Ratiometric Fluorescence Aptasensor of Allergen Protein Based on Multivalent Aptamer-Encoded DNA Flowers as Fluorescence Resonance Energy Transfer Platform.

Life-threatening allergic reactions to food allergens, particularly peanut protein Ara h1, are a growing public health concern affecting millions of people worldwide. Thus, accurate and rapid detection is necessary for allergen labeling and dietary guidance and ultimately preventing allergic incidents. Herein, we present a novel ratiometric fluorescence aptasensor based on multivalent aptamer-encoded DNA flowers (Mul-DNFs) for the high-stability and sensitive detection of allergen Ara h1. The flower-shaped Mul-DNFs were spontaneously packaged using ultralong polymeric DNA amplicons driven by a rolling circle amplification reaction, which contains a large number of Ara h1 specific recognition units and has excellent binding properties. Furthermore, dual-color fluorescence-labeled Mul-DNFs probes were developed by hybridizing them with Cy3- and Cy5-labeled complementary DNA (cDNA) to serve as a ratiometric fluorescence aptasensor platform based on fluorescence resonance energy transfer. Benefiting from the combined merits of the extraordinary synergistic multivalent binding ability of Mul-DNFs, the excellent specificity of the aptamer, and the sensitivity of the ratiometric sensor to avoid exogenous interference. The developed ratiometric aptasensor showed excellent linearity (0.05-2000 ng mL-1) with a limit of detection of 0.02 ng mL-1. Additionally, the developed ratiometric fluorescence aptasensor was utilized for quantifying the presence of Ara h1 in milk, infant milk powder, cookies, bread, and chocolate with recoveries of 95.7-106.3%. The proposed ratiometric aptasensor is expected to be a prospective universal aptasensor platform for the rapid, sensitive, and accurate determination of food and environmental hazards.

Incidence of serum antibodies to xenoantigens on triple-knockout pig cells in different human groups.

BACKGROUND: Xenoantigens other than Gal, Neu5Gc, and Sda may be playing a role in pig graft rejection. We investigated the incidence of antibodies to unknown pig xenoantigen in different human groups. METHODS: We collected blood from TKO/hCD55 pigs (n = 3), and isolated PBMCs and RBCs. Serum samples were collected from (i) healthy human volunteers (n = 43), (ii) patients with end-stage renal disease (ESRD) (n = 87), (iii) the same patients after kidney allotransplantation (n = 50), and (iv) renal allotransplant recipients experiencing T cell-mediated rejection (allo-TCMR, n = 10). The sera were initially incubated with TKO/hCD55 pRBCs (1 × 108 cells) for 1 h to absorb anti-pig antibodies (except against SLA and possibly other antigens not expressed on pRBCs) and then the serum (absorbed or unabsorbed) was tested for antibody binding and complement-dependent cytotoxicity (CDC) to TKO/hCD55 pig PBMCs. RESULTS: A significant reduction in IgM/IgG binding and CDC was observed in the absorbed sera. Serum obtained before and after renal allotransplantation showed no significant difference in IgM or IgG binding to, or in CDC of, TKO/hCD55 pig cells. IgM antibodies (but rarely IgG) against unknown xenoantigens expressed on TKO/hCD55 PBMCs, possibly against swine leukocyte antigens, were documented in healthy humans, patients with ESRD, and those with renal allografts undergoing acute T cell rejection. IgM (but not CDC) was higher in patients experiencing allo-TCMR. CONCLUSION: Human sera contain IgM antibodies against unknown pig xenoantigens expressed on TKO/hCD55 pPBMCs. Although not confirmed in the present study, the targets for these antibodies may include swine leukocyte antigens.

Theoretical study of transition metal-doped ß12 borophene as a new single-atom catalyst for carbon dioxide electroreduction.

The electrocatalytic carbon dioxide reduction reaction (CO2RR) presents a viable and cost-effective approach for the elimination of CO2 by transforming it into valuable products. Nevertheless, this process is impeded by the absence of exceptionally active and stable catalysts. Herein, a new type of electrocatalyst of transition metal (TM)-doped ß12-borophene (TM@ß12-BM) is investigated via density functional theory (DFT) calculations. Through comprehensive screening, two promising single-atom catalysts (SACs), Sc@ß12-BM and Y@ß12-BM, are successfully identified, exhibiting high stability, catalytic activity and selectivity for the CO2RR. The C1 products methane (CH4) and methanol (CH3OH) are synthesized with limiting potentials (UL) of -0.78 V and -0.56 V on Sc@ß12-BM and Y@ß12-BM, respectively. Meanwhile, CO2 is more favourable for reduction into the C2 product ethanol (CH3CH2OH) compared to ethylene (C2H4) via C-C coupling on these two SACs. More importantly, the dynamic barriers of the key C-C coupling step are 0.53 eV and 0.73 eV for the "slow-growth" sampling approach in the explicit water molecule model. Furthermore, Sc@ß12-BM and Y@ß12-BM exhibit higher selectivity for producing C1 compounds (CH4 and CH3OH) than C2 (CH3CH2OH) in the CO2RR. Compared with Sc@ß12-BM, Y@ß12-BM demonstrates superior inhibition of the competitive hydrogen evolution reaction (HER) in the liquid phase. These results not only demonstrate the great potential of SACs for direct reduction of CO2 to C1 and C2, but also help in rationally designing high-performance SACs.

Effectiveness and safety of dermal matrix used for diabetic foot ulcer: a systematic review and meta-analysis of randomized controlled trials.

BACKGROUND: Diabetic foot ulcers (DFUs) have become a global health concern, which can lead to diabetic foot infection (DFI), lower leg amputation, and even mortality. Though the standard of care (SOC) practices have been recognized as the "gold standard" for DFU care, SOC alone may not be adequate to heal all DFUs and prevent their recurrence. The use of dermal matrix has emerged as an adjuvant treatment to enhance DFU healing. The current study aimed to evaluate the effectiveness and safety of dermal matrix application as an adjuvant treatment to the SOC. METHODS: The databases of PubMed, Embase and CENTRAL were independently searched by two authors, with the following key terms: "diabetic foot ulcer", "acellular dermal matrix", "wound healing", and so on. Randomized controlled trials (RCTs) evaluated the efficacy and safety of dermal matrix in the treatment of DFUs were eligible for inclusion. The primary outcomes analyzed included time to complete healing and complete healing rate at the final follow-up, while secondary outcomes included wound area, ulcer recurrence rate, amputation risk and complication risk. Meta-analyses were performed using random-effect or fixed-effect models, based on the heterogeneity test. RESULTS: This study included a total of 15 RCTs with a total of 1524 subjects. Of these, 689 patients were treated with SOC alone, while 835 patients received SOC plus dermal matrix. Compared to the SOC group, significantly shorter time (MD = 2.84, 95%CI: 1.37 ~ 4.32, p < 0.001***) was required to achieve complete healing in dermal matrix group. Significantly higher complete healing rate (OR = 0.40, 95%CI: 0.33 ~ 0.49, p < 0.001***) and lower overall (RR = 1.83, 95%CI: 1.15 ~ 2.93, p = 0.011*) and major (RR = 2.64, 95%CI: 1.30 ~ 5.36, p = 0.007**) amputation risks were achieved in dermal matrix group compared to SOC group. No significant difference was found in the wound area, ulcer recurrence rate, and complication risk between the two groups. CONCLUSIONS: The application of dermal matrix as an adjuvant therapy in conjunction with SOC effectively improved the healing process of DFUs and reduced the amputation risk when compared to SOC alone. Furthermore, dermal matrix application was well tolerated by the subjects with no added complication risk.

Study on the coordinated development of urban competitiveness and energy-carbon emission reduction in China.

The urban competitiveness (UC) evaluation system is multidimensional and complex. This paper takes the simulated annealing (SA) model as the projection pursuit (PP) optimization to achieve a comprehensive assessment of competitiveness of 277 Chinese cities from 2011 to 2019, accompanied by energy saving and carbon-emission reduction (ESCER) as environmental measurements, to explore whether the two can meet the Porter hypothesis through coupling coordination degree (CCD). Further using spatiotemporal autocorrelation and obstacle degree model to uncover spatiotemporal features and interfering factors of coordinated development. Key findings include: (1) UC and ESCER show a slightly fluctuating upward trend during the research period, with apparent spatial variations. The eastern coastal region has a robust UC, while the less competitive central and western regions benefit from natural conditions, excelling in ESCER. (2) 87% of cities have achieved coordinated development between competitiveness and ESCER. Some coastal areas, often with a high CCD, are improving resource use efficiency and environmental benefits through economic agglomeration. From the perspective of the CCD collaboration network, the positive correlation accounts for about 85%, which reveals that most adjacent regions can cooperate on the road of coordinated development. (3) While differences exist in the coordinated development of UC-ESCER across various regions, social factors predominantly influence the obstacles affecting coordinated development. Specifically, a substantial barrier to the concordant progression of most cities is the number of patent applications, underscoring the pivotal role of innovation in aligning UC with ESCER.

A Modified Transversal Two-Suture Microsurgical Intussusception Vasoepididymostomy for the Treatment of Epididymal Obstructive Azoospermia.

INTRODUCTION: We have developed a modified vasoepididymostomy procedure, namely "fenestrated" transversal two-suture microsurgical intussusception vasoepididymostomy. This study aimed to investigate the therapeutic efficacy and outcome of this fenestrated vasoepididymostomy for epididymal obstructive azoospermia (OA). METHODS: Microsurgical two-suture transversal intussusception vasoepididymostomy was performed using our modified fenestration technique in 64 OA patients due to epididymal obstruction at our hospital. Fenestration means making an opening on the epididymal tubule wall. The edges of the epididymal tubule "window" were stitched transversally (two stitches) using the two double-armed 9-0 atraumatic sutures. The epididymal tubule was anastomosed to the lumen of the vas deferens. The patency rate and pregnancy rate were assessed. RESULTS: Of the 64 OA patients, 45 received bilateral microsurgical two-suture transversal intussusception vasoepididymostomy, while 19 underwent unilateral microsurgical two-suture transversal intussusception vasoepididymostomy. All of the patients were followed up after the operation. The follow-up period ranged from 4 to 54 months. Among 45 cases of bilateral surgery, the patency rate was 88.89% (40/45), and the natural pregnancy rate was 28.89% (13/45). After the patency was confirmed postoperatively, 3 cases had recurrent OA, of which 2 cases had return of sperm to the ejaculate by oral antibiotics and scrotal self-massage. As for the 19 cases of unilateral microsurgery, the patency rate was 68.42% (13/19), and the natural pregnancy rate was 21.05% (4/19). CONCLUSION: The fenestrated transversal two-suture microsurgical intussusception vasoepididymostomy can achieve a good patency rate in OA patients and did not increase the difficulty and duration of the procedure.

A dual-core system dynamics approach for carbon emission spillover effects analysis and cross-regional policy simulation.

As carbon emission continue to rise and climate issues grow increasingly severe, countries worldwide have taken measures to reduce carbon emission. However, carbon dioxide is continuously flowing in the atmosphere and is easily influenced by neighboring cities' policies. Therefore, how to solve the problem of carbon emission spillover effect has become the key to improve policy efficiency. Cross-regional carbon governance provides a perspective on solving the carbon emission problem by regulating and guiding the cooperative behavior of cross-regional governance actors. Taking Chengdu-Chongqing area as an example, this study used the SDM to analyze the influencing factors and spatial spillover effects of emission. Then we used the system dynamics method to construct a dual-core carbon emission system, and simulated the spillover effect and emission reduction potential of Chengdu and Chongqing emission reduction policies under different policy schemes. The results reveal that the mobility of population and enterprises have a significant impact on carbon emission prediction. Carbon reduction policies exhibit the phenomena of "carbon transfer" and "free-riding." When Chengdu lowers its economic growth rate, it leads to the transfer of high energy-consuming enterprises to Chongqing, increasing carbon emission in Chongqing. The implementation of comprehensive carbon reduction policies in Chongqing has a positive effect on Chengdu. Emission reduction policies exhibit issues related to their temporal efficacy, as the effects of industrial structural policies in Chengdu yield opposite outcomes in the short and long term. Each city's unique circumstances necessitate tailored carbon reduction policies. In order to reduce carbon emissions, Chengdu and Chongqing require opposite population policies.

An insight to rhizosphere bacterial community composition and structure of consecutive winter-initiated sugarcane ratoon crop in Southern China.

BACKGROUND: Ratooning in sugarcane is a crucial strategy for ensuring the long-term sustainability of the sugarcane industry. Knowledge gap relating to the interaction between rhizosphere microbiome and ratooning crop, particularly the impact of different sugarcane cultivars on the rhizosphere microbiome in consecutive ratooning, requires additional research. The response of two different sugarcane cultivars, viz ZZ-1 and ZZ-13, were evaluated in consecutive ratooning towards the rhizosphere microbial community and cane morphological characters. RESULTS: Significant changes in the rhizosphere microbiome were observed in the second ratooning over the years. Several important genera were observed in high abundance during the second ratooning, including Burkholderia, Sphingomonas, Bradyzhizobium, and Acidothermus. Cultivar ZZ-13 caused more alterations in the rhizosphere microbiome than ZZ-1, resulting in a more favorable rhizosphere environment for sugarcane growth. The genotypes also varied in terms of nutrients and enzyme activity over the years. There were significant differences between the genotypes and year for number of stalks and yield was significant for genotypes, years and genotype × year. CONCLUSION: This finding will help to understand thorough interactions between rhizosphere microorganisms and ratoon sugarcane and lay the foundation for promoting and maximizing yield as far as possible. In the future, this work can serve as guidance in sugarcane husbandry, mainly in Guangxi, China.

Feasibility of contrast-enhanced ultrasound and flank position during percutaneous nephrolithotomy in patients with no apparent hydronephrosis: a randomized controlled trial.

PURPOSE: To investigate the puncture accuracy and feasibility of contrast-enhanced ultrasound (CEUS) guided percutaneous nephrolithotomy (PCNL) in flank position for patients with no apparent hydronephrosis. METHODS: Between May 2018 and June 2020, 72 kidney stone patients with no or mild hydronephrosis were randomized into two groups: a CEUS-guided PCNL group and a conventional ultrasound (US)-guided group. Patients' demographics and perioperative outcomes were compared, including the success rate of puncture via calyceal fornix, the success rate of a single-needle puncture, puncture time, operative time, postoperative hemoglobin loss, stone-free rate, incidence of complications and postoperative stay. RESULTS: The success rate of puncture via calyceal fornix for CEUS-guided group was significantly higher than that for conventional US-guided group (86.1 vs. 47.2%, p = 0.002). Patients performed with CEUS-guided PCNL required shorter renal puncture time than those guided with conventional US (36.5 s vs. 61.0 s, p < 0.001). The median postoperative hemoglobin loss in the CEUS-guided group was significantly lower than that in conventional US-guided group (2.5 vs. 14.5 g/L, p < 0.01). There was no statistically significant difference in the success rate of a single-needle puncture, operative time, stone-free rate, incidence of complications and postoperative stay between the two groups. CONCLUSION: CEUS guidance facilitates identification of the renal calyx fornix, and benefits more precise renal puncture and less hemoglobin loss in PCNL. CEUS-guided PCNL in flank position is a feasible approach to the treatment of kidney stone patients with no apparent hydronephrosis. TRIAL REGISTRATION NUMBER: ChiCTR1800015417.

Clinical outcomes and safety of osimertinib plus anlotinib for patients with previously treated EGFR T790M-positive NSCLC: A retrospective study.

WHAT IS KNOWN AND OBJECTIVE: Although osimertinib achieved convincing efficacy for patients with EGFR T790M-positive non-small-cell lung cancer (NSCLC) as second-line treatment in the AURA3 clinical trials, patients developed drug resistance ultimately. Therefore, the present study was to investigate the clinical outcome and safety of osimertinib plus anlotinib for patients with previously treated EGFR T790M-positive NSCLC. METHODS: Designed as a retrospective study, this study consecutively included a total of 33 patients with advanced NSCLC who possessed a EGFR T790M-positive mutation and progressed after the first-line therapy. Eligible patients were treated with osimertinib plus anlotinib. Baseline characteristics of the patients were collected during hospitalization. Efficacy of the combination regimen was assessed with the change of target lesion using imaging evidence according to RECIST 1.1 criteria, and all the patients were followed up regularly. Adverse reactions were collected and documented during the treatment. Univariate analysis according to baseline characteristic subgroups was performed using log-rank test, and multivariate analysis was carried out by Cox regression analysis. RESULTS AND DISCUSSION: The best overall response of the patients during osimertinib and anlotinib combination indicated that complete response was found in one patient, partial response was observed in 26 patients, stable disease was noted in 5 patients and progressive disease was reported in one patient. Therefore, objective response rate (ORR) of the combination regimen was 81.8% (95%CI: 64.5%-93.0%), and disease control rate (DCR) was 97.0% (95%CI: 84.2%-99.9%). Furthermore, the median progression-free survival (PFS) of the 33 patients with NSCLC was 15.5 months (95%CI: 6.19-24.81). In addition, the median overall survival (OS) of the 33 patients with NSCLC was 23.8 months (95% CI: 17.67-29.93). Safety profile suggested that the most common adverse reactions of the patients with NSCLC who received anlotinib plus osimertinib were hypertension (63.6%), fatigue (57.6%), diarrhoea (48.5%%), dermal toxicity (39.4%) and proteinuria (33.3%). Interestingly, multivariate Cox regression analysis for PFS demonstrated that ECOG performance status was an independent factor to predict the PFS of the combination regimen. WHAT IS NEW AND CONCLUSION: Osimertinib plus anlotinib regimen preliminarily exhibited encouraging clinical outcomes and acceptable safety profile for patients with previously treated EGFR T790M-positive NSCLC numerically. This conclusion should be validated in prospective clinical trials.

The miR-155-5p inhibits osteoclast differentiation through targeting CXCR2 in orthodontic root resorption.

BACKGROUND AND OBJECTIVE: Root resorption is an unavoidable side effect of orthodontic tooth movement. The mechanism of root resorption is similar to bone resorption; the odontoclasts share similar characteristics with osteoclasts (OCs). MicroRNAs (miRNAs) such as miR-155-5p play an important role in OC differentiation, but the underlying molecular mechanism of miR-155-5p in this process is not fully understood. We found that the miR-155-5p seed sequences were complementary to a sequence conserved in the 3-untranslated region of CXCR2 mRNA. In this study, we explored the molecular mechanism underlying the effect of miR-155-5p on OC differentiation by targeting CXCR2. MATERIALS AND METHODS: In this study, we divided the orthodontic patients into mild, moderate, and severe groups according to the severity of root resorption. The gingival crevicular fluid (GCF) of patients in different groups was collected, and the expression levels of dentin phosphoprotein (DPP) were detected by ELISA, and the expression levels of CXCR2 and miR-155-5p in GCF were detected by real-time quantitative PCR (qRT-PCR). The relationship between miR-155-5p and CXCR2 was verified by double luciferase. We analyzed changes of CXCR2 and miR-155-5p expression after transfection of miR-155-5p mimic and inhibitor into RAW264.7 cells induced by receptor activator of nuclear factor-κB ligand (RANKL) through qRT-PCR and western blotting. The effect of miR-155-5p on OC differentiation was evaluated by tartrate-resistant acid phosphatase (TRAP) staining. QRT-PCR and western blotting were used to analyze expression of the osteoclastic bone resorption-related enzymes carbonic anhydrase 2 (CA II), matrix metalloproteinase-9 (MMP-9), and cathepsin K. To further confirm the direct targeting effect of CXCR2 by miR-155-5p, we blocked CXCR2 using si-CXCR2 in RANKL-induced RAW264.7 cells. RESULTS: Dentin phosphoprotein levels were consistent with the trend of miR-155-5p changes, and the trend of CXCR2 expression was opposite to miR-155-5p changes. miR-155-5p can be directly targeted to act on CXCR2. The expression of miR-155-5p was significantly downregulated in differentiated OCs. MiR-155-5p inhibited OC differentiation, and downregulated CA II, MMP-9, and cathepsin K expression at the protein and mRNA levels. CONCLUSIONS: In summary, the results of this study suggested that miR-155-5p inhibited OC differentiation by targeting CXCR2, thus reducing root resorption in orthodontics. MiR-155-5p can be used as an effective target for avoiding or reducing the degree of root resorption in orthodontic treatment.

Extracellular histones and xenotransplantation.

Xenotransplantation may be an alternative source of organs for patients with end-stage organ failure, but problems remain to be overcome. Five factors that are problematic are (a) a sustained systemic inflammatory response in the xenograft recipient, (b) thrombotic microangiopathy and disseminated intravascular coagulation, (c) ischemia-reperfusion injury, (d) complement activation, and (e) vascular endothelial cell injury. In xenotransplantation, histones, which are positively charged proteins, are released into the extracellular space from damaged and activated cells, cause cell and tissue damage, and act as danger/damage-associated molecular patterns (DAMPs) that mediate inflammation, coagulation disorders, an immune response, and cytotoxicity. We have previously demonstrated that serum histones increase after pig-to-baboon organ transplantation and infection. Treatment of the recipient with tocilizumab (interleukin-6 receptor blockade) reduces the level of serum histones and C-reactive protein. In this review, the potential role of extracellular histones in xenotransplantation is discussed, and we briefly summarize the relationship between extracellular histones and the inflammatory response, coagulation dysfunction, ischemia-reperfusion injury, the complement system, and vascular endothelial cell injury.

Differential m6A methylomes between two major life stages allows potential regulations in Trypanosoma brucei.

N6-methyladenosine (m6A) is the most prevalent mRNA modification in higher eukaryotes. Recent studies suggest that m6A has a regulatory role in mRNA degradation and translation initiation or efficiency, involving in cell fate determination in yeast, plants, and stem cells of mammalian. Trypanosoma brucei (T. brucei) regulates gene expression through post-transcriptional fashion, which heavily relies on mRNA cis-motifs. However, internal mRNA modification in T. brucei has not been reported yet. Here we found m6A modification is abundant in T. brucei and presented a transcriptome wide methylome of m6A in both life stages of T. brucei. We identified 355 and 95 peaks in procyclic form and blood stream form trypanosomes respectively. A consensus motif of CAU was shared in both life stages of T. brucei. mRNA abundance of m6A-containing genes is higher in procyclic form and tend to be down-regulated in bloodstream form trypanosomes. Furthermore, m6A-containing transcripts harbor relative longer half-lives, and are enriched in pathways of cell morphology and movement in procyclic form trypanosomes. By m6A-containing RNA pulldown in both life stages, we identified TRRM2 as a potential m6A reader in T. brucei. Uncovering the m6A methylome and its binding proteins may provide a new post-transcriptional regulatory pathway in T. brucei.

The lncRNA DLX6-AS1 promoted cell proliferation, invasion, migration and epithelial-to-mesenchymal transition in bladder cancer via modulating Wnt/ß-catenin signaling pathway.

BACKGROUND: Bladder cancer is the most common human urological malignancies with poor prognosis, and the pathophysiology of bladder cancer involves multi-linkages of regulatory networks in the bladder cancer cells. Recently, the long noncoding RNAs (lncRNAs) have been extensively studied for their role on bladder cancer progression. In this study, we evaluated the expression of DLX6 Antisense RNA 1 (DLX6-AS1) in the cancerous bladder tissues and studied the possible mechanisms of DLX6-AS1 in regulating bladder cancer progression. METHODS: Gene expression was determined by qRT-PCR; protein expression levels were evaluated by western blot assay; in vitro functional assays were used to determine cell proliferation, invasion and migration; nude mice were used to establish the tumor xenograft model. RESULTS: Our results showed the up-regulation of DLX6-AS1 in cancerous bladder cancer tissues and bladder cell lines, and high expression of DLX6-AS1 was correlated with advance TNM stage, lymphatic node metastasis and distant metastasis. The in vitro experimental data showed that DLX6-AS1 overexpression promoted bladder cancer cell growth, proliferation, invasion, migration and epithelial-to-mesenchymal transition (EMT); while DLX6-AS1 inhibition exerted tumor suppressive actions on bladder cancer cells. Further results showed that DLX6-AS1 overexpression increased the activity of Wnt/ß-catenin signaling, and the oncogenic role of DLX6-AS1 in bladder cancer cells was abolished by the presence of XAV939. On the other hand, DLX6-AS1 knockdown suppressed the activity of Wnt/ß-catenin signaling, and the tumor-suppressive effects of DLX6-AS1 knockdown partially attenuated by lithium chloride and SB-216763 pretreatment. The in vivo tumor growth study showed that DLX6-AS1 knockdown suppressed tumor growth of T24 cells and suppressed EMT and Wnt/ß-catenin signaling in the tumor tissues. CONCLUSION: Collectively, the present study for the first time identified the up-regulation of DLX6-AS1 in clinical bladder cancer tissues and in bladder cancer cell lines. The results from in vitro and in vivo assays implied that DLX6-AS1 exerted enhanced effects on bladder cancer cell proliferation, invasion and migration partly via modulating EMT and the activity of Wnt/ß-catenin signaling pathway.

Salinomycin triggers endoplasmic reticulum stress through ATP2A3 upregulation in PC-3 cells.

BACKGROUND: Salinomycin is a monocarboxylic polyether antibiotic and is a potential chemotherapy drug. Our previous studies showed that salinomycin inhibited cell growth and targeted CSCs in prostate cancer. However, the precise target of salinomycin action is unclear. METHODS: In this work, we analyzed and identified differentially expressed genes (DEGs) after treatment with or without salinomycin using a gene expression microarray in vitro (PC-3 cells) and in vivo (NOD/SCID mice xenograft model generated from implanted PC-3 cells). Western blotting and immunohistochemical staining were used to analyze the expression of ATP2A3 and endoplasmic reticulum (ER) stress biomarkers. Flow cytometry was used to analyze the cell cycle, apoptosis and intracellular Ca2+ concentration. RESULTS: A significantly upregulated gene, ATPase sarcoplasmatic/endoplasmatic reticulum Ca2+ transporting 3 (ATP2A3), was successfully identified. In subsequent studies, we found that ATP2A3 overexpression could trigger ER stress and exert anti-cancer effects in PC-3 and DU145 cells. ATP2A3 was slightly expressed, but the ER stress biomarkers showed strong staining in prostate cancer tissues. We also found that salinomycin could trigger ER stress, which might be related to ATP2A3-mediated Ca2+ release in PC-3 cells. Furthermore, we found that salinomycin-triggered ER stress could promote apoptosis and thus exert anti-cancer effects in prostate cancer cells. CONCLUSION: This study demonstrates that ATP2A3 might be one of the potential targets for salinomycin, which can inhibit Ca2+ release and trigger ER stress to exert anti-cancer effects.

The Effect of SiO2 Particle Size on Crystallization Behavior and Space Charge Properties for SiO2/MMT/LDPE Composites.

The matrix material used in this paper was low-density polyethene (LDPE), and the added particles selected were silicon oxide (SiO2) particles and montmorillonite (MMT) particles. The sizes of the SiO2 particles were 1 µm, 30 nm, and 100 nm, respectively; three kinds of SiO2/MMT/LDPE multi-component composites were prepared based on MMT/LDPE composites doped with MMT particles. The effect of the SiO2 particle size on the crystallization behavior and space charge properties of SiO2/MMT/LDPE composites was studied. The crystalline behaviors and crystallinity of the materials were analyzed. At the same time, the changes in the relative dielectric constant εr and loss factor tanδ for each material with the influence of frequency were studied, and the space charge accumulation, residual characteristics, and apparent charge mobility of each material were explored. The results show that the smaller the size of the added particles, the smaller the grain size and the clearer the grain outline for the multi-composite material. After adding 30 nm SiO2 particles, the crystallinity of the material increases significantly. The microstructure formed by the addition of 100 nm SiO2 particles effectively restricts molecular chain movement and makes it difficult to establish the polarization of the composite. The incorporation of large-size particles can reduce the proportion of the crystalline structure for the material as a whole, resulting in the formation of a new structure to promote charge transfer. Among the three kinds of SiO2 particles, the addition of 30 nm SiO2 particles can effectively suppress the space charge, and the composite material has the lowest residual space charge after depolarization. The addition of 100 nm SiO2 particles can cause the accumulation of many homopolar charges near the anode.

[Effectiveness of transverse double "8"-shaped tension band technique for Lawrence zone â fracture of the fifth metatarsal base].

Objective: To explore the effectiveness of transverse double "8"-shaped tension band technique in the treatment of Lawrence zoneⅠfracture of the 5th metatarsal base. Methods: Between February 2019 and October 2021, 15 patients with Lawrence zoneⅠfracture of the 5th metatarsal base were treated with transverse double "8"-shaped tension band technique. There were 8 males and 7 females, with a median age of 40 years (range, 23-59 years). The fractures were caused by sprains. The time from injury to operation was 3-7 days (mean, 4.1 days). X-ray films were taken to observe the fracture healing and the anchor looseness and detachment. The foot function was evaluated by American Orthopaedic Foot and Ankle Society (AOFAS) score, visual analogue scale (VAS) score, and the eversion angle of the calcaneal talus joint. Results: The incisions healed by first intention after operation in 14 cases and the incision healed poorly in 1 case. All patients were followed up 8-12 months (median, 10 months). The imaging examination showed that all fractures healed well, with a healing time of 10-14 weeks (mean, 11.7 weeks). At last follow-up, AOFAS score was 82-100 (median, 98); 13 cases were excellent and 2 cases were good, with an excellent and good rate of 100%. VAS score was 0-3 (median, 1). Three cases had mild limited ankle joint range of motion, while 12 cases had normal range of motion. The eversion angle of the calcaneal talus joint was 25°-32° (median, 30°). Conclusion: The application of transverse double "8"-shaped tension band technique for Lawrence zone Ⅰ fracture of the 5th metatarsal base has advantages such as simple operation, avoidance of secondary operation, and reduction of foreign body sensation, with definite effectiveness.

Implication of PD­L1 polymorphisms rs2297136 on clinical outcomes of patients with advanced NSCLC who received PD­1 blockades: A retrospective exploratory study.

Clinically, programmed death-1 (PD-1) blockades have demonstrated promising therapeutic outcomes for patients with advanced non-small cell lung cancer (NSCLC). The present study aimed to examine the impact of programmed death-ligand 1 (PD-L1) polymorphism on clinical outcomes of patients with advanced NSCLC who were treated with PD-1 blockades therapy. The present study was designed as a retrospective analysis, where a consecutive screening of 89 patients with advanced NSCLC who received PD-1 blockades monotherapy were screened. Biological specimens were collected to determine the presence of polymorphism and PD-L1 mRNA expression through genotyping. The analysis focused on examining the relationship between the genotype status of PD-L1 polymorphism and clinical outcomes. Among the 89 patients with advanced NSCLC, the use of PD-1 blockades monotherapy resulted in objective response rate (ORR) of 22.5%, a median progression-free survival (PFS) of 3.4 months [95% Confidence Interval (CI): 1.80-5.00) and a median overall survival (OS) of 11.3 months (95% CI: 7.93-14.67). The analysis of polymorphism indicated that only rs2297136 had clinical significance. Among the 89 patients with NSCLC, the prevalence of rs2297136 was as follows: A total of 58 cases (65.2%) had the AA genotype, 28 cases (31.5%) had the AG genotype and 3 cases (3.4%) had the GG genotype. This resulted in a minor allele frequency of 0.19, which was in consistent with Hardy-Weinberg Equilibrium (P=0.865). The correlation analysis between genotype status of rs2297136 and clinical outcomes indicated that patients with the AA genotype had an ORR of 19.0%, while those with the AG/GG genotype had an ORR of 29.0% (P=0.278). Additionally, the median PFS for the AA genotype was 2.95 months, compared with 5.30 months for the AG/GG genotype (P=0.038). Accordingly, median OS of the AA and AG/GG genotypes was 8.8 and 18.4 months, respectively (P=0.011). The mRNA expression of PD-L1 was significantly higher in patients with AG/GG genotype compared with those with AA genotype (P<0.001). In clinical practice, PD-1 blockades demonstrated promising effectiveness in treating patients with advanced NSCLC. The presence of the rs2297136 variant in PD-L1 gene could potentially be used as a biomarker to predict the clinical outcomes of PD-1 blockades.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

[Neutral alpha-glucosidase activity is correlated with the location of epididymal obstruction in azoospermia men].

OBJECTIVE: To evaluate the correlation of neutral alpha-glucosidase in seminal plasma with the location of epididymal obstruction in azoospermia men. METHODS: We detected neutral alpha-glucosidase activity in the seminal plasma of 59 men with obstructive azoospermia followed by determining the location of epididymal obstruction by scrotal exploratory surgery. Then we analyzed the correlation between neutral alpha-glucosidase and the location of epididymal obstructive azoospermia. RESULTS: Among the total number of patients, there were 25 cases of bilateral cauda epididymal obstruction, 15 bilateral corpus, 12 bilateral caput, 4 unilateral caput-opposite cauda, and 3 unilateral corpus-opposite cauda. The neutral alpha-glucosidase levels in the seminal plasma of bilateral cauda, corpus and capus epididymal obstructions were (4.1 +/- 1.9), (13.8 +/- 4.4) and (46.8 +/- 19.3) mU per ejaculate, respectively, with statistically significant differences among the three groups (P < 0.05). CONCLUSION: Neutral alpha-glucosidase activity is significantly correlated with the location of epididymal obstruction in azoospermia men, which helps to locate epididymal obstruction, evaluate surgical prognosis and reduce the time of scrotal exploratory surgery.