia y Lipoproteínas. Ddesde el punto de vista endocrino, se investigó T-4, TSH y Cortisol Plasmático, asimismo Supresión Suprarrenal del Cortisol con Dexametasona. Se evaluó desde el punto de vista radiológico en cuanto a normalidad de la SiIIa Turca y determinación de edad ósea. La dieta practicada revela que en el grupo de obesos es hipercalórica, en comparación con el grupo control. Un 18.6% del total del grupo de obesos tuvieron más del 75% de sobrepeso y dos veces predominante con el sexo masculino con respecto al femenino. Entre los antecedentes familiares encontramos que la Diabetes, Insuficiencia Coronaria e Hipertensión Arterial, predominaron en el grupo de obesos, el antecedentes familiar de obesidad fue igual en ambos grupos. Se encontraron niveles de Triglicéridos, Fosfolípidos y Lípidos Totales más elevados en los obesos que en el grupo control. No hay diferencia en los niveles de Colesterol entre el grupo de obesos y los normales reportados por otros autores. Se aprecia un elevado porcentaje de obesos con hiperlipoproteinemias tipo IIa (6,7%) y IIb (10,1%), además un altísimo porcentaje (28,8%) con hiperliproteinemia tipo IV. No se encontraron alteraciones, ni diferencias en relación a las concentraciones de TSH, T-4 y Cortisol Plasmático,en los dos grupos estudiados. Hubo buen funcionamiento del eje pituitario-adrenal en todos, excepto en un caso, del grupo control. Este paciente se refirió para una evaluación más exhaustiva. La edad ósea fue mayor o más avanzada en un 49,14%, que la edad cronológica en el grupo de obesos, en comparación con 30,63% en los controles. No hubo alteraciones radiológicas de la siIIa turca en ambos grupos