Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Resultados 1 - 9 de 9
Filtrar
Más filtros

Banco de datos
País como asunto
Tipo del documento
Publication year range
1.
Zhonghua Liu Xing Bing Xue Za Zhi ; 45(3): 385-392, 2024 Mar 10.
Artículo en Zh | MEDLINE | ID: mdl-38514315

RESUMEN

Objective: To analyze the individual and cumulative effects of unhealthy lifestyle on the prevalence of hypertension, diabetes and dyslipidemia in old adults in China, and find out the critical lifestyle in the network. Methods: Based on the baseline data of Yunnan Behavior and Disease Surveillance Cohort in 2021, a total of 16 763 older adults aged ≥60 years were included in our study. The unhealthy lifestyle factors including smoking, drinking, unhealthy eating habit, lower physical activity level, abnormal BMI and abnormal waist circumference. We calculated the unhealthy lifestyle score by using the cumulative exposures of each participant. Multiple logistic regression and mixed graphical models were used to describe the association between unhealthy lifestyle and the prevalence of hypertension, diabetes and dyslipidemia. Results: The prevalence of hypertension, diabetes and dyslipidemia were 57.0%, 11.5% and 37.0%, respectively. Most of the unhealthy lifestyles included in the study were risk factors for hypertension, diabetes and dyslipidemia, and the risks of disease increased with the increase of the unhealthy lifestyle score. The participants with the highest score (score: 6) had significantly higher prevalence of hypertension (OR=3.99, 95%CI: 1.81-8.80), diabetes (OR=4.64, 95%CI: 1.64-13.15) and dyslipidemia (OR=4.26, 95%CI: 2.08-8.73) compared with those with lowest score (score: 0). In the network constructed by mixed graphical model, abnormal waist circumference (bridge strength=0.81) and hypertension (bridge strength=0.55) were vital bridge nodes connecting unhealthy lifestyle and hypertension, diabetes and dyslipidemia. Conclusions: The unhealthy lifestyle score was associated with risks for hypertension, diabetes and dyslipidemia. Abnormal waist circumference was the key factor for chronic diseases in old adults.


Asunto(s)
Diabetes Mellitus , Dislipidemias , Hipertensión , Humanos , Anciano , China/epidemiología , Diabetes Mellitus/epidemiología , Hipertensión/epidemiología , Hipertensión/complicaciones , Factores de Riesgo , Dislipidemias/epidemiología , Dislipidemias/complicaciones , Estilo de Vida
2.
Zhonghua Liu Xing Bing Xue Za Zhi ; 45(3): 440-446, 2024 Mar 10.
Artículo en Zh | MEDLINE | ID: mdl-38514322

RESUMEN

Objective: To investigate the association between alcohol consumption and hypertension and SBP, DBP and the mediating effects of body mass index (BMI) and lipid level in occupational population, and provide reference for the intervention and prevention of hypertension. Methods: Based on the data of Southwest Occupational Population Cohort from China Railway Chengdu Group Co., Ltd., the information about the demographic characteristics, behavior and lifestyle, blood pressure and lipids level of the participants were collected through questionnaire survey, physical examination and blood biochemical test. Logistic/linear regression was used to analyze the association between alcohol consumption and hypertension, SBP and DBP. The individual and joint mediating effects of BMI, HDL-C, LDL-C, TG, and TC were explored through causal mediating analysis. A network analysis was used to explore the correlation between alcohol consumption, BMI and lipid levels, and hypertension. Results: A total of 22 887 participants were included, in whom 1 825 had newly detected hypertension. Logistic regression analysis found that current/former drinkers had a 33% increase of risk for hypertension compared with never-drinkers (OR=1.33, 95%CI:1.19-1.48). Similarly, alcohol consumption could increase SBP (ß=1.05, 95%CI:0.69-1.40) and DBP (ß=1.10, 95%CI:0.83-1.38). Overall, BMI and lipid levels could mediate the associations between alcohol consumption and hypertension, SBP and DBP by 21.91%, 28.40% and 22.64%, respectively. BMI and TG were the main mediators, and they were also the two nodes with the highest edge weight and bridge strength centrality in the network of alcohol consumption, BMI, lipid levels and hypertension. Conclusions: Alcohol consumption was associated with increased risk for hypertension, and BMI and TG were important mediators and key nodes in the network. It is suggested that paying attention to the alcohol consumption, BMI and TG might help prevent hypertension in occupational population.


Asunto(s)
Hipertensión , Humanos , Índice de Masa Corporal , Consumo de Bebidas Alcohólicas/epidemiología , Consumo de Bebidas Alcohólicas/efectos adversos , Presión Sanguínea/fisiología , Lípidos
3.
Zhonghua Liu Xing Bing Xue Za Zhi ; 45(3): 417-424, 2024 Mar 10.
Artículo en Zh | MEDLINE | ID: mdl-38514319

RESUMEN

Objective: To explore the association between occupational noise perception and cardiovascular disease (CVD), depression symptoms, as well as their comorbidity in occupational population and provide evidence for the prevention and control of physical and mental illnesses. Methods: A cross-sectional survey design was adopted, based on baseline data in population in 28 prefectures in Sichuan Province and Guizhou Province, and 33 districts (counties) in Chongqing municipality from Southwest Occupational Population Cohort from China Railway Chengdu Group Co., Ltd. during October to December 2021. A questionnaire survey was conducted to collect information about noise perception, depressive symptoms, and the history of CVD. Latent profile analysis model was used to determine identify noise perception type, and multinomial logistic regression analysis was conducted to explore the relationship between different occupational noise perception types and CVD, depression symptoms and their comorbidity. Results: A total of 30 509 participants were included, the mean age was (36.6±10.5) years, and men accounted for 82.0%. The direct perception of occupational noise, psychological effects and hearing/sleep impact of occupational noise increased the risk for CVD, depressive symptoms, and their comorbidity. By using latent profile analysis, occupational noise perception was classified into four levels: low, medium, high, and very high. As the level of noise perception increased, the association with CVD, depressive symptoms, and their comorbidity increased. In fact, very high level occupational noise perception were found to increase the risk for CVD, depressive symptoms, and their comorbidity by 2.14 (95%CI: 1.73-2.65) times, 8.80 (95%CI: 7.91-9.78) times, and 17.02 (95%CI: 12.78-22.66) times respectively compared with low-level occupational noise perception. Conclusions: Different types of occupational noise perception are associated with CVD and depression symptom, especially in the form of CVD complicated with depression symptom. Furthermore, the intensity of occupational noise in the work environment should be reduced to lower the risk for physical and mental health.


Asunto(s)
Enfermedades Cardiovasculares , Enfermedades Profesionales , Masculino , Humanos , Adulto , Persona de Mediana Edad , Enfermedades Cardiovasculares/epidemiología , Depresión/psicología , Estudios Transversales , Comorbilidad , Audición , Condiciones de Trabajo , Percepción , Factores de Riesgo , Enfermedades Profesionales/epidemiología
4.
Zhonghua Liu Xing Bing Xue Za Zhi ; 45(3): 432-439, 2024 Mar 10.
Artículo en Zh | MEDLINE | ID: mdl-38514321

RESUMEN

Objective: To understand the relationship between unhealthy lifestyle and hyperuricemia, as well as the modification effects of hypertension and dyslipidemia in occupational population and provide a theoretical basis for the prevention of hyperuricemia. Methods: A cross-sectional survey design was adopted, based on baseline data from the Southwest Occupational Population Cohort from China Railway Chengdu Group Co., Ltd., which included the population in 28 prefectures from Sichuan Province and Guizhou Province, and 33 districts (counties) from Chongqing Municipality between October and December 2021. This study collected the information about the demographics characteristics, lifestyles, and prevalence of chronic non-communicable diseases of the study subjects through questionnaire, physical measurement and laboratory biochemical test. The unhealthy lifestyle score was scored based on smoking, alcohol consumption, dietary patterns, physical activity, and low weight or overweight, with higher scores being associated with more unhealthy lifestyles. The multivariate logistic regression model was used to analyze the relationship between unhealthy lifestyle score, smoking, alcohol consumption, other factors and hyperuricemia, and the stratified analysis was used to explore the modification effect of hypertension and other diseases on the relationship between unhealthy lifestyle and hyperuricemia. Results: A total of 11 748 participants were included in this study, the prevalence of hyperuricemia was 34.4%. Multivariate logistic regression model showed that current/previous smoking, current/previous alcohol consumption and BMI abnormality were risk factors for hyperuricemia, and the unhealthy lifestyle score showed a "cumulative" effect on the risk for hyperuricemia, with higher score increasing the risk of hyperuricemia, and the OR increased from 1.64 (95%CI: 1.34-2.00) to 2.89 (95%CI: 2.39-3.50). Stratified analysis showed that unhealthy lifestyles had a greater impact on the risk for hyperuricemia in people with hypertension and dyslipidemia. Conclusions: The coexistence of multiple unhealthy lifestyles might increase the risk of hyperuricemia, and this effect was stronger in participants with hypertension and dyslipidemia. Timely correction of unhealthy lifestyles, and control of hypertension and dyslipidemia might reduce the risk for hyperuricemia.


Asunto(s)
Dislipidemias , Hipertensión , Hiperuricemia , Humanos , Hiperuricemia/epidemiología , Estudios Transversales , Hipertensión/epidemiología , Hipertensión/complicaciones , Factores de Riesgo , Estilo de Vida , Dislipidemias/epidemiología , Dislipidemias/complicaciones , Prevalencia
5.
Plant Dis ; 96(8): 1193-1197, 2012 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-30727060

RESUMEN

The aqueous extracts of 30 out of 67 Chinese medicinal herbs were shown to have inhibitory effects on growth of Xanthomonas euvesicatoria by a paper disc diffusion assay. The inhibitory substances with the strongest antibacterial activity were extracted from Chinese sumac gallnut and black myrobalan. The aqueous extract of gallnut inhibited the growth of eight of the tested plant-pathogenic bacteria, and that of black myrobalan inhibited five. The gallnut extract produced at least an 8-mm inhibition zone against Acidovorax citrulli, Ralstonia solanacearum, X. citri pv. citri, and X. euvesicatoria at a 10-fold dilution, and it was still active at 800- to 1,600-fold dilutions. The aqueous extract of gallnut was more inhibitory than the acetone-water extract. To identify the inhibitory compounds in the gallnut aqueous extract, the crude extract was chromatographed over a silica column, and the primary compounds in fractions 3 and 8 were identified by nuclear magnetic resonance as gallic acid and methyl gallate, respectively. The inhibitory effect of methyl gallate on the growth of four plant-pathogenic bacteria was 10 to 80 times that of gallic acid. The minimum inhibition and minimum bactericidal concentration tests showed that the inhibition effect of the original aqueous was higher than that of methyl gallate. These results indicate that methyl gallate in gallnut is an important compound that is inhibitory to plant-pathogenic bacterial growth, and there are other unidentified compounds that are also responsible for the antibacterial effects. This is the first report regarding the antibacterial effects of gallnut extract and its chemical components on plant-pathogenic bacteria.

6.
Plant Dis ; 95(8): 1033, 2011 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-30732089

RESUMEN

Many Calathea species in the family Marantaceae are beautiful ornamental plants with variegated foliage. Among them, C. picturata 'Argentea', an evergreen perennial that has pale green leaves with dark green margins and a red underside, is a popular houseplant in Taiwan. In 2004, a new foliage disease that caused leaf blight of C. picturata 'Argentea' was first observed in a nursery in southern Taiwan. Initial symptoms were tiny, brown spots that appeared on the leaves of all ages, which quickly enlarged and coalesced. These necrotic lesions spread to cover the entire leaves in high temperature and moisture conditions and caused leaves to shrivel and eventually die. A dematiaceous hyphomycete with multicelled conidia was consistently isolated from the diseased leaves after being surfaced sterilized with 10% Clorox and placed on vegetable juice agar (10% V8 juice, 0.02% CaCO3, and 2% agar [VJA]). Pathogenicity of the isolate was tested by spraying 'Argentea' calathea leaves with a conidia suspension (1.6 × 105 conidia/ml) prepared from a culture grown on VJA at 28°C for 7 days. Plant leaves sprayed with distilled water were used as a control. Three pots of 15-cm high 'Argentea' calathea plants were inoculated with 10 ml of a conidia suspension and the experiment was conducted twice at 28°C and 90% relative humidity in a growth chamber. Tiny, brown spots started to show on all inoculated leaves 5 days after inoculation and the progression of symptom development was similar to that observed in nature. Control leaves remained asymptomatic. The same dematiaceous hyphomycete fungus was reisolated from 13 of 16 disease tissues taken from four symptomatic leaves. A colony of the calathea isolate was olive green when grown on potato dextrose agar (PDA) and conidia production was observed 7 days after incubation in darkness. The conidiophores were either branches from or the ends of normal mycelium, some of them geniculate with conidium produced at each bend measuring 142 to 602 (340) × 3 to 6 (4) µm on disease tissues and 51 to 150 (103) × 3 to 5 (4) µm on PDA. Conidia were multicelled with protruding hilum at the base, terminal cells thickened, olivaceous brown or golden brown in fusiform shape with blunt tips, 5 to 11 septate on disease tissues and 6 to 11 septate on PDA, measuring 46 to 166 (95) × 8 to 19 (13) µm on disease tissues and 58 to 145 (94) × 6 to 15 (11) µm on PDA, germinating by producing germ tubes semiaxially from each end. Morphological characteristics of the calathea isolate fit the description of the genus Exserohilum (2). Comparison of rDNA internal transcribed spacer (ITS) sequence of the calathea isolate with those in GenBank revealed that it shared 99.5% (549 of 552) similarity with a published sequence (GenBank Accession No. EU571210) (3) and Exserohilum rostratum was its closest species. ITS sequence analysis was done as previously described (1). Morphological and molecular data identified the pathogen as E. rostratum (Drechs.) Leonard & Suggs (= Bipolaris rostrata (Drechs.) Shoemaker). To our knowledge, this is the first report of leaf blight caused by E. rostratum on C. picturata in Taiwan. References: (1) L. L. Chern et al. Plant Dis. 94:1164, 2010. (2) K. J. Leonard. Mycologia 68:402, 1976. (3) R. Sappapan et al. J. Nat. Prod. 71:1657, 2008.

7.
Plant Dis ; 94(9): 1164, 2010 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-30743699

RESUMEN

Angelica (Angelica acutiloba (Siebold. & Zucc.) Kitag.) is one of the most important traditional Chinese medicines in Taiwan. The medicinal herb has been mainly imported from China, but cultivation at a commercial scale has also been established in recent years in Hualien County, Taiwan. In September 2008, angelica plants in a field at Liou-shih-dan Mountain displayed symptoms of yellowing, stunting, rotting of roots and basal stem, and wilting. A severe brown discoloration of vascular tissue along the stems of infected plants was observed. One or more Fusarium spp. was consistently isolated from the roots and stems of diseased plants. Isolates R3, R4, and R5 were incubated for 14 days on celery tissues to produce chlamydospores, and 33 g of celery tissue with chlamydospores were mixed with 500 ml of soil per pot as inoculum. One 4-month-old angelica seedling was planted per pot. Three angelica plants were inoculated with each isolate in the first test and nine plants were inoculated with each isolate in the second test. Other seedlings were inoculated with water as checks. Pathogenicity tests were conducted twice. Incidence of diseased plants was 66, 100, and 33% in the first test, and 66, 100, and 44% in the second test for the R3, R4, and R5 isolates, respectively. Symptoms similar to those on the diseased plants in the field were produced, with leaves turning yellow starting 7 days after inoculation and wilt and discoloration of roots 14 days after inoculation. Fusarium spp. also were reisolated from the diseased plants. Genomic DNA was extracted from mycelium with a fungal genomic DNA purification kit, and the internal transcribed spacer (ITS) rDNA region was amplified and sequenced with primers ITS-4 and ITS-5. The sequence of the resulting ~550-bp amplicon was compared with those in GenBank. The ITS sequences of the R3, R4, and R5 isolates shared 98.7, 98.7, and 97.9% similarity with F. solani isolate AF129104 (3), respectively. Phylogenetic analysis also showed that the three isolates were closer to F. solani than to other Fusarium species. Both macroconidia and microconidia of the R4 isolate were produced on potato dextrose agar. Macroconidia were three to five septate and 27.2 to 37.8 × 4.4 to 6.2 µm; microconidia were zero to one septate and 9.3 to 14.7 × 2.9 to 4.8 µm. Chlamydospores produced on celery juice agar were terminal or intercalary, solitary, in pairs or in chains, and 9.3 to 12.1 µm. Morphological characteristics identified the three isolates as F. solani (Martius) Snyder & Hansen according to Fu and Chang (2) and Chung et al. (1), which agrees with the ITS comparison. To our knowledge, this is the first report of root and basal rot caused by F. solani on angelica in Taiwan. References: (1) W. C. Chung et al. Plant Prot. Bull. 40:177, 1998. (2) C. H. Fu and T. T. Chang. Taiwan J. For. Sci. 14:223, 1999. (3) H. Suga et al. Mycol. Res. 104:1175, 2000.

8.
Plant Dis ; 90(10): 1358, 2006 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-30780946

RESUMEN

Aglaonema (Aglaonema spp.) is a popular ornamental potted plant in Taiwan. In 2003, leaves showing soft rot symptoms were found on a number of Sithiporn aglaonema (A. marantifoloum var. tricolor × A. rotundum) plants in a nursery in southern Taiwan. The disease usually started from leaf tips or wounded sites and the affected areas appeared water soaked. The diseased tissue subsequently turned dark brown and became fragile. More than 50% of Sithiporn aglaonema plants were destroyed in the affected nursery. Bacteria isolated from the symptomatic leaves grew at 39°C, degraded pectate, caused soft rot on slices of potato tuber and petioles of Chinese cabbage, produced phosphatase and lecithinase, and utilized malonate, but did not grow in 5% NaCl or produce acid from trehalose. These characteristics were similar to those of Erwinia chrysanthemi Burkholder et al. (1,2) and the reference strain OS2 from Phalaenopsis sp. provided by K. C. Tzeng of National Chung Hsing University, Taichung, Taiwan. Polymerase chain reaction (PCR) analysis using the primer pair 5A (5' GCGGTTGTTCACCAGGTGTTTT 3') and 5B (5' ATGCACGCTACCTGGAAGTAT 3') specific for E. chrysanthemi (4) confirmed the identity of all seven isolates tested as E. chrysanthemi. The primer pair 5A/5B was designed from the sequences of pT8-1, idg (a gene for blue-pigment synthesis), and pecS (a gene for regulation of pectinase, cellulose, and pigment production). PCR products amplified from E. chrysanthemi DNA with the 5A/5B primer were 500 bp (4). Pathogenicity of isolates was confirmed by rubbing the leaf surface of Sithiporn aglaonema plants with Carborundum and spraying the wounded surface with a bacterial suspension at 1 × 108 CFU/ml in the greenhouse. Plant leaves sprayed with distilled water were used as the control. Three leaves were inoculated for each isolate, and the experiment was conducted twice. Symptoms appeared within 24 h after inoculation. All seven isolates tested were pathogenic, causing an average of 86 to 95% of inoculated leaves to show water-soaked symptoms similar to these observed in nature. Symptoms did not occur on control leaves. E. chrysanthemi was reisolated from diseased tissues of inoculated leaves. To our knowledge, this is the first report of bacterial blight caused by E. chrysanthemi on aglaonema in Taiwan and the first report of the disease on the Sithiporn cultivar of aglaonema. This disease on aglaonema was previously reported in the United States (3). References: (1) R. S. Dickey and A. Kelman. Page 44 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. The American Phytopathological Society, St. Paul, MN, 1988. (2) M. Goto and K. Matsumoto. Int. J. Syst. Bacteriol. 37:130, 1987. (3) L. A. McFadden. Plant Dis. Rep. 53:253. 1969. (4) M. G. Zhu. Ph.D. diss, National Chung Hsing University, Taichung, Taiwan, 1995.

9.
Plant Dis ; 90(8): 1107, 2006 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-30781312

RESUMEN

Zamioculcas zamiifolia (Lodd.) Engl., commonly called 'ZZ' plant, is a monocotyledonous plant in the Araceae. It is a new introduction in the foliage plant industry worldwide and is an increasing popular ornamental foliage plant in Taiwan. In 2003, basal petiole rot and death of ZZ plants were found in two nurseries in southern Taiwan with 18% of the plants diseased at one nursery. Early symptoms were water soaking of the petiole base and a slight yellowing of the leaflets followed by browning of leaflets. As the disease progressed, the petiole base became dark brown, shriveled, collapsed, and eventually rotted. The surface of the roots and rhizomes of diseased plants were initially blackish brown followed by root rots and mortality of plants. A Phytophthora species was consistently isolated from diseased petioles, rhizomes, and roots on a selective medium (4). Two single zoospore isolates (2), each from a different nursery, were used for morphological and pathogenicity tests. The isolates were grown on vegetable juice agar (10% V8 juice, 0.02% CaCO3, and 2% agar [VJA]) at 28°C with 12-h irradiation for 10 days. Sporangia were nondeciduous, terminal or intercalary, and attached to irregularly or sympodially branched sporangiophores. Papillate sporangia were spherical to broadly ovoid or obpyriform, averaged 37.3 × 30.2 µm, and ranged from 23 to 55 µm in length by 17 to 46 µm in diameter, with a length/breadth ratio of 1.24 and a range of 1.1 to 1.4. Chlamydospores with walls 1 to 4 µm thick were terminal or intercalary, spherical, averaged 30.6 µm in diameter, and ranged from 18 to 46 µm. On the basis of the morphological characteristics above, Phytophthora nicotianae Breda de Haar. (synonym P. parasitica Dastur) was identified (1). Paired with known A1 and A2 mating types of P. cinnamomi on VJA, both P. nicotianae cultures were A2, forming oospores after 14 days in darkness at 28°C. Disease-free ZZ plants were propagated by rhizomes in 242-cm3 round pots with 500 g of sterilized potting medium (vermiculite/peat moss/perlite = 1:2:1). Plants with 30 cm long petiole were used for inoculation. For the pathogenicity test, both isolates were grown on VJA plates sealed with Parafilm at 28°C in darkness. After 10 days, aerial mycelia with sporangia were scraped off the plates, placed in 10 ml of sterile distilled water at 8°C for 15 min to release zoospores. A zoospore suspension was adjusted to 104 zoospores/ml following enumeration with a microliter pipette (3) and 200 ml of the suspension was added to each pot, or rhizomes and roots were dipped in 400 ml of the suspension for 60 min and planted immediately. Ten plants were inoculated with either method and water was added to inoculated control plants. Water soaking of the petiole bases developed in 7 days and mortality occurred in 10 days in a screenhouse after plants were inoculated with either method. Control plants remained healthy and no petiole, root, or rhizome rots developed. P. nicotianae was isolated from the advancing lesions of the inoculated plants and both experiments were repeated. To our knowledge, this is the first report of basal petiole rot and plant kill of Zamioculcas zamiifolia caused by P. nicotianae. References: (1) D. C. Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN, 1996. (2) W. C. Ho and W. H. Ko. Bot. Bull. Acad. Sin. 38:41, 1997. (3) W. H. Ko et al. Phytopathology 63:1206, 1973. (4) W. H. Ko et al. Trans. Br. Mycol. Soc. 71:496, 1978.

SELECCIÓN DE REFERENCIAS
Detalles de la búsqueda