Hirschsprung's disease: m6A methylase VIRMA suppresses cell migration and proliferation by regulating GSK3ß.

BACKGROUND: N6-methyladenosine (m6A) is the most abundant mRNA modification in mammals, participating in various biological processes. VIRMA is a key methyltransferase involved in m6A modification. However, the role of VIRMA in Hirschsprung's disease (HSCR) remains unclear. This study aims to investigate the function of VIRMA in HSCR and identify its corresponding regulatory mechanisms. METHODS: The expression of VIRMA and GSK3ß in colon tissues of HSCR was examined using RT-qPCR, Western blot, and Immunohistochemistry. Immunofluorescence detected localization of VIRMA and GSK3ß. Cell proliferation was measured by CCK8 and EdU assays, and cell migration was evaluated via cell migration and wound healing assays. The stability of GSK3ß mRNA was assessed using the actinomycin D assay and the overall level of m6A in cells was assessed by colorimetric assay. RESULTS: VIRMA was significantly downregulated in narrow-segment colon tissue. Silencing of VIRMA inhibited cell proliferation and migration. VIRMA can inhibit the degradation of GSK3ß mRNA and increase the expression of GSK3ß. GSK3ß was significantly upregulated in narrow-segment colon tissues. Accordingly, our findings showed that GSK3ß mediated the VIRMA-driven cell migration and proliferation. CONCLUSION: VIRMA can inhibit cell migration and proliferation by upregulating the expression of GSK3ß, contributing to the onset of HSCR. IMPACT: The expressions of VIRMA were significantly reduced in HSCR, while GSK3ß expression was increased in HSCR, and can be used as a molecular marker. VIRMA overexpression promoted the proliferation and migration of SH-SY5Y and HEK-293T cells. VIRMA can inhibit the degradation of GSK3ß mRNA and increase the expression of GSK3ß.

Comparison of pulmonary function during interscalene block vs. supraclavicular block: a single-center, double-blind, randomized trial.

BACKROUND: The supraclavicular plexus block (SCB) and interscalene plexus block (ISB) have the potential to pulmonary function, the duration of the potential remains uncertain. So, we compared the effect of SCB and ISB on pulmonary function, especially the duration time. METHODS: Ninety-six patients were finally allocated to group I and group S. The ISB and the SCB procedures were performed with ultrasound guidance before anesthesia induction. An investigator recorded the diaphragm mobility and respiratory function test indicators before the block (T0) and at 30 min (T30 min), 4 h (T4), 8 h (T8), and 12 h (T12) after the block. The diaphragmatic paralysis rate was calculated for above timepoint. The VAS, the recovery time for the sensory and motor block, and adverse reactions within 24 h of administering the block were also recorded. RESULTS: The recovery times of diaphragm mobility in group I were longer than those in group S. Compared with group I, group S had a significantly lower diaphragmatic paralysis rate during eupnea breathing at T30 min and T8 after the block. Similarly, group S had a significantly lower diaphragmatic paralysis rate at deep breathing at T30 min, T8, and T12 after the block. The recovery times of FEV1 and FVC in group I were longer than those in group S. The other results were not statistically significant. CONCLUSIONS: Ultrasound-guided ISB resulted in a longer periods with a suppressive effect on pulmonary function than SCB. TRIALS REGISTRATION: 17/12/2019, ChiCTR1900028286.

The m6A methyltransferase METTL3 affects cell proliferation and migration by regulating YAP expression in Hirschsprung disease.

BACKGROUND: METTL3, an mRNA m6A methyltransferase, has been implicated in various steps of mRNA metabolism, such as stabilization, splicing, nuclear transportation, translation, and degradation. However, whether METTL3 dysregulation is involved in Hirschsprung disease (HSCR) development remains unclear. In this study, we preliminarily elucidated the role of METTL3 in HSCR and sought to identify the associated molecular mechanism. METHODS: The gene expression levels of YAP and several methyltransferases, demethylases, and effectors were evaluated by RT-qPCR. Protein levels were evaluated by western blot and immunohistochemistry. Cell proliferation and migration were detected by CCK-8 and Transwell assays, respectively. The overall levels of m6A modification were determined by colorimetry. RESULTS: We found that m6A levels were reduced in the stenotic intestinal tissue of patients with HSCR. When METTL3 was knocked down in SH-SY5Y and HEK-293T cells, the proliferative and migratory abilities of the cells were inhibited, m6A modification levels were reduced, and YAP expression was increased. Importantly, YAP and METTL3 expression displayed a negative correlation in both cell lines as well as in HSCR tissue. CONCLUSIONS: Our results provide evidence for an interaction between METTL3 and YAP in HSCR, and further suggest that METTL3 is involved in the pathogenesis of HSCR by regulating neural crest cell proliferation and migration upstream of YAP.

[Analysis of variant of GLI3 gene in a child featuring autosomal dominant Pallister-Hall syndrome].

OBJECTIVE: To explore the clinical and genetic characteristics of a child with Pallister-Hall syndrome (PHS). METHODS: DNA was extracted from peripheral blood sample from the child and subjected to whole exome sequencing. Suspected variants were verified by Sanger sequencing of his family members. RESULTS: Genetic testing revealed that the child has harbored a heterozygous c.3320_3330delGGTACGAGCAG (p.G1107Afs×18) variant of the GLI3 gene. Neither parent was found to carry the same variant. CONCLUSION: The c.3320_3330delGGTACGAGCAG (p.G1107Afs×18) frameshift variant of the GLI3 gene probably underlay the pathogenesis of PHS in this child. Genetic testing should be considered for patients featuring hypothalamic hamartoma and central polydactyly.

[Effectsof the time interval and the endocrine therapy on the prognosis and consistency of the biological indicatorsin patients with bilateral primary breast cancer].

OBJECTIVE: The study aimed to discuss whether the time interval between bilateral primary breast cancers (BPBC)and the endocrine therapy status after thefirst primary cancer could influence the prognosis and consistency of the biological indicators. METHODS: Clinical data of 133 patients with BPBC in cancer institute and hospital of Tianjin medical university from January 2005 to December 2008 were retrospectively analyzed. The patients were divided into two groups according to the time interval and the endocrine therapy. The consistency of hormone receptor and human epidermal growth factor receptor-2 (HER-2) expression between the bilateral tumors and the prognosis of BPBC in different groups were analyzed. RESULTS: With the extension of time interval, the consistent rate of biological indicators between the bilateral tumorshas decreased.The consistent rate of estrogen receptor (ER)was higher than that of progestin hormone (PR) in each group. When the time interval was six or less months, ER and HER-2 had the consistency and correlation between the two primary cancers(P≤0.05). In patients who did not receiveendocrine therapyafter the first cancer, the consistent rates of the biological indicators were higher and ER had betterconsistency and correlation(P≤0.05). Time interval and endocrine therapy hadno effecton the overall survival of the patients. CONCLUSION: With the extension of the time interval, the consistency of the biological indicators in BPBChas decreased.ER and HER-2 of the bilateral tumorshad a high similarity in patients whose time interval wasno more than 6 months.Endocrine therapy could also affect the consistency of the biological indicators.However, these two factors were not associated with prognosis in patients with BPBC.

The roles of non-coding RNAs in Hirschsprung's disease.

Hirschsprung's disease (HSCR) is a congenital disorder characterized by the absence of ganglion cells in the colon, leading to various intestinal complications. The etiology of HSCR stems from complex genetic and environmental interactions, of which the intricate roles of non-coding RNAs (ncRNAs) are a key area of research. However, the roles of ncRNAs in the pathogenesis of HSCR have not been fully elucidated. In order to understand the variety of symptoms caused by HSCR and develop new therapeutic approaches, it is essential to understand the underlying biological genetic basis of HSCR. This review presents a comprehensive overview of the current understanding regarding the involvement of ncRNAs in HSCR, including microRNAs (miRNAs), long noncoding RNAs (lncRNAs), and circular RNAs (circRNAs). Additionally, it provides a summary of the molecular mechanisms through which ncRNAs regulate the expression of genes related to the proliferation, migration, and differentiation of intestinal neural crest cells, thereby contributing to the advancement of HSCR research.

HCV peptide (C5A), an amphipathic α-helical peptide of hepatitis virus C, is an activator of N-formyl peptide receptor in human phagocytes.

The hepatitis C virus (HCV) nonstructural 5A, a phosphorylated zinc metalloprotein, is an essential component of the HCV replication complex. An amphipathic α-helical peptide (HCV peptide [C5A]) derived from nonstructural 5A membrane anchor domain possesses potent anti-HCV and anti-HIV activity in vitro. In this study, we aimed to investigate the potential of HCV peptide (C5A) to regulate host immune responses. The capacity of HCV peptide (C5A) in vitro to induce migration and calcium mobilization of human phagocytes and chemoattractant receptor-transfected cells was investigated. The recruitment of phagocytes in vivo induced by HCV peptide (C5A) and its adjuvant activity were examined. The results revealed that HCV peptide (C5A) was a chemoattractant and activator of human phagocytic leukocytes by using a G-protein coupled receptor, namely formyl peptide receptor. In mice, HCV peptide (C5A) induced massive phagocyte infiltration after injection in the air pouch or the s.c. region. HCV peptide (C5A) also acted as an immune adjuvant by enhancing specific T cell responses to Ag challenge in mice. Our results suggest that HCV peptide (C5A) derived from HCV regulates innate and adaptive immunity in the host by activating the formyl peptide receptor.

Use of Hydrogeochemistry and Isotopes for Evaluation of Groundwater in Qilian Coal Base of China.

The Jiangcang Basin is an important mining area of the former Qilian Mountain large coal base in Qinghai Province, and understanding the groundwater circulation mechanism is the basis for studying the hydrological effects of permafrost degradation in alpine regions. In this study, hydrogeochemical and multiple isotope tracer analysis methods are used to understand the chemical evolution and circulation mechanisms of the groundwater in the typical alpine region of the Jiangcang Basin. The diversity of the groundwater hydrochemistry in the study area reflects the complexity of the hydrogeochemical environment in which it is located. The suprapermafrost water and intrapermafrost water are recharged by modern meteoric water. The groundwater is closely hydraulically connected to the surface water with weak evaporation overall. The high δ34 S value of deep groundwater is due to SO4 reduction, and SO4 2- -rich snow recharge with lixiviated sulfate minerals are the main controlling factor for the high SO4 2- concentration in groundwater. According to the multivariate water conversion relationships, it reveals that the river receives more groundwater recharge, suprapermafrost water is recharged by the proportion of meteoric water, which is closely related to the mountainous area at the edge of the basin, while intrapermafrost water is mainly recharged by the shallow groundwater. This study provides a data-driven approach to understanding groundwater recharge and evolution in alpine regions, in addition to having significant implications for water resource management and ecological environmental protection in coal bases of the Tibetan Plateau.

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report.

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

Characterization and Fine Mapping of qRPR1-3 and qRPR3-1, Two Major QTLs for Rind Penetrometer Resistance in Maize.

Stalk strength is one of the most important traits in maize, which affects stalk lodging resistance and, consequently, maize harvestable yield. Rind penetrometer resistance (RPR) as an effective and reliable measurement for evaluating maize stalk strength is positively correlated with stalk lodging resistance. In this study, one F2 and three F2:3 populations derived from the cross of inbred lines 3705I (the low RPR line) and LH277 (the high RPR line) were constructed for mapping quantitative trait loci (QTL), conferring RPR in maize. Fourteen RPR QTLs were identified in four environments and explained the phenotypic variation of RPR from 4.14 to 15.89%. By using a sequential fine-mapping strategy based on the progeny test, two major QTLs, qRPR1-3 and qRPR3-1, were narrowed down to 4-Mb and 550-kb genomic interval, respectively. The quantitative real-time PCR (qRT-PCR) assay was adopted to identify 12 candidate genes responsible for QTL qRPR3-1. These findings should facilitate the identification of the polymorphism loci underlying QTL qRPR3-1 and molecular breeding for RPR in maize.

Serum levels of laminin and von Willebrand factor in COVID-19 survivors 6 months after discharge.

OBJECTIVES: The aim of this study was to evaluate the clinical characteristics, pulmonary diffusion function, chest computed tomography (CT), and serum lung cell damage indicators of coronavirus disease 2019 (COVID-19) survivors 6 months after discharge. METHODS: Data of COVID-19 survivors discharged from hospital between January 21, 2020 and January 11, 2021 and healthy controls were collected. Serum levels of surfactant protein D (SP-D)1, the receptor for advanced glycation end products (RAGE)2, laminin, and von Willebrand factor (vWF) were measured in the healthy controls and COVID-19 survivors 6 months after discharge. The relationships between serum lung cell damage indicator levels and various parameters were explored. RESULTS: Fifty-two COVID-19 survivors (31 with non-severe disease and 21 with severe disease) and 30 controls were included. Serum levels of laminin in COVID-19 survivors 6 months after discharge were significantly higher than those in the controls. The increase was more significant in elderly and female patients. Serum levels of RAGE and vWF were not statistically different from those of the controls. However, 6 months after discharge, COVID-19 survivors with abnormal chest CT and those in the severe group had higher vWF levels. CONCLUSIONS: COVID-19 patients had abnormal lung injury indicators 6 months after discharge. The recovery time after infection is currently unknown, and long-term observation is required.

Detection and predictors of anti-SARS-CoV-2 antibody levels in COVID-19 patients at 8 months after symptom onset.

Aim: To determine SARS-CoV-2 specific IgM and IgG levels of patients with COVID-19 at 8 months after symptom onset and to explore the predictors of antibody levels. Materials & methods: The magnetic chemiluminescence method was used to measure the antibody levels. Clinical data were collected and analyzed retrospectively. Results: A total of 54 patients were enrolled in this study, of whom 59.3% were IgM positive and 96.4% were IgG positive. The multiple linear regression analysis revealed that the duration of RNA shedding, C-reactive protein level and disease severity were independent predictors of IgG levels. Conclusion: COVID-19 patients retained long-term viral-specific protective immunity. Disease severity, C-reactive protein level and duration of RNA shedding were related to antibody levels 8 months after symptom onset.

A Follow-Up Study of Lung Function and Chest Computed Tomography at 6 Months after Discharge in Patients with Coronavirus Disease 2019.

We aimed to investigate changes in pulmonary function and computed tomography (CT) findings in patients with coronavirus disease 2019 (COVID-19) during the recovery period. COVID-19 patients underwent symptom assessment, pulmonary function tests, and high-resolution chest CT 6 months after discharge from the hospital. Of the 54 patients enrolled, 31 and 23 were in the moderate and severe group, respectively. The main symptoms 6 months after discharge were fatigue and exertional dyspnea, experienced by 24.1% and 18.5% of patients, respectively, followed by smell and taste dysfunction (9.3%) and cough (5.6%). One patient dropped out of the pulmonary function tests. Of the remaining 54 patients, 41.5% had pulmonary dysfunction. Specifically, 7.5% presented with restrictive ventilatory dysfunction (forced vital capacity <80% of the predicted value), 18.9% presented with small airway dysfunction, and 32.1% presented with pulmonary diffusion impairment (diffusing capacity for carbon monoxide <80% of the predicted value). Of the 54 patients enrolled, six patients dropped out of the chest CT tests. Eleven of the remaining 48 patients presented with abnormal lung CT findings 6 months after discharge. Patients with residual lung lesions were more common in the severe group (52.6%) than in the moderate group (3.4%); a higher proportion of patients had involvement of both lungs (42.1% vs. 3.4%) in the severe group. The residual lung lesions were mainly ground-glass opacities (20.8%) and linear opacities (14.6%). Semiquantitative visual scoring of the CT findings revealed significantly higher scores in the left, right, and both lungs in the severe group than in the moderate group. COVID-19 patients 6 months after discharge mostly presented with fatigue and exertional dyspnea, and their pulmonary dysfunction was mostly characterized by pulmonary diffusion impairment. As revealed by chest CT, the severe group had a higher prevalence of residual lesions than the moderate group, and the residual lesions mostly manifested as ground-glass opacities and linear opacities.

A follow-up study of respiratory and physical function after discharge in patients with redetectable positive SARS-CoV-2 nucleic acid results following recovery from COVID-19.

OBJECTIVE: The aim of this study was to evaluate the respiratory and physical function of patients who retested positive for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA during post-coronavirus disease 2019 (COVID-19) rehabilitation. METHODS: A total of 302 discharged COVID-19 patients were included. Discharged patients were followed up for 14 days to 6 months. The modified Medical Research Council (mMRC) dyspnea scale, Borg rating of perceived exertion, and manual muscle testing (MMT) scores on day 14 and at 6 months after discharge were compared between the redetectable positive (RP) and non-RP (NRP) groups. Prognoses of respiratory and physical function were compared between patients who recovered from moderate and severe COVID-19. RESULTS: Of the study patients, 7.6% were RP. The proportion of patients who used antiviral drugs was significantly lower in the RP group than in the NRP group. There were no differences in mMRC, Borg, or MMT scores within the RP and NRP groups. The mMRC, Borg, and MMT scores were worse for patients with severe disease when compared to those with moderate disease at both follow-up time points. CONCLUSIONS: COVID-19 patients who did not take antiviral drugs were more likely to be RP after discharge. The recovery of respiratory and physical function was not related to re-positivity during rehabilitation, but was related to disease severity during hospitalization.

The reference genome of Miscanthus floridulus illuminates the evolution of Saccharinae.

Miscanthus, a member of the Saccharinae subtribe that includes sorghum and sugarcane, has been widely studied as a feedstock for cellulosic biofuel production. Here, we report the sequencing and assembly of the Miscanthus floridulus genome by the integration of PacBio sequencing and Hi-C mapping, resulting in a chromosome-scale, high-quality reference genome of the genus Miscanthus. Comparisons among Saccharinae genomes suggest that Sorghum split first from the common ancestor of Saccharum and Miscanthus, which subsequently diverged from each other, with two successive whole-genome duplication events occurring independently in the Saccharum genus and one whole-genome duplication occurring in the Miscanthus genus. Fusion of two chromosomes occurred during rediploidization in M. floridulus and no significant subgenome dominance was observed. A survey of cellulose synthases (CesA) in M. floridulus revealed quite high expression of most CesA genes in growing stems, which is in agreement with the high cellulose content of this species. Resequencing and comparisons of 75 Miscanthus accessions suggest that M. lutarioriparius is genetically close to M. sacchariflorus and that M. floridulus is more distantly related to other species and is more genetically diverse. This study provides a valuable genomic resource for molecular breeding and improvement of Miscanthus and Saccharinae crops.

Sesamin inhibits bacterial formylpeptide-induced inflammatory responses in a murine air-pouch model and in THP-1 human monocytes.

The reaction of human leukocytes to chemoattractants is an important component of the host immune response and also plays a crucial role in the development of inflammation. Sesamin has been shown to inhibit lipid peroxidation and regulate cytokine production. In this study, we examined the effect of sesamin on inflammatory responses elicited by the bacterial chemotactic peptide N-formyl-methionyl-leucyl-phenylalanine (fMLF) in vitro and in vivo and explored the mechanisms involved. fMLF is recognized by a human G protein-coupled receptor formyl peptide receptor (FPR) on phagocytic leukocytes. Sesamin at concentrations between 12.5 and 50 micromol/L inhibited fMLF-induced chemotaxis of human monocyte cell line THP-1 differentiated with dibutyryl cyclic AMP (P < 0.01). Similarly, sesamin inhibited FPR-transfected rat basophilic leukemia cell [epitope-tagged human FPR (ETFR) cell] migration toward fMLF (P < 0.01). In fMLF-induced inflammation in a murine air-pouch model, intraperitoneal administration of sesamin (12 mgkg(-1)d(-1) for 2 d) suppressed leukocyte infiltration into the air pouch induced by fMLF [(62.89 +/- 7.93) x 10(4) vs. (19.67 +/- 4.43) x 10(4) cells/air pouch; n = 9; P < 0.001]. Ca(2+) mobilization and mitogen-activated protein kinase extracellular signal-regulated kinase (ERK1/2) activation are involved in fMLF-induced leukocyte migration. Pretreatment of ETFR cells with sesamin inhibited fMLF-induced ERK1/2 phosphorylation in a dose-dependent manner but did not affect fMLF-induced Ca(2+) flux. Electrophoretic mobility shift assay showed that pretreatment of THP-1 cells with sesamin dose dependently inhibited fMLF-induced nuclear factor-kappaB (NF-kappaB) activation. These results suggest that sesamin inhibits leukocyte activation by fMLF through ERK1/2- and NF-kappaB-related signaling pathways and thus is a potential compound for the management of inflammatory diseases.

Impact of early diagnosis of carotid artery stenosis by carotid ultrasound: A protocol of systematic review and meta-analysis.

BACKGROUND: The purpose of this study is to explore the impact of carotid ultrasound (CU) for early diagnosis of carotid artery stenosis (CAS). METHODS: Literatures will be sought from the following electronic databases: MEDLINE, EMBASE, Cochrane Library, PSYCINFO, Web of Science, Allied and Complementary Medicine Database, and China National Knowledge Infrastructure. The search will cover from the start of indexing to the present without any limitations of language and publication status. All study quality will be assessed by Quality Assessment of Diagnostic Accuracy Studies tool, and data will be analyzed by RevMan V.5.3 software and Stata V.12.0 software. RESULTS: This study will investigate the impact of CU for early diagnosis of CAS through sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, and diagnostic odds ratio. CONCLUSION: The findings of this study may provide helpful evidence for the impact of CU for early diagnosis of CAS. SYSTEMATIC REVIEW REGISTRATION: PROSPERO CRD42019153904.

Acinetobacter calcoaceticus CSY-P13 Mitigates Stress of Ferulic and p-Hydroxybenzoic Acids in Cucumber by Affecting Antioxidant Enzyme Activity and Soil Bacterial Community.

Ferulic acid (FA) and p-hydroxybenzoic acid (PHBA) are main phenolic compounds accumulated in rhizosphere of continuously cropped cucumber, causing stress in plants. Microbial degradation of a mixture of FA and PHBA is not well understood in soil. We isolated a strain CSY-P13 of Acinetobacter calcoaceticus, inoculated it into soil to protect cucumber from FA and PHBA stress, and explored a mechanism underlying the protection. CSY-P13 effectively degraded a mixture of FA and PHBA in culture solution under conditions of 39.37°C, pH 6.97, and 21.59 g L-1 potassium dihydrogen phosphate, giving rise to 4-vinyl guaiacol, vanillin, vanillic acid, and protocatechuic acid. During FA and PHBA degradation, activities of superoxide dismutase (SOD), catalase, ascorbate peroxidase, and dehydroascorbate reductase in CSY-P13 were induced. Inoculated into cucumber-planted soil containing 220 µg g-1 mixture of FA and PHBA, CSY-P13 degraded FA and PHBA in soil, increased plant height, and decreased malonaldehyde, superoxide radical, and hydrogen peroxide levels in leaves. CSY-P13 also enhanced SOD, guaiacol peroxidase, catalase, glutathione peroxidase, ascorbate peroxidase, monodehydroascorbate reductase, dehydroascorbate reductase, and glutathione reductase activities; increased ascorbate and glutathione contents; and elevated transcript levels of copper/zinc SOD, manganese SOD, and catalase in leaves under FA and PHBA. Moreover, CSY-P13 increased phosphatase, catalase, urease, and sucrase activities and changed bacterial richness, diversity, and community composition by high throughput sequencing in cucumber-planted soil supplemented with the mixture of FA and PHBA. So CSY-P13 degrades the mixture of FA and PHBA in soil and mitigates stress from the two phenolic compounds in cucumber by activating antioxidant enzymes, changing soil bacterial community, and inducing soil enzymes.

Biologically active peptides interacting with the G protein-coupled formylpeptide receptor.

Leucocytes accumulate at sites of inflammation and microbial infection in response to locally produced chemotactic factors. N-formylpeptides produced by Gram negative bacteria were among the first chemotactic factors structurally defined which signal through G protein-coupled formylpeptide receptor (FPR) and FPR-like 1 (FPRL1) expressed by phagocytic leukocytes in human and in mouse homogogues mFPR and mFPR2. During the past few years, a number of pathogen- and host-derived agonists/antagonists for FPR, FPRL1 and another FPR variant FPR-like 2 (FPRL2) have been identified. Activation of formylpeptide receptors (FPRs) in phagocytic leukocytes by agonists results in increased cell chemotaxis, phagocytosis, and release of pro-inflammatory mediators. Peptide agonists for FPRs have also been shown to possess immune adjuvant activity when injected in mice. In addition, FPR aberrantly expressed on highly malignant human glioblastoma cells promotes tumor cell migration, proliferation and production of vascular endothelial growth factor in response to agonists released by necrotic tumor cells. Therefore, formylpeptide receptor ligands, by interacting with FPRs, play important roles in host defense and in the rapid progression of human glioblastoma.

The prognostic value of node status in different breast cancer subtypes.

Nodal metastases and breast cancer subtypes (BCS) are both well-recognized prognostic indicators. However, the association between nodal metastases and BCS, and the prognostic value of nodal metastases in different BCS are still remains unclear. Our aim was to investigate the association between nodal metastases and BCS, and the prognostic value of nodal metastases in the different BCS.We found that the breast cancer subtype was closely associated with the pN stage. pN stage and breast cancer subtype were significantly associated with disease-free survival. The subgroup analysis showed that the patients in higher pN stage had a poor outcome than patients in lower pN stage in each breast cancer subtype. Furthermore, when the analysis was stratified by breast cancer subtype, we found that even in the same pN stage (pN0-pN2), there was significant survival difference among patients in different BCS, and Luminal A breast cancer patients had the best survival outcome. However, there were no significant survival difference between Luminal A patients and other breast cancer subtype when patients in pN3 stage. Thus, our study suggested that both lymph node status and molecular subtype played important roles in the outcome of breast cancer patients and they cannot replace each other.