Restriction map of the hepatitis B virus DNA cloned in Escherichia coli.

A plasmid carrying the complete genome of hepatitis B virus (HBV) inserted into the BamHI site of the pBR322 plasmid vector has been constructed. The physical map of HBV DNA established for 13 restriction endonucleases allows to conclude that the cloned DNA is similar, but not identical to the HBV DNA of ayw subtype.

Expression of hepatitis B virus surface antigen gene in Escherichia coli.

Direct expression of hepatitis B virus (HBV) surface antigen (HBsAg) gene under the control of the Escherichia coli tryptophan operon (trp) promoter has been achieved. Synthesis of HBsAg (both complete and lacking its N-terminal segment) as a part of hybrid proteins with the N-terminal portion coded by genes cat, kan or bla is controlled by the appropriate promoters, as well as by the trp promoter. The highest levels of expression, including those for direct synthesis of HBsAg, provide the accumulation of about 10(5) polypeptide molecules per bacterial cell.

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr.

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.

Recombinant core particles of hepatitis B virus exposing foreign antigenic determinants on their surface.

Insertion of foreign oligopeptide sequences (40-50 amino acids in length) into the Pro144 position of hepatitis B core antigen (HBcAg) leads to the formation of chimeric capsids in Escherichia coli cells. These capsids are morphologically and immunologically similar to native HBcAg, but expose the inserted oligopeptides on their outer surface and exhibit antigenic and immunogenic characteristics of the latter. As a source of model antigenic determinants, the appropriate DNA copies excised from cloned viral genes such as the pre-S region of hepatitis B virus, the transmembrane protein gp41 of human immunodeficiency virus 1 and the envelope protein gp51 of bovine leukemia virus have been used. The localization of the inserted antigenic determinants on the surface of chimeric capsids does not depend on the presence or absence of the arginine-rich, 39 amino acid-long C terminus of HBcAg.

Affinity labelling of Escherichia coli ribosomes with a benzylidene derivative of AUGU6 within initiation and pretranslocational complexes.

Affinity labelling of E. coli ribosomes with the 2',3'-O-[4-(N-2-chloroethyl)-N-methylamino]benzylidene derivative of AUGU6 was studied within the initiation complex (complex I) obtained by using fMet-tRNAMetf and initiation factors and within the pretranslocational complex (complex II) obtained by treatment of complex I with the ternary complex Phe-tRNAPhe.GTP.EF-Tu. Both proteins and rRNA of 30 S as well as 50 S subunits were found to be labelled. Sets of proteins labelled within complexes I and II differ considerably. Within complex II, proteins S13 and L10 were labelled preferentially. On the other hand, within complex I, multiple modification is observed (proteins S4, S12, S13, S14, S15, S18, S19, S20/L26 were found to be alkylated) despite the single fixation of a template in the ribosome by interaction of the AUG codon with fMet-tRNAMetf.

Recognition of messenger RNA during translational initiation in Escherichia coli.

The structural aspects of recognition by E. coli ribosomes of translational initiation regions on homologous messenger RNAs have been reviewed. Also discussed is the location of initiation region on mRNA, its confines, typical nucleotide sequences responsible for initiation signal, and the influence of RNA macrostructure on protein synthesis initiation. Most of the published DNA nucleotide sequences surrounding the start of various E. coli genes and those of its phages have been collected.

Monoclonal antibodies against genetically manipulated hepatitis B core antigen.

Four different hybridoma clones secreting anti-HBcAg antibodies were constructed by fusing cells of the mouse myeloma line SP2/0 with lymphocytes from mice immunized with bacterially produced HBcAg. The monoclonal antibodies were immunologically characterized and used for HBcAg detection by ELISA. This monoclonal-antibody-based assay was compared with ELISA based on polyclonal human anti-HBcAg IgG for sensitivity and specificity. The monoclonal antibody reacted specifically both with the bacterially produced HBcAg and HBcAg isolated from human liver, but did not react with HBeAg. The human polyclonal antibody reacted with HBcAg, but also with HBeAg.

[Effect of synthetic polynucleotides and RNA on poly(C)-dependent poly(G) polymerase activity of Q beta replicase].

The effect of synthetic polynucleotides and phage RNA on poly(C)-dependent synthesis of poly (G) by Qbeta replicase is studied. It is shown that single stranded poly(U) and poly (dT) are strong inhibitors whereas structured polynucleotides poly(A), MS2 RNA as well as double stranded complexes poly(A)-poly(U) and poly(A)-poly(dT) do not affect the synthesis of poly(G). It is suggested that contact region of template with enzyme has single stranded unhelical structure and affinity of polynucleotides to Qbeta replicase is determined by degree of their secondary structure.

The regulatory region of MS2 phage RNA replicase cistron. III. Characterization of fragments resulting from S1 nuclease digestion.

The functionally active fragments MS2 R(-53 leads to 6) and MS2 R(-53 leads to 3) comprising the regulatory region for the replicase cistron have been isolated from MS2 RNA-coat protein complex following T1 RNase digestion. In order to obtain shorter fragments, active in coat protein binding and initiation of translation, MS2 R(-53 leads to 6) was cleaved with S1 nuclease. The results indicate that S1 nuclease attacks the most susceptible loop regions of the two hairpin helices of MSZ R(-53) leads to 6). Among the three fragments which have been isolated, only MS2 R(-35/33 leads to 6) containing the intact hairpin (b) region with initiation codon AUG is active in the coat protein binding. Functional activity exerted by another polynucleotide MS R(-17 leads to 6) supports the assumption that specific binding with the coat protein is determined by the hairpin (b) region prior to the replicase cistron.

The regulatory region of phage fr replicase cistron. III. Initiation activity of specific fr RNA fragments.

RNA fragments from phage fr covering the complete or part of the replicase cistron initiation region have been used as templates in the formation of a ribosomal initiation complex in vitro. The results so obtained together with our earlier findings in a similar approach applied to fragments of the structurally related RNA from phage MS2 have allowed us to pinpoint the boundaries of the replicase cistron initiation region on phage RNA. A structural model of the above initiation region has been provided which shows that besides the minimal initiation region (comprises the Shine-Dalgarno sequence and initiator AUG), the flanking regions are also involved and are responsible for additional interactions with the ribosome. The flanking regions possibly contribute to the stability of specific contact between the ribosome and template realized by the minimal initiation region.

Replication of RNA bacteriophages in the presence of rifamycin.

Replication of RNA bacteriophages in the presence of rifamycin was studied in different Escherichia coli strains that vary in RNase content but are not isogenic: AB259 RNase+, Q13 RNase I- PNPase-, AB105 RNase I- RNase III-. It was found that rifamycin did not affect characteristics of phage replication such as the general pattern of viral RNA synthesis and intracellular development of the phage. These characteristics are strain specific and independent of the cell growth rate, which defines only phage release. The inhibition of cell division by rifamycin interfered with the release of the phage and thus produced an apparent effect of rifamycin on phage replication.

Control of replication in RNA bacteriophages.

The rates of viral RNA and protein syntheses for wild-type RNA bacteriophages and their nonpolar, coat protein amber mutants were determined in amber suppressor (S26R1E, Su-1 and H12R8a, Su-3) and nonsuppressor (AB259, S26, and Q13) strains of Escherichia coli in the presence of rifamycin. It was demonstrated that the rates of synthesis of phage-specific replicase and RNA minus strands drop off concurrently in both wild-type and coat protein mutant-infected Su(-) and Su(+) cells after 10 and 15 min postinfection, respectively. The rate of synthesis of RNA plus strands started to decline 5 to 10 min later in both cases. Excessive synthesis of replicase in the coat protein mutant-infected cells was accompanied by a similar overproduction of RNA minus strands, but not of plus strands. Partial suppression of protein synthesis in wild-type phage-infected cells abolishing coat protein control over replicase accumulation led to prolongation of replicase synthesis. Such an effect was observed also in coat protein mutant-infected cells, indicating that the excess of replicase itself may be capable of suppression of replicase synthesis in the absence of coat protein. The prolongation of replicase synthesis was followed by the prolonged synthesis of RNA minus strands in both cases. Moreover, replicase and minus strands were formed in nearly equal amounts when protein synthesis was partially inhibited. Assuming functional instability of phage RNAs, the observed coupling of replicase and minus-strand RNA synthesis offers a possibility for control of viral RNA replication by means of control of replicase synthesis on the translational level. A hypothesis is put forward to explain the molecular mechanism of such coupling between the syntheses of replicase and RNA minus strands.

The regulatory region of MS2 phage RNA replicase cistron. IV. Functional activity of specific MS2 RNA fragments in formation of the 70 S initiation complex of protein biosynthesis.

The initiation region of the MS2 replicase cistron can be isolated as a fragment 59 bases in length protected from RNAase by the binding of the coat protein which serves as a translational repressor. This fragment MS2 R(-53 leads to 6) starts 53 bases before the initiation codon and retains full activity in binding ribosomes. We have investigated the functional activity in initiation of a series of fragments from this region variously shortened from the 5'-end. Ribosome protected fragments starting 17 or 21 bases before the AUG are unable to rebind to ribosomes. The shortest fragment which has this activity was produced by partial S1 nuclease digestion and starts 33 to 35 bases before the AUG. The initiation signal comprises some nucleotides between 21 and 33 bases before the initiation codon and the regulatory region responsible for initiation is longer than that protected by the ribosome in the final initiation complex.

Immunogenicity of recombinant core particles of hepatitis B virus containing epitopes of human immunodeficiency virus 1 core antigen.

A Gag protein segment of human immunodeficiency virus 1 (HIV-1) has been fused to a C terminally truncated core antigen of hepatitis B virus (HBcAg) using an E. coli expression system. Fusion of 90 amino acids of HIV-1 Gag protein to HBcAg still allowed the formation of capsids presenting on their surface epitopes of HIV-1 core protein, whereas fusion of 317, 189, or 100 amino acids of Gag prevented self-assembly of chimeric particles. Mice immunized with recombinant particles emulsified with Freund's complete adjuvant (CFA) or aluminium hydroxide developed high anti-HBcAg titers. However, anti-HIVp24 antibodies were detected only in mice inoculated with immunogen emulsified with CFA.

Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers.

DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription.