Silver-dendrimer nanocomposite as emerging therapeutics in anti-bacteria and beyond.

To develop next-generation nanomedicine, theranostic nanotherapeutic strategies are increasingly being emphasized. In recent years, it is observed that the effective lifetime of anti-bacterial and anti-cancer agent is diminishing, which undermines the economic incentives necessary for clinical development and therapeutic applications. Thus, novel formulations ought to not only kill drug resistant strains and cancerous cells but also inhibit their formation. Recently, metallic nanoparticles [for example- silver (Ag) nanoparticles] have been widely investigated for their biomedical applications. The so-called applications necessitate the inclusion of these nanoparticles inside polymeric matrices (for example- dendrimer) leading to chemical functionalization of the metallic nanoparticles. Silver and silver nanoparticles' antibacterial activity has already been well established over years. Dendrimers due to their homogeneous highly branched structure and uniform composition are perfectly suitable for the inclusion of silver nanoparticles [Ag NPs]. Recently, the increasing trend in the development of Ag-dendrimer nanocomposites is attributed to the excellent antibacterial activity of Ag as well as dendrimer's unique properties like variable functional terminal ends and potential antibacterial effect necessarily. This review provides an informative overview regarding the numerous aspects of bactericidal and other biomedical applications of Ag-dendrimer nanocomposites, particularly emphasizing analysis of existing research and prospective worth to the pharmaceutical sector in future.

Comparative efficacy and safety of restrictive versus liberal transfusion thresholds in anemic preterm infants: a meta-analysis of 12 randomized controlled trials.

The comparative efficacy and safety of restrictive with liberal transfusion thresholds remain controversial in anemic preterm infants. This meta-analysis aimed to compare the efficacy and safety of these two transfusion thresholds for anemic preterm infants. We searched PubMed, Embase, Cochrane Library, and China National Knowledge Infrastructure (CNKI) for relevant randomized controlled trials (RCTs) comparing restrictive with liberal transfusion thresholds in anemic preterm infants through April 30, 2022. Two independent investigators screened literature, extracted data, and appraised the methodological quality of eligible studies. Meta-analysis was conducted using RevMan version 5.3.5. Twelve RCTs with 4380 preterm infants were included. Liberal transfusion threshold significantly increased the level of hemoglobin after transfusion (mean difference (MD): -10.03; 95% confidence interval (CI): -15.98 to -4.08; p=0.001; I2=94%) and hematocrit (MD: -3.62; 95%CI: -6.78 to -0.46; p=0.02; I2=80%) compared with restrictive transfusion. Infants' age at first transfusion in restrictive transfusion group was higher than that of infants in liberal transfusion group (MD: 5.08; 95%CI: 2.27 to7.89; p=0.004; I2=54%); however, restrictive transfusion was associated with more time on supplemental oxygen (MD: 3.56; 95%CI: 1.93 to 5.18; p<0.001; I2=62%) and ventilator or CPAP (MD: 3.31; 95%CI: 1.42 to 5.20; p=0.006; I2=75%). For the remaining outcomes, two transfusion strategies were comparable. Furthermore, a series of sensitivity analyses confirmed the robustness of the level of hemoglobin after transfusion, age at first transfusion, time on ventilator or CPAP, and safety outcomes. Evidence with substantial heterogeneity indicates that liberal and restrictive transfusion thresholds are effective and safe blood cell transfusion strategies in anemic preterm infants, but the liberal strategy may be more effective in shortening the length of necessary respiratory support.

Chemiluminescence Immunoassay Method of Urinary Liver Fatty-acid-binding Protein as a Promising Candidate for Kidney Disease.

Liver fatty acid binding protein (L-FABP) is an intercellular lipid chaperone protein that selectively combines with unsaturated free fatty acids and transports them to mitochondria or peroxisomes. L-FABP is a promising biomarker for the early detection of renal diseases in humans. Herein a chemiluminescence method (CLIA) was demonstrated to measure the level of urinary L-FABP in the urinary samples. An anti-(L-FABP)-magnetic beads complex was prepared to capture the analyte target. Sensitivity, precision, accuracy, interference effect, high-dose hook effect of the developed assay were evaluated. Under the suitable experimental parameters, the established method have a wide linear range (0.01-10 ng/mL) and also showed a sufficiently low limit of detection of 0.0060 ng/mL. Besides, the satisfactory recoveries of the method in the urinary were ranged from 97.74%-112.32%, which was well within the requirement of clinical analysis. Furthermore, this proposed method has been successfully applied to the clinical determination of L-FABP in patients who have been diagnosed with kidney disease. The results showed that CLIA could accurately and rapidly determine the urinary level of L-FABP with high-throughput, which could be useful as a new tool to predict complications in patients with kidney disease. The clinical trial was approved by Shuyang Hospital of Traditional Chinese Medicine Ethics Committee: 20,210,202-001 at February 2, 2021.

Identification and characterization of novel MPC1 gene variants causing mitochondrial pyruvate carrier deficiency.

Pyruvate, the end product of glycolysis, is a key metabolic molecule enabling mitochondrial adenosine triphosphate synthesis and takes part in multiple biosynthetic pathways within mitochondria. The mitochondrial pyruvate carrier (MPC) plays a vital role in transporting pyruvate from the cytosol into the organelle. In humans, MPC is a hetero-oligomeric complex formed by the MPC1 and MPC2 paralogs that are both necessary to stabilize each other and form a functional MPC. MPC deficiency (OMIM#614741) due to pathogenic MPC1 variants is a rare autosomal recessive disease involving developmental delay, microcephaly, growth failure, and increased serum lactate and pyruvate. To date, two MPC1 variants in four cases have been reported, though only one with a detailed clinical description. Herein, we report three novel pathogenic MPC1 variants in six patients from three unrelated families, identified within European, Kuwaiti, and Chinese mitochondrial disease patient cohorts, one of whom presented as a Leigh-like syndrome. Functional analysis in primary fibroblasts from the patients revealed decreased expression of MPC1 and MPC2. We rescued pyruvate-driven oxygen consumption rate in patient's fibroblasts by reconstituting with wild-type MPC1. Complementing homozygous MPC1 mutant cDNA with CRISPR-deleted MPC1 C2C12 cells verified the mechanism of variants: unstable MPC complex or ablated pyruvate uptake activity. Furthermore, we showed that glutamine and beta-hydroxybutyrate were alternative substrates to maintain mitochondrial respiration when cells lack pyruvate. In conclusion, we expand the clinical phenotypes and genotypes associated with MPC deficiency, with our studies revealing glutamine as a potential therapy for MPC deficiency.

Whole-exome sequencing identified five novel de novo variants in patients with unexplained intellectual disability.

BACKGROUND: Intellectual disability (ID) represents a neurodevelopmental disorder, which is characterized by marked defects in the intellectual function and adaptive behavior, with an onset during the developmental period. ID is mainly caused by genetic factors, and it is extremely genetically heterogeneous. This study aims to identify the genetic cause of ID using trio-WES analysis. METHODS: We recruited four pediatric patients with unexplained ID from non-consanguineous families, who presented at the Department of Pediatrics, Guizhou Provincial People's Hospital. Whole-exome sequencing (WES) and Sanger sequencing validation were performed in the patients and their unaffected parents. Furthermore, conservative analysis and protein structural and functional prediction were performed on the identified pathogenic variants. RESULTS: We identified five novel de novo mutations from four known ID-causing genes in the four included patients, namely COL4A1 (c.2786T>A, p.V929D and c.2797G>A, p.G933S), TBR1 (c.1639_1640insCCCGCAGTCC, p.Y553Sfs*124), CHD7 (c.7013A>T, p.Q2338L), and TUBA1A (c.1350del, p.E450Dfs*34). These mutations were all predicted to be deleterious and were located at highly conserved domains that might affect the structure and function of these proteins. CONCLUSION: Our findings contribute to expanding the mutational spectrum of ID-related genes and help to deepen the understanding of the genetic causes and heterogeneity of ID.

Influence of the Building Unit on Covalent Organic Frameworks in Mediating Photo-induced Energy-Transfer Reversible Complexation-Mediated Radical Polymerization (PET-RCMP).

Two imine-based covalent organic framework photocatalysts with different building units, TPB-DMTA-COF and TAT-DMTA-COF, for photo-induced energy transfer reversible complexation-mediated radical polymerization (PET-RCMP) were developed and investigated, producing ideal polymers with accurate molecular weight and moderate dispersity under visible light irradiation. The chain extension and spatiotemporal control experiments revealed the high chain-end fidelity of polymers and the compatibility of RCMP processes in both bulk and aqueous system. Moreover, density functional theory (DFT) calculations verified that heteroatom-doped TAT-DMTA-COF exhibits higher activities for weakening C-I bond energy barrier, which promotes PET-RCMP polymerization performance. This work demonstrates that rational adjustment of building block for constructing COF heterogeneous photocatalyst can enhance the catalytic performance of PET-RCMP, providing a design methodology for the development of polymeric organic photoelectric semiconductor catalysts to mediate RCMP.

Visible Light-Regulated Heterogeneous Catalytic PET-RAFT by High Crystallinity Covalent Organic Framework.

Covalent organic frameworks (COFs) are a class of promising photocatalysts for conversing light energy into chemical energy. Based on the tunable building blocks, COFs can be well-designed as photocatalyst for mediating reversible addition-fragmentation chain-transfer (RAFT) polymerization. Herein, 1,3,6,8-tetrakis(4-formylphenyl)pyrene (TFPPy) and 2,2″-bipyridine-5,5″-diamine (Bpy) are chosen to construct imine-based TFPPy-Bpy-COFs for catalyzing RAFT polymerization of methacrylates under white light irradiation. The well-defined polymers with precise molecular weight and narrow molecular weight distribution are obtained. The switch on/off light experiments suggest excellent temporal control toward RAFT polymerization system and the chain-extension reaction indicates high chain-end fidelity of macro-initiators. Mechanism study clarifies that the electron transfer between excited state of TFPPy-Bpy-COFs and RAFT agent can form living radicals to mediate polymerization. This methodology provides a novel platform for reversible-deactivation radical polymerization using COFs as heterogeneous catalysts.

MicroRNA-375-3p is implicated in carotid artery stenosis by promoting the cell proliferation and migration of vascular smooth muscle cells.

BACKGROUND: Atherosclerosis is the main cause of carotid artery stenosis (CAS) which mostly occurs in the elderly. In this paper, the expression level of miR-375-3p in asymptomatic CAS patients and its diagnostic value for asymptomatic CAS were investigated, and the effects of miR-375-3p on the cell proliferation and migration of vascular smooth muscle cells (VSMCs) was further explored. METHODS: 98 healthy subjects and 101 asymptomatic CAS patients were participated in this study. qRT-PCR was used to measure the expression level of serum miR-375-3p, and the ROC curve was established to evaluate the predictive value of miR-375-3p for asymptomatic CAS. After transfection with miR-375-3p mimic or inhibitor in vitro, cell proliferation and migration were detected by CCK-8 assay, colony formation assay, and Transwell assay, respectively. The levels of TNF-α, IL-1ß, IL-6 were detected by ELISA. Western blot was used to detect the protein expression of XIAP. Finally, luciferase reporter gene assay was applied to assess the interaction of miR-375-3p with target genes. RESULTS: The expression level of serum miR-375-3p in asymptomatic CAS patients was significantly higher than that in healthy controls, and the AUC value of ROC curve was 0.888. The sensitivity and specificity were 80.2 and 86.7%, respectively, indicating that miR-375-3p had high diagnostic value for asymptomatic CAS. In vitro cell experiments showed that up-regulation of miR-375-3p significantly promoted the proliferation and migration of VSMCs, and also promoted the generation of inflammatory factors and phenotypic transformation of VSMCs. Luciferase reporter gene assay confirmed that XIAP was a target gene of miR-375-3p and was negatively regulated by miR-375-3p. CONCLUSIONS: In this study, miR-375-3p may have a clinical diagnostic value for asymptomatic CAS patients which need further validation. Increased miR-375-3p levels in CAS may be associated with increased proliferation and migration of VSMCs via downregulation of the apoptosis inducing gene XIAP.

A Progressive Enlarging Intraparenchymal Pericatheter Cyst and Cerebral Spinal Fluid Edema Following Ommaya Reservoir Placement.

ABSTRACT: Spread of cerebral spinal fluid (CSF) into the brain parenchyma is a very rare complication of Ommaya reservoir placement and can take form of CSF edema or an intraparenchymal pericatheter cyst. Herein, we described an extremely rare case of a progressive enlarging intraparenchymal pericatheter cyst and CSF edema in a patient with cerebral cysticercosis following Ommaya reservoir placement. A heightened index of suspicion of this rare complication is required to prevent misdiagnosis as a tumor or brain abscess that may lead to unnecessary surgical explorations.

Rapid determination of aflatoxin B1 by an automated immunomagnetic bead purification sample pretreatment method combined with high-performance liquid chromatography.

We aimed to establish an automated versatile sample preconcentration method based on the modified immunomagnetic beads, which was utilized to enrich for aflatoxin B1 from the matrices. The critical main parameters affecting the extraction efficiency, such as usage amount of immunomagnetic beads, reaction time, elution time, and blending way were investigated. Under the optimized conditions, the content of aflatoxin B1 was analyzed by high-performance liquid chromatography, the mobile phase consists of water-acetonitrile-methanol (42:18:10, v/v/v), and fluorescence detection was performed with excitation and emission wavelengths at 360 and 440 nm, respectively. Moreover, the performance of preconcentration method was compared with the conventional method based on the immunoaffinity column. The accuracy of two clean-up methods was within the error range. In addition, the stability and recyclability of the immunomagnetic beads was studied by recycling them five times. The results for the respective analysis in various samples demonstrated that the developed extraction platform provides a promising approach that is simple, rapid, sensitive, and easy to use.

Roles of Fibulin-2 in Carcinogenesis.

Fibulin-2, an extracellular matrix (ECM) protein expressed in normal epithelia, is a kind of fibulin which is associated with basement membranes (BM) and elastic ECM fibers. The role of fibulin-2 has been recognized as an oncogene. The upregulation of fibulin-2 correlates with cancer development and progression. Furthermore, the upregulation of fibulin has been detected in ovarian cancer and stomach adenocarcinoma. However, the downregulation of fibulin has been detected in different intestinal and respiratory tumor cells. Additional studies have revealed that the role of fibulin-2 in carcinogenesis is context dependent and is caused by the interaction of fibulin proteins such as cell surface receptors and other ECM proteins, including integrins and syndecans. The present study summarizes the role of fibulin in carcinogenesis and its underlying molecular mechanism.

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

Formulation and Pharmacokinetic Evaluation of a Drug-in-Adhesive Patch for Transdermal Delivery of Koumine.

The aim of this study was to develop a suitable drug-in-adhesive patch for transdermal delivery of koumine. Acrylic polymer Duro-Tak® 87-4287, which contains hydroxyl groups, may significantly enhance the skin permeation of koumine from transdermal patches containing 0.93-3.72% koumine. Among permeation enhancers, 10% azone showed the greatest potential and increased the flux of koumine to 1.48-fold that of the control. Therefore, an optimized patch formulation containing 3.72% koumine and 10% azone in Duro-Tak® 87-4287 that offers good physical properties was selected for an in vivo pharmacokinetic study using rats. The maximal plasma drug concentration (Cmax) of koumine after transdermal administration (4 mg/patch) was 25.80 ± 1.51 ng/mL, which was in the range of those after oral administration (3 mg/kg and 15 mg/kg). The time to the maximal concentration (Tmax) and the half-life (t1/2) of the drug with transdermal administration were 3.96 ± 0.46 h and 21.10 ± 1.36 h, respectively, which were longer than those with oral administration. Furthermore, the area under the concentration-time curve (AUC0-72 h) of 898.20 ± 45.57 ng·h/mL for the transdermal patch was much higher than that for oral administration (15 mg/kg). In conclusion, the drug-in-adhesive patch containing koumine provides a steady plasma koumine level and sustained release in vivo and can be an effective means of transdermal delivery for koumine.

Evodiamine Suppresses ABCG2 Mediated Drug Resistance by Inhibiting p50/p65 NF-κB Pathway in Colorectal Cancer.

Evodiamine (Evo), extracted from the Chinese herbal medicine Evodia rutaecarpa, has cytotoxic effects on different types of human cancer cells. However, its effects on drug resistance and their molecular mechanism and therapeutic target in colorectal cancer are not well understood. In the present study, we observed that Evo inhibited cell growth and induced apoptosis in adose-and time-dependent manner in HCT-116/L-OHP cells. Moreover, Evo treatment reduced Rhodamine 123 accumulation and ATPase activity in HCT-116/L-OHP cells, indicating that Evo decreased the efflux function in HCT-116/L-OHP cells. Interestingly, phosphorylation of NF-κB pathway, particularly p50/p65, was also inhibited by Evo treatment. Furthermore the effect of Evo in reversing drug resistance and suppressing phosphorylation of NF-κB pathway were attenuated after treatment with the NF-κB activator (LPS). Additionally, Evo inhibited the tumor growth in a colorectal MDR cancer xenograft model and down regulated p-NF-κB level in vivo. Our study provided the first direct evidence that Evo can attenuate multidrug resistance by blocking p-NF-κB signaling pathway in human colorectal cancer. Evo could be a potential candidate for cancer chemotherapy.

Long-Term Alcohol-Induced Activation of Mammalian Target of Rapamycin is a Key Risk Factor of Epilepsy.

BACKGROUND The aim of this study was to determine whether activation of mammalian target of rapamycin (mTOR) is a key epileptogenic mechanism in the development of alcohol-related seizure. MATERIAL AND METHODS C57BL/6 mice were administered 10% ethanol in drinking water for 9 weeks. Video-electroencephalography (EEG) monitoring was then used to assess seizure frequency after alcohol and rapamycin treatment. In addition, mouse neuroblastoma NG108-15 cells were treated ethanol for 3 days and subsequently treated with AKT inhibitor LY294002 for 2-12 h. The in vitro kinase assay was performed for determining mTOR activity. Western blot analysis was used to determine the expression of P-AKT, P-S6K, and P-S6. RESULTS Long-term ethanol treatment markedly increased the seizure frequency of C57/BL6 mice over time. Moreover, ethanol treatment increased the expression level of P-S6 over time. Ethanol-induced seizure can be reversed by rapamycin. In addition, the in vitro kinase assay showed mTOR activity was activated by ethanol. Compared with NG108-15 cells treated without both ethanol and LY294002, ethanol increased the expression level of P-AKT, P-S6K, and P-S6, whereas LY294002 had opposite effects on expression levels of these proteins. CONCLUSIONS Our findings indicate that long-term alcohol intake increases the risk of epilepsy via activation of mTOR signaling. Moreover, ethanol-induced mTOR activation may be dependent on the AKT-mTOR signaling pathway. The key molecules involved in AKT-mTOR signaling pathway may serve as potential targets in the treatment of epilepsy.

Effective Spatial Separation of PC12 and NIH3T3 Cells by the Microgrooved Surface of Biocompatible Polymer Substrates.

Most organs and tissues are composed of more than one type of cell that is spatially separated and located in different regions. This study used a microgrooved poly(lactic-co-glycolic acid) (PLGA) substrate to guide two types of cocultured cells to two spatially separated regions. Specifically, PC12 pheochromocytoma cells are guided to the inside of microgrooves, whereas NIH3T3 fibroblasts are guided to the ridge area in between neighboring parallel microgrooves. In addition, the microgrooved structures can significantly promote the proliferation and neural differentiation of PC12 cells as well as the osteogenic differentiation of NIH3T3 cells. Therefore, the microgrooved PLGA surface with separated PC12 and NIH3T3 cells can serve as a potential model system for studying nerve reconstruction in bone-repairing scaffolds.

Zuo Jin Wan reverses P-gp-mediated drug-resistance by inhibiting activation of the PI3K/Akt/NF-κB pathway.

BACKGROUND: Zuo-Jin-Wan (ZJW), a traditional Chinese medicine formula, has been identified to be effective against drug resistance in cancer. In the present study, we investigated the effect of ZJW on acquired oxaliplatin-resistant and the PI3K/Akt/NF-κB pathway in vitro. METHODS: We tested the dose-response relationship of ZJW on reversing drug-resistance by CCK-8 assay and flow cytometry analysis in vitro. The protein expression of P-gp, MRP-2, LRP, and ABCB1 mRNA expression level were evaluated by Western blot and quantitative RT-PCR. The activities of PI3K/Akt/NF-κB pathway were also examined with or without ZJW, including Akt, IκB, p65 and their phosphorylation expression. RESULTS: We found that ZJW significantly enhanced the sensitivity of chemotherapeutic drugs and increased oxaliplatin (L-OHP)-induced cell apoptosis in a time- and dose-dependent manner. Moreover, both ZJW and a PI3K specific inhibitor (LY294002) suppressed phosphorylation of Akt (Ser473) and NF-κB, which is necessary in the activation of the PI3K/Akt/NF-κB pathway. The effect of ZJW in reversing drug-resistance and suppressing phosphorylation of Akt (Ser473) and NF-κB were weakened after treatment with a PI3K/Akt activator in HCT116/L-OHP cells. CONCLUSIONS: Our study has provided the first direct evidence that ZJW reverses drug-resistance in human colorectal cancer by blocking the PI3K/Akt/NF-κB signaling pathway, and could be considered as a useful drug for cancer therapy.

Apoptotic extracellular vesicles restore homeostasis of the articular microenvironment for the treatment of rheumatoid arthritis.

Rheumatoid arthritis (RA) is a severe autoimmune disease with symptoms including synovial inflammation, cartilage erosion, and bone loss in RA lesions, which eventually lead to joint deformity and function loss. Most current treatments fail to achieve satisfying therapeutic outcomes with some adverse effects. Extracellular vesicles derived from apoptotic cells (apoEVs) have emerged as important mediators in intercellular communication regulating diverse physiological and pathological processes. In this study, we investigated the therapeutic efficacy of macrophage-derived and osteoclast-derived apoEVs (Mφ-apoEVs and OC-apoEVs) on RA. The in vitro results showed that both Mφ-apoEVs and OC-apoEVs induced macrophage repolarization toward the anti-inflammatory M2 phenotype, promoted chondrocyte functions and chondrogenesis, and inhibited osteoclast formation and maturation. In addition, OC-apoEVs promoted osteogenic differentiation. The in vivo study on the CIA mouse model further demonstrated that apoEVs could couple various functions and exert synergistic effects on the joint with RA, as evidenced by the regression of synovial inflammation, the reversal of cartilage damage and bone erosion, and the preservation of joint structure. These findings demonstrated that Mφ-apoEVs and OC-apoEVs contributed to restoring the homeostasis of the overall microenvironment in the RA joint and highlighted their potential application as a promising alternative to treat RA.

Suppression of LPS-activated inflammatory responses and chromosomal histone modifications in macrophages by micropattern-induced nuclear deformation.

Macrophages are important immune effector cells which participate various physiological and pathological conditions. Numerous studies have demonstrated the regulation of macrophage phenotype by micropatterns. It is well accepted that micropatterns affect cellular behaviors through changing cell shape and modulating the associated mechanical sensors on the plasma membrane and cytoskeleton. However, the role of nucleus, which serves as a critical physical sensing device, is often ignored. Herein, we found the nuclear deformation and the subsequently increased chromosomal histone methylation (H3K36me2) may contribute to the micropattern-induced suppression of macrophage inflammatory responses. Specifically, macrophages on micropatterned surfaces expressed lower levels of key inflammatory genes, compared with those on flat surfaces. Further investigation on macrophage nuclei showed that micropatterned surfaces cause shrinkage of nucleus volume and compaction of chromatin. Moreover, micropatterned surfaces elevated the methylation level of H3K36me2 in macrophages, while decreased the methylation level of H3K4me3. Our study provides new mechanistic insight into how micropatterns affect macrophage phenotype and highlights the importance of nuclear shape and chromatin histone modification in mediating micropattern-induced change in cell behaviors.

A chemiluminescence immunoassay for type IV collagen as a promising marker for liver fibrosis and cirrhosis.

Herein, a magnetic bead-based chemiluminescence assay is reported to detect type IV collagen (col-IV) in serum samples. Magnetic beads (MBs) exhibit biocompatibility. Taking advantage of this property, they were conjugated with the col-IV antibody. For the determination of col-IV, the interaction of the col-IV sample, anti-(col-IV)-alkaline phosphatase (anti-(col-IV)-ALP) and anti-col-IV-magnetic beads (anti-(col-IV)-MBs) was performed to generate chemiluminescence. Under the optimized conditions, the developed method displayed good linearity in the concentration range of 20-2000 ng mL-1 with the limit of 0.79 ng mL-1. The repeatability coefficient of variation (CV) for col-IV detection ranged from 3.16% to 7.50%. The col-IV level in samples collected from a hospital was assessed by the chemiluminescence assay. Satisfactory recoveries were obtained ranging from 93.30% to 100.14%. In conclusion, the magnetic bead-based chemiluminescence assay may be used as a routine and efficient tool to detect type IV collagen in clinical diagnosis.