Cloning and characterization of a core histone gene tandem repeat in Urechis caupo.

A Urechis caupo histone gene tandem repeat has been isolated from a 5.0-kilobase EcoRI genomic library in lambda gtWES.lambda B. Genomic reconstruction experiments indicate that the cloned sequence is repeated approximately 100 times per haploid genome. Unique restriction fragments from the cloned sequence hybridize with individual core histone genes from a histone gene tandem repeat of the sea urchin, Strongylocentrotus purpuratus. No hybridization is detected when restriction digests are probed with a sea urchin H1 histone gene. Hybrid selection and in vitro translation of embryo mRNAs demonstrate that the clone contains sequences complementary to all four core histones; however, no H1 histone is detected among the translation products. Based on a restriction site map of the clone and the subcloned sequences which hybridize to the histone mRNAs, the order of the core histone genes in the clone is shown to be H3 H2A H2B H4. S1 nuclease hybrid protection mapping is used to locate the coding regions and to determine the transcript lengths of the core histone mRNAs. The transcript lengths of H2A, H2B, H3, and H4 mRNAs are approximately 464, 438, 494, and 397 bases, respectively. The S1 nuclease mapping also demonstrates that H2A and H4 are transcribed from one DNA strand while H2B and H3 are transcribed from the other strand. In the tandem repeat, the genes are organized so that transcription of the H2A-H2B and H3-H4 gene pairs is divergent.

Nucleotide sequence of the Urechis caupo core histone gene tandem repeat.

The 4942 bp nucleotide sequence of a repeating unit from the core histone gene tandem repeat of Urechis caupo and the predicted amino acid sequence of the four core histones are presented. Putative promoter elements including the CAP site and TATA box as well as multiple CAAT-like sequences are identified upstream from each gene. Upstream from each core histone gene are 26 or 30 bp sequences that may have a promoter function and appear to be unique to Urechis histone genes. Located 5' to both H2A and H2B is the 26 bp sequence, GGTCATGTGACTCTAATACCGCGCTG. An identical, but inverted, 26 bp sequence is present upstream of H4. Upstream from the H3 gene, two regions of a 30 bp sequence, GGTCTTGTGGCGGGAACAAATACCGCAACG, are very similar to corresponding regions of the 26 bp sequence. Additional 10 bp conserved sequences, CAGCGGGCGC, are present only upstream from the H2A and H2B genes. Conserved sequences containing a region of dyad symmetry followed by a purine-rich sequence that are typical of histone mRNA termination sites are present 27 to 36 bp 3' from the termination codon. Short repetitive DNA sequence elements are present in the spacer sequences between the H2A and H3 genes and the H2B and H4 gene.

Detection of nitrate reductase activity of mycobacteria: an evaluation of the use of a powdered reagent in the test, and rapid swab methods as compared to the conventional test.

Tests using a powdered reagent proved to be an excellent alternative to the test using conventional reagents for the detection of nitrate reductase activity of mycobacteria. A rapid swab test, using either a dry or moist swab, showed inferior results to the conventional test.

Detection of bacterial nitrate reductase activity by the use of a powdered reagent and rapid swab methods as compared to the conventional test.

A rapid swab method using either a dry or moist swab soaked with potassium nitrate/benzalkonium chloride solution, and a method employing a single powdered reagent were assessed as possible alternatives to the conventional test for the detection of bacterial nitrate reductase activity. Results obtained by the use of the powdered reagent agreed 100% with those obtained by the conventional method. The moist swab method had a sensitivity and predictive value of the negative test of 80% and 73%, respectively. The dry swab method was least sensitive (72%) and had the lowest predictive value of the negative test (66%). The use of the single powdered reagent, which has a long shelf life, is a reliable alternative to the use of conventional reagents A and B. Results obtained by the rapid swab methods were inferior to those obtained by the conventional method.

Comparison of a new, bismuth-iron-sulfite-cycloserine agar for isolation of Clostridium perfringens with the tryptose-sulfite-cycloserine and blood agars.

A new differential and selective, bismuth-iron-sulfite-cycloserine (BISC) medium, for isolation and enumeration of Clostridium perfringens from food and feces, was developed. The medium was compared with the widely-used tryptose-sulfite-cycloserine (TSC) medium and blood agar (BA) in recovering actively growing cells, cold- (refrigerated and frozen) stressed, and heat-stressed C. perfringens cells, and heat-activated spores from human feces. Both selective media were satisfactory in recovering actively growing cells and heat-activated spores of C. perfringens. Both were inferior to non-inhibitory blood agar in recovering heat or cold-stressed cells. The advantages of the new BISC medium over the TSC medium were: elimination of the need to prepare pour- or overlay-agar plates, which simplified inoculation of specimens on the medium and simplified the subcultures of colonies for confirmatory identification. All colonies of C. perfringens developed on BISC were black or dark gray. This was contrary to TSC medium, which gave, on average, 39.6% of white colonies when inoculated with the pure cultures of C. perfringens.

Origin of the main class of repetitive DNA within selected Pennisetum species.

In an attempt to identify relationships among genomes of the allotetraploid Pennisetum purpureum Schumach and closely related Pennisetum species with which it can be successfully hybridized, repetitive DNA sequences were examined. Digestion with KpnI revealed two highly repetitive fragments of 140 bp and 160 bp. The possibility that these sequences could be used as genome markers was investigated. Average sequences were determined for the 140 bp and 160 bp KpnI families from P. purpureum and P. squamulatum Fresen. Average sequences (based upon four or five repeats) were determined for the P. glaucum (L.) R. Br. 140 bp KpnI family and the diploid P. hohenackeri Hochst. ex Steud. 160 bp KpnI family. The average sequences of the 160 bp KpnI families in P. purpureum and P. squamulatum differ by only nine bases. The 140 bp KpnI families of the three related species, P. purpureum, P. squamulantum, and P. glaucum are nearly identical, and thus likely represent a recent divergence from a common progenitor or a common genome. Each repetitive sequence may contain internal duplications, which probably diverged following amplification of the original sequence. The 140 bp KpnI repeat probably evolved from the 160 bp KpnI repeat since the missing 18 bp segment is part of the internal duplication that is otherwise conserved in the subrepeats. Tandemly arrayed repetitive sequences in plants are likely to be composed of subrepeats which have been duplicated and amplified.

De novo synthesis of an intron by the maize transposable element Dissociation.

The mechanisms by which introns are gained or lost in the evolution of eukaryotic genes remain poorly understood. The discovery that transposable elements sometimes alter RNA splicing to allow partial or imperfect removal of the element from the primary transcripts suggests that transposons are a potential and continuing source of new introns. To date, splicing events that precisely restore the wild-type RNA sequence at the site of insertion have not been detected. Here we describe alternative RNA splicing patterns that result in precise removal of a Dissociation (Ds) insertion and one copy of its eight-nucleotide host site duplication from an exon sequence of the maize shrunken2-mutabe1 (sh2-m1) mutant. In one case, perfect splicing of Ds was associated with aberrant splicing of an intron located 32 bp upstream of the insertion site. The second transcript type was indistinguishable from wild-type mRNA, indicating that Ds was spliced like a normal intron in about 2% of the sh2-m1 transcripts. Our results suggest that the transposition of Ds into sh2 in 1968, in effect, marked the creation of a new intron in a modern eukaryotic gene. The possibility of precise intron formation by a transposable element demonstrated here may be a general phenomenon of intron formation, since consensus intron splice sites can be explained by insertions that duplicate host sequences upon integration. A model is presented.