Crimean-Congo Hemorrhagic Fever Virus Kinetics in Serum, Saliva, and Urine, Iran, 2018.

Little is known about using noninvasive samples for diagnosing Crimean-Congo hemorrhagic fever (CCHF). We investigated detection of CCHF virus in serum, saliva, and urine samples. Our results indicate that serum is the best sample type for CCHF diagnosis; saliva can be used for noninvasive sampling.

The ins and outs of SARS-CoV-2 variants of concern (VOCs).

SARS-CoV-2, a newly emerging coronavirus that caused the COVID-19 epidemic, has been spreading quickly throughout the world. Despite immunization and some fairly effective therapeutic regimens, SARS-CoV-2 has been ravaging patients, health workers, and the economy. SARS-CoV-2 mutates and evolves to adapt to its host as a result of extreme selection pressure. As a consequence, new SARS-CoV-2 variants have emerged, some of which are classified as variants of concern (VOC) because they exhibit greater transmissibility, cause more-severe disease, are better able to escape immunity, or cause higher mortality than the original Wuhan strain. Here, we introduce these VOCs and review their characteristics, such as transmissibility, immune escape, mortality risk, and diagnostics.

Severe acute respiratory syndrome-coronavirus-2 spike (S) protein based vaccine candidates: State of the art and future prospects.

Coronavirus disease 2019 (Covid-19) is caused by severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2) which is responsible for a global pandemic that started in late 2019 in Wuhan, China. To prevent the worldwide spread of this highly pathogenic virus, development of an effective and safe vaccine is urgently needed. The SARS-CoV-2 and SARS-CoV share a high degree of genetic and pathologic identity and share safety and immune-enhancement concerns regarding vaccine development. Prior animal studies with first generation (whole virus-based) preparations of SARS-CoV vaccines (inactivated and attenuated vaccine modalities) indicated the possibility of increased infectivity or eosinophilic infiltration by immunization. Therefore, development of second and third generation safer vaccines (by using modern vaccine platforms) is actively sought for this viral infection. The spike (S) protein of SARS-CoVs is the main determinant of cell entry and tropism and is responsible for facilitating zoonosis into humans and sustained person-to-person transmission. Furthermore, 'S' protein contains multiple neutralizing epitopes that play an essential role in the induction of neutralizing antibodies (nAbs) and protective immunity. Moreover, T-cell responses against the SARS-CoV-2 'S' protein have also been characterized that correlate to the IgG and IgA antibody titres in Covid-19 patients. Thus, S protein is an obvious candidate antigen for inclusion into vaccine platforms against SARS-CoV-2 viral infection. This manuscript reviews different characteristics of S protein, its potency and 'state of the art' of the vaccine development strategies and platforms using this antigen, for construction of a safe and effective SARS-CoV-2 vaccine.

SARS-CoV-2 re-infection rate in Iranian COVID-19 cases within one-year follow-up.

Since the COVID-19 pandemic initiation, the possibility of re-infection has been unclearly present. Although herd immunity has a potential reliance through natural infection, human corona viruses has the ability to subvert immunity and re-infection happens for seasonal corona viruses. Currently, the frequency of SARS-CoV-2 re-infection incidence is not exactly defined. In this study we aimed at determination of SARS-CoV-2 re-infection rate in Iranian population. In a total of 5696 COVID-19 suspicious individuals, RT-PCR was applied to diagnose the infection. The confirmed patients were followed for 12 months and serology tests were applied to measure the specific antibodies. Among 1492 confirmed COVID-19 cases, five individuals experienced the subsequent infection. The re-infection/reactivation incidence rate was totally 0.33% after one year of follow-up. The interval ranged from 63 to 156 days. All the cases had viral mutations in the second episode of the infection. All of them were symptomatic cases with moderate severity. The estimated rate of SARS-CoV-2 in Persian population is therefore rare and natural infection seems to induce good protection against re-infection which clarifies that mass vaccination can hugely affect the society.

Clinical characteristics of SARS-CoV-2 by re-infection vs. reactivation: a case series from Iran.

COVID-19 immunity in infected individuals may not be persistent. The specific response wanes in patients who have recovered from this infection. Nevertheless, it has not been fully understood whether true re-infection occurs or the viral reactivation. In this study, we investigated three COVID-19 patients who represented the symptoms after recovery. Chest CT scan was applied to assess the patients along with the viral samples from oropharyngeal/nasopharyngeal which were subjected to RT-PCR. The viral genome sequencing was applied where possible to distinguish possible re-infection or latent reactivation. Moreover, COVID-19-specific antibodies available data were evaluated in each incidence. The second episode of SARS-CoV-2 infection was different among the investigated subjects who experienced an interval between positive PCR tests ranged between 63 and 156 days. The disease presentation was less or more severe in the second infection. All cases were found IgG positive in the re-infection phase. The sequencing of SARS-CoV-2 sample obtained from two cases revealed a D614G mutation of S gene from the second isolated sample strengthens the case for the re-infection. The possibility of re-infection and reactivation could have significant effect on clinical implications and also vaccination. Our data supports clear warning of SARS-CoV-2 continuous circulation potency among the populations in spite of herd immunity either with natural infection or vaccination. This issue is critical in term of the patients, clinical investigate, and viral transmission.

Taguchi array optimization of the reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for sensitive and rapid detection of dengue virus serotype 2.

OBJECTIVES: Serotype 2 of dengue virus (DENV-2) is the most prevalent cause of dengue fevers. In this study, the C-prM gene was used for specific detection of DENV-2 by RT-LAMP assay. The RT-LAMP assay was optimized using the Taguchi design of experiments. RESULTS: The efficiency of the assay in such optimal conditions resulted in 100% sensitivity, 100% specificity, and 100% overall accuracy for detection of 4 copies/µL of the genome of DENV-2. In addition, the detection of 2 copies/µL of the genome of DENV-2 was feasible, although the sensitivity was 50%. Considering the importance of the specific detection of the dengue virus serotypes, the cost-effective RT-LAMP approach can be used for rapid, specific, and sensitive detection of DENV-2. CONCLUSION: RT-LAMP, as a cost-effective method, was optimized using Taguchi array approach for specific and rapid detection of DENV-2. Such methods can facilitate the diagnosis procedure in remote regions.

Hantavirus infection in Iranian patients suspected to viral hemorrhagic fever.

BACKGROUND: Hantaviruses are a group of emerging pathogens causing hemorrhagic fever with renal syndrome and Hantavirus cardiopulmonary syndrome in human. This study was conducted to investigate Hantavirus infection among Iranian viral hemorrhagic fever suspected patients. METHODS: From April 2014 to June 2016, 113 cases from 25 different provinces of Iran were analyzed for Hantavirus infection by IgM/IgG ELISA and pan-Hantavirus RT-PCR tests. RESULTS: Although, viral genome was detected in none of the subjects, IgM and IgG antibodies were detected in 19 and 4 cases, respectively. Differentiation of the anti-Hantavirus antibodies according to virus species by EUROLINE Anti-Hantavirus Profile Kit revealed three Puumala virus IgM positive, one Hantaan virus IgM positive, one Hantaan virus IgM borderline, and two Puumala virus IgG borderline cases. CONCLUSIONS: This study demonstrates the circulation of Hantaviruses in Iran and calls for further investigations of these life-threatening viruses in the country.

Imported cases of Chikungunya virus in Iran.

BACKGROUND: Chikungunya virus (CHIKV) is a widespread mosquito-borne virus representing a serious challenge to public health. The largest outbreak in the Middle-East was recorded in 2016-2017 in Pakistan. Sistan and Baluchistan Province of Iran shares a wide border with Pakistan; accordingly, introduction of CHIKV from Pakistan to Iran seems to be probable. The current study is aimed at investigating CHIKV infection in Sistan and Baluchistan Province. METHODS: Between April 2017 and June 2018, a total of 159 serum samples of CHIK suspected cases from 10 cities of Sistan and Baluchistan Province were tested by molecular and serological assays. Samples obtained up to 4 days after onset of illness were tested by real time PCR (n = 8). Samples collected 5-10 days after disease onset were subjected to ELISA, as well as real time PCR tests (n = 72). Samples obtained after the 10th day of disease onset were tested by only ELISA (n = 79). Phylogenetic analysis of real time PCR positive samples was carried out by sequencing of a 1014-bp region of Envelope 1 gene (E1 gene). Chi-square and independent t tests were used to evaluate the association between variables and CHIKV infection. RESULTS: In total, 40 (25.1%) out of 159 samples tested positive either by real time PCR or ELISA tests.Out of 151 samples serologically analyzed, 19 (12.6%) and 28 (18.6%) cases were positive for anti-CHIKV IgM and anti-CHIKV IgG antibodies, respectively. Of 80 samples tested by real time PCR, CHIKV RNA was detected in 11 (13.7%) sera, all of them had recent travel history to Pakistan. Additionally, phylogenetic analysis of 5 samples indicated their similarity with recent isolates of Pakistan outbreak 2016-2017 belonging to Indian Ocean sub-lineage of ECSA genotype. A significant correlation between abroad travel history and CHIKV infection was observed (P < 0.001). The most common clinical symptoms included fever, arthralgia/arthritis, myalgia, headache, and chill. CONCLUSIONS: These results present substantial evidence of CHIKV introduction to Iran from Pakistan and emphasize the need for the enhancement of surveillance system and preventive measures.

Crimean-Congo hemorrhagic fever among children in Iran.

Crimean-Congo hemorrhagic fever (CCHF) is a viral zoonotic disease which is endemic in Iran. The etiological agent of CCHF is an RNA virus belonging to the genus Nairovirus of the family Bunyaviridae. CCHF virus (CCHFV) can be transmitted to humans through bites from infected ticks and direct contact with infected blood or tissues. Although the disease has been observed in different age groups, the rate of disease is lower in children and elderly. This study was designed to characterize CCHFV-infected children in Iran. Between 2000 and 2016, a total of 908 CCHF suspected cases (in children less than 19 years old) were evaluated for CCHFV infection by CCHF IgM ELISA and RT-PCR. CCHFV infection was observed in 161 (17.73%) of subjects. Most CCHF positive children were male (70.8%) and >15 years of age (65.8%). Contact with livestock was the main risk factor (35.4%). Sistan and Baluchestan provinces had the highest frequency within the infected cohort (68.3%). The overall mortality rate was 11.8%. This study also revealed a significant reduction in CCHF-fatality rates in Iranian children when compared to earlier studies in Iran. Having contact with livestock was the major risk factor and CCHF was more common in male children of an older age.

Crimean-Congo Hemorrhagic Fever Virus Clade IV (Asia 1) in Ticks of Western Iran.

Crimean-Congo Hemorrhagic Fever virus (CCHFV) is transmitted through the bite of an infected tick, or by direct contact with CCHFV-infected patients' blood or the products of infected livestock. In 2012, ticks were collected in eight regions of Lorestan Province, Iran. In total, 434 ticks were collected. Reverse transcriptase polymerase chain reaction was used for the detection of CCHFV RNA. Of 434 ticks, 419 (96.6%) ticks were from the family Ixodidae (hard ticks) and 15 (3.5%) ticks were from the family Argasidae (soft ticks). The presence of CCHFV RNA was detected in 29 (6.7%) of 434 ticks. The infected tick species include Hyalomma asiaticum (n = 7, 7.4%), Hyalomma anatolicum (n = 12, 13.2%), Hyalomma marginatum (n = 1, 16.7%), and Rhipicephalus sanguineus (n = 9, 4.3%). These empirical data demonstrated that the majority of CCHFV-positive ticks belonged to the Ixodidae. None of the Argasidae and Haemaphysalis sulcata species was infected with CCHFV. The phylogenetic analyses of the tick-derived CCHFV strains revealed that all 29 viral strains fell in clade IV (Asia 1). The most abundant species of tick collected in this study was R. sanguineus followed by different species of Hyalomma. Given the infection rate among collected ticks, H. marginatum was the most abundant infected tick species (16.7%) followed by H. anatolicum (13.2%), H. asiaticum (7.4%), and R. sanguineus (4.3%).

New circulating genomic variant of Crimean-Congo hemorrhagic fever virus in Iran.

Crimean-Congo hemorrhagic fever is a viral infection that is caused by Crimean-Congo hemorrhagic fever virus (CCHFV). On May 27, 2012, a woman became ill after accidentally splashing cow's blood into her eyes. Serological and molecular investigations were carried out on the serum of the patient. The test results for serological testing were negative, but RT-PCR was strongly positive for CCHFV. A phylogenetic study on the CCHFV genome sequence showed 50 % similarity to a 520-bp region of Russian strains. By combining historical phylogenetic data and current data, it can be surmised that there are potentially more than five circulating CCHFV genomic variants in Iran.

Aptamer-based diagnosis of various SARS-CoV2 strains isolated from clinical specimens.

The emergence of the SARS-CoV-2 virus, an unknown strain of coronavirus, has resulted in severe acute respiratory syndrome with high mortality rates worldwide. Due to the possibility of asymptomatic carriers, late diagnosis of infected individuals can lead to uncontrollable transmission of the disease, making early and accurate detection crucial in controlling the spread of the virus. In this study we identified high-binding-affinity aptamers targeting various strains of the SARS-CoV2 (COVID-19) virus, using the GO-Cell-SELEX (Graphene Oxide- Systematic Evolution of Ligands by Exponential Enrichment) strategy. A total of 96 aptamers were developed through 11 rounds of GO-Cell-SELEX from a random 40 nucleotide single-strand DNA (ssDNA) aptamer library. Using the surface plasmon resonance (SPR) method, the dissociation constant (Kd) values of all aptamers were calculated and two aptamers 52 and 91 with Kd 50 and 61 were selected for enzyme-linked apta-sorbent assay (ELASA). Aptamer 91 could detect various strains of the virus in above 97% of clinical samples obtained from nasopharyngeal swaps (NPS) specimens kept in viral transport media (VTM), confirmed by real-time PCR assay at COVID-19 Reference Diagnostic Laboratory of Iran, Pasture Institute. Aptamer 52 could detect the SARS-CoV2 virus in a competitive lateral flow assay (LFA) to be considered for a future designed kit. These two simple, specific, and sensitive tests can be used in combination for rapid and early diagnosis of various strains of the COVID-19 virus. Our results suggest that these two discovered aptamers present an opportunity for developing a new rapid aptamer-based coronavirus diagnostic kit.

Evaluation of PastoCovac plus vaccine as a booster dose on vaccinated individuals with inactivated COVID-19 vaccine.

COVID-19 pandemic has been managed through global vaccination programs. However, the antibody waning in various types of vaccines came to notice. Hereby, PastoCovac Plus as a protein subunit vaccine was investigated in immunized health care workers by COVAXIN (BBV152). The booster vaccine was recommended at least three months post the second dose of COVAXIN. Sera collection was done before and after each injection. SARS-CoV-2 PCR test was done monthly to detect any asymptomatic and symptomatic vaccine breakthrough. 47.9 and 24.3% of the participants were seronegative for anti-N and anti-S antibodies three months after the second dose of COVAXIN, respectively. On average, fold-rises of 70, 93, 8 and mean-rises of 23.32, 892.4, 5.59 were recorded regarding neutralizing antibody, quantitative and semi-quantitative anti-Spike antibody, respectively. Anti-Spike and neutralizing antibodies seroconversion was seen 59.3% and 45.7%, respectively. The vaccine breakthrough assessment showed that all the isolated samples belonged to SARS-CoV-2 Delta variant. PastoCovac Plus boosting is strongly recommended in combination with inactivated vaccine platforms against SARS-CoV-2.

Efficacy and Safety of a Protein-Based SARS-CoV-2 Vaccine: A Randomized Clinical Trial.

Importance: The protein-based SARS-CoV-2 vaccines FINLAY-FR-2 (Soberana 02) and FINLAY-FR-1A (Soberana Plus) showed good safety and immunogenicity in phase 1 and 2 trials, but the clinical efficacy of the vaccine remains unknown. Objective: To evaluate the efficacy and safety of a 2-dose regimen of FINLAY-FR-2 (cohort 1) and a 3-dose regimen of FINLAY-FR-2 with FINLAY-FR-1A (cohort 2) in Iranian adults. Design, Setting, and Participants: A multicenter, randomized, double-blind, placebo-controlled, phase 3 trial was conducted at 6 cities in cohort 1 and 2 cities in cohort 2. Participants included individuals aged 18 to 80 years without uncontrolled comorbidities, coagulation disorders, pregnancy or breastfeeding, recent immunoglobulin or immunosuppressive therapy, and clinical presentation or laboratory-confirmed COVID-19 on enrollment. The study was conducted from April 26 to September 25, 2021. Interventions: In cohort 1, 2 doses of FINLAY-FR-2 (n = 13 857) or placebo (n = 3462) were administered 28 days apart. In cohort 2, 2 doses of FINLAY-FR-2 plus 1 dose of FINLAY-FR-1A (n = 4340) or 3 placebo doses (n = 1081) were administered 28 days apart. Vaccinations were administered via intramuscular injection. Main Outcomes and Measures: The primary outcome was polymerase chain reaction-confirmed symptomatic COVID-19 infection at least 14 days after vaccination completion. Other outcomes were adverse events and severe COVID-19. Intention-to-treat analysis was performed. Results: In cohort 1 a total 17 319 individuals received 2 doses and in cohort 2 5521 received 3 doses of the vaccine or placebo. Cohort 1 comprised 60.1% men in the vaccine group and 59.1% men in the placebo group; cohort 2 included 59.8% men in the vaccine group and 59.9% in the placebo group. The mean (SD) age was 39.3 (11.9) years in cohort 1 and 39.7 (12.0) years in cohort 2, with no significant difference between the vaccine and placebo groups. The median follow-up time in cohort 1 was 100 (IQR, 96-106) days and, in cohort 2, 142 (137-148) days. In cohort 1, 461 (3.2%) cases of COVID-19 occurred in the vaccine group and 221 (6.1%) in the placebo group (vaccine efficacy: 49.7%; 95% CI, 40.8%-57.3%) vs 75 (1.6%) and 51 (4.3%) in cohort 2 (vaccine efficacy: 64.9%; 95% CI, 49.7%-59.5%). The incidence of serious adverse events was lower than 0.1%, with no vaccine-related deaths. Conclusions and Relevance: In this multicenter, randomized, double-blind, placebo-controlled, phase 3 trial of the efficacy and safety of FINLAY-FR-2 and FINLAY-FR-1A, 2 doses of FINLAY-FR-2 plus the third dose of FINLAY-FR-1A showed acceptable vaccine efficacy against symptomatic COVID-19 as well as COVID-19-related severe infections. Vaccination was generally safe and well tolerated. Therefore, Soberana may have utility as an option for mass vaccination of the population, especially in resource-limited settings, because of its storage condition and affordable price. Trial Registration: isrctn.org Identifier: IRCT20210303050558N1.

SARS-CoV-2 in domestic cats (Felis catus) in the northwest of Iran: Evidence for SARS-CoV-2 circulating between human and cats.

This study aimed to investigate the prevalence of COVID-19 in domestic cats, focusing on the disease in the northwest of Iran and then showing the natural transmission of SARS-COV-2 circulating between domestic cats and humans. After receiving ethic codes from Tehran University of Medical Sciences (IR.TUMS.VCR.REC.1399.303) and confirmed by the Center of Communicable Diseases Control (CDC) of Iran, 124 domestic cats were collected from the homes and only one hospital of Meshkin -Shahr district from northwestern Iran where SARS-CoV-2 patients were hospitalized and quarantined during 2020. Samples were prepared from fluid materials of oropharynx and nasopharynx. All samples were tested by real-time PCR (RT-PCR) using specific genes N and ORF1ab in Pasteur Institute of Iran, and then partial sequence analyses of S gene were performed. All collected cats were kept in separated cages until SARS-COV-2 infection was confirmed with the RT-PCR. RT- PCR Ct values of 123 collected cats were ≥40; thus, all of them showed negative results, but one of the collected cats with close contact with its owner, whom confirmed SARS-CoV-2 showed positive results with gene N(Ct=30) and gene ORF1ab (Ct=32). Furthermore, the positive pet cat showed respiratory and gastro-intestinal clinical manifestations, and its owner was infected with SARS-CoV-2 two weeks ago. Cats are susceptible animals to SARS-CoV-2 infection. Epidemiological evidence showed that SARS-COV-2 is able to transmit to healthy cats due to having close contact with its owner as a reverse zoonosis.

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

SARS-CoV-2 presented moderately during two episodes of the infection with lack of antibody responses.

The world has gone through the critical phase of SARS-CoV-2 crisis caused by the new variants of the virus. The globally concerted effort to characterize viral genomic mutations across different clades has revealed several changes in the coding and also non-coding regions which might lead to a violent presentation or re-infection occurrence. Here, we studied a COVID-19 subject who represented the symptoms following the full recovery of the first infection. COVID-19 specific IgM and IgG were evaluated in both steps. The viral samples from oropharyngeal/nasopharyngeal were subjected to RT-PCR and full sequencing was done in both incidences. The sequencing data was fully investigated with the reference sequence of SARS-CoV-2 and the changes were detected. The obtained data is in favor of re-infection with 128 days of interval. SARS-CoV-2 presented more severely in the second episode of the disease and the specific antibodies against COVID-19 were not detectable. Both infections were caused by the same clade 20G, however, the mutation rates were higher in the second incidence including 10 nucleotide substitutions which had rarely been reported before. In the present study, the nucleotide mutations in various regions of the viral genome have been presented. The re-infection could have significant effect on clinical implications as well as vaccination.

Evidence of Hantavirus circulation among municipal street sweepers, southwest of Iran.

Hantaviruses are rodent-borne zoonosis pathogens that cause hemorrhagic fever with renal syndrome (HFRS) and Hantavirus cardiopulmonary syndrome (HCPS) in humans. Rodents spread the virus via their excretions. The outbreak of Hantaviruses pose a significant public health problem. The epidemiology and history of Hantaviruses in Iran is not clear and regardless of the data from the few available studies, little is known about its epidemiology in this country. Herein, we discuss the prevalence of IgG antibody against Hantavirus serotypes in 385 street sweepers from southwest of Iran. Serum samples were investigated, using Hantavirus Pool 1 "Eurasia" IgG kit and Pool 2 "America" ELISA IgG kit (Euroimmun, Germany) to detect IgG antibodies against Old and New World Hantaviruses. The results showed a specific IgG antibody in two samples (0.5%). Both of seropositive cases had specific IgG antibody against Old World Hantaviruses. The data of the current study along with the previous data, indicate the circulation of Hantaviruses in Iran. Hence, the risk of Hantavirus infection in high-risk groups should be considered as a serious health issue.

Prolonged viral shedding and antibody persistence in patients with COVID-19.

SARS-CoV-2 as a new global threat has affected global population for one year. Despite the great effort to eradicate this infection, there are still some challenges including different viral presentation, temporal immunity in infected individuals and variable data of viral shedding. We studied 255 COVID-19 suspected individuals to assess the viral shedding duration and also the antibody development against SARS-CoV-2 among the cases. Real Time RT-PCR assay was applied to determine the virus presence and SARS-CoV-2 antibodies were evaluated using SARS-CoV-2 IgM and IgG kits. 113 patients were confirmed for COVID-19 infection. The patients were followed until negative PCR achieved. The median viral shedding among studied population was obtained 34.16 (±17.65) days which was not significantly associated with age, sex and underlying diseases. Shiver and body pain were found in prolonged form of the infection and also patients who had gastrointestinal problems experienced longer viral shedding. Moreover, IgG was present in 84% of patients after 150 days. According to this data, the median viral shedding prolongation was 34.16 days which indicates that 14 days isolation might not be enough for population. In addition, IgG profiling indicated that it is persistent in a majority of patients for nearly 6 months which has brought some hopes in vaccine efficacy and application.