Strategies for Development of a Next-Generation Protein Sequencing Platform.

Proteomic analysis can be a critical bottleneck in cellular characterization. The current paradigm relies primarily on mass spectrometry of peptides and affinity reagents (i.e., antibodies), both of which require a priori knowledge of the sample. An unbiased protein sequencing method, with a dynamic range that covers the full range of protein concentrations in proteomes, would revolutionize the field of proteomics, allowing a more facile characterization of novel gene products and subcellular complexes. To this end, several new platforms based on single-molecule protein-sequencing approaches have been proposed. This review summarizes four of these approaches, highlighting advantages, limitations, and challenges for each method towards advancing as a core technology for next-generation protein sequencing.

The emerging landscape of single-molecule protein sequencing technologies.

Single-cell profiling methods have had a profound impact on the understanding of cellular heterogeneity. While genomes and transcriptomes can be explored at the single-cell level, single-cell profiling of proteomes is not yet established. Here we describe new single-molecule protein sequencing and identification technologies alongside innovations in mass spectrometry that will eventually enable broad sequence coverage in single-cell profiling. These technologies will in turn facilitate biological discovery and open new avenues for ultrasensitive disease diagnostics.

An important consideration when expressing mAbs in Escherichiacoli.

Monoclonal antibodies (mAbs) are a driving force in the biopharmaceutical industry. Therapeutic mAbs are usually produced in mammalian cells, but there has been a push towards the use of alternative production hosts, such as Escherichia coli. When the genes encoding for a mAb heavy and light chains are codon-optimized for E. coli expression, a truncated form of the heavy chain can form along with the full-length product. In this work, the role of codon optimization in the formation of a truncated product was investigated. This study used the amino acid sequences of several therapeutic mAbs and multiple optimization algorithms. It was found that several algorithms incorporate sequences that lead to a truncated product. Approaches to avoid this truncated form are discussed.

Archaeal DNA replication.

DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed.

Creation and filtering of a recurrent spectral library of CHO cell metabolites and media components.

This paper reports the first implementation of a new type of mass spectral library for the analysis of Chinese hamster ovary (CHO) cell metabolites that allows users to quickly identify most compounds in any complex metabolite sample. We also describe an annotation methodology developed to filter out artifacts and low-quality spectra from recurrent unidentified spectra of metabolites. CHO cells are commonly used to produce biological therapeutics. Metabolic profiles of CHO cells and media can be used to monitor process variability and look for markers that discriminate between batches of product. We have created a comprehensive library of both identified and unidentified metabolites derived from CHO cells that can be used in conjunction with tandem mass spectrometry to identify metabolites. In addition, we present a workflow that can be used for assigning confidence to a NIST MS/MS Library search match based on prior probability of general utility. The goal of our work is to annotate and identify (when possible), all liquid chromatography-mass spectrometry generated metabolite ions as well as create automatable library building and identification pipelines for use by others in the field.

Unwinding 20 Years of the Archaeal Minichromosome Maintenance Helicase.

Replicative DNA helicases are essential cellular enzymes that unwind duplex DNA in front of the replication fork during chromosomal DNA replication. Replicative helicases were discovered, beginning in the 1970s, in bacteria, bacteriophages, viruses, and eukarya, and, in the mid-1990s, in archaea. This year marks the 20th anniversary of the first report on the archaeal replicative helicase, the minichromosome maintenance (MCM) protein. This minireview summarizes 2 decades of work on the archaeal MCM.

Characterization of the internal translation initiation region in monoclonal antibodies expressed in Escherichia coli.

Monoclonal antibodies (mAbs) represent an important platform for the development of biotherapeutic products. Most mAbs are produced in mammalian cells, but several mAbs are made in Escherichia coli, including therapeutic fragments. The NISTmAb is a well-characterized reference material made widely available to facilitate the development of both originator biologics and biosimilars. Here, when expressing NISTmAb from codon-optimized constructs in E. coli (eNISTmAb), a truncated variant of its heavy chain was observed. N-terminal protein sequencing and mutagenesis analyses indicated that the truncation resulted from an internal translation initiation from a GTG codon (encoding Val) within eNISTmAb. Using computational and biochemical approaches, we demonstrate that this translation initiates from a weak Shine-Dalgarno sequence and is facilitated by a putative ribosomal protein S1-binding site. We also observed similar internal initiation in the mAb adalimumab (the amino acid sequence of the drug Humira) when expressed in E. coli Of note, these internal initiation regions were likely an unintended result of the codon optimization for E. coli expression, and the amino acid pattern from which it is derived was identified as a Pro-Ser-X-X-X-Val motif. We discuss the implications of our findings for E. coli protein expression and codon optimization and outline possible strategies for reducing the likelihood of internal translation initiation and truncated product formation.

Leveraging nature's biomolecular designs in next-generation protein sequencing reagent development.

Next-generation approaches for protein sequencing are now emerging that could have the potential to revolutionize the field in proteomics. One such sequencing method involves fluorescence-based imaging of immobilized peptides in which the N-terminal amino acid of a polypeptide is readout sequentially by a series of fluorescently labeled biomolecules. When selectively bound to a specific N-terminal amino acid, the NAAB (N-terminal amino acid binder) affinity reagent identifies the amino acid through its associated fluorescence tag. A key technical challenge in implementing this fluoro-sequencing approach is the need to develop NAAB affinity reagents with the high affinity and selectivity for specific N-terminal amino acids required for this biotechnology application. One approach to develop such a NAAB affinity reagent is to leverage naturally occurring biomolecules that bind amino acids and/or peptides. Here, we describe several candidate biomolecules that could be considered for this purpose and discuss the potential for developability of each. Key points • Next-generation sequencing methods are emerging that could revolutionize proteomics. • Sequential readout of N-terminal amino acids by fluorescent-tagged affinity reagents. • Native peptide/amino acid binders can be engineered into affinity reagents. • Protein size and structure contribute to feasibility of reagent developability.

Engineering ClpS for selective and enhanced N-terminal amino acid binding.

One of the central challenges in the development of single-molecule protein sequencing technologies is achieving high-fidelity sequential recognition and detection of specific amino acids that comprise the peptide sequence. An approach towards achieving this goal is to leverage naturally occurring proteins that function through recognition of amino (N)-terminal amino acids (NAAs). One such protein, the N-end rule pathway adaptor protein ClpS, natively recognizes NAAs on a peptide chain. The native ClpS protein has a high specificity albeit modest affinity for the amino acid Phe at the N-terminus but also recognizes the residues Trp, Tyr, and Leu at the N-terminal position. Here, we employed directed evolution methods to select for ClpS variants with enhanced affinity and selectivity for two NAAs (Phe and Trp). Using this approach, we identified two promising variants of the Agrobacterium tumefaciens ClpS protein with native residues 34-36 ProArgGlu mutated to ProMetSer and CysProSer. In vitro surface binding assays indicate that the ProMetSer variant has enhanced affinity for Phe at the N-terminus with sevenfold tighter binding relative to wild-type ClpS, and that the CysProSer variant binds selectively to Trp over Phe at the N-terminus while having a greater affinity for both Trp and Phe. Taken together, this work demonstrates the utility of engineering ClpS to make it more effective for potential use in peptide sequencing applications.

High-temperature single-molecule kinetic analysis of thermophilic archaeal MCM helicases.

The minichromosome maintenance (MCM) complex is the replicative helicase responsible for unwinding DNA during archaeal and eukaryal genome replication. To mimic long helicase events in the cell, a high-temperature single-molecule assay was designed to quantitatively measure long-range DNA unwinding of individual DNA helicases from the archaeons Methanothermobacter thermautotrophicus (Mth) and Thermococcus sp. 9°N (9°N). Mth encodes a single MCM homolog while 9°N encodes three helicases. 9°N MCM3, the proposed replicative helicase, unwinds DNA at a faster rate compared to 9°N MCM2 and to Mth MCM. However, all three MCM proteins have similar processivities. The implications of these observations for DNA replication in archaea and the differences and similarities among helicases from different microorganisms are discussed. Development of the high-temperature single-molecule assay establishes a system to comprehensively study thermophilic replisomes and evolutionary links between archaeal, eukaryal, and bacterial replication systems.

A small protein inhibits proliferating cell nuclear antigen by breaking the DNA clamp.

Proliferating cell nuclear antigen (PCNA) forms a trimeric ring that encircles duplex DNA and acts as an anchor for a number of proteins involved in DNA metabolic processes. PCNA has two structurally similar domains (I and II) linked by a long loop (inter-domain connector loop, IDCL) on the outside of each monomer of the trimeric structure that makes up the DNA clamp. All proteins that bind to PCNA do so via a PCNA-interacting peptide (PIP) motif that binds near the IDCL. A small protein, called TIP, binds to PCNA and inhibits PCNA-dependent activities although it does not contain a canonical PIP motif. The X-ray crystal structure of TIP bound to PCNA reveals that TIP binds to the canonical PIP interaction site, but also extends beyond it through a helix that relocates the IDCL. TIP alters the relationship between domains I and II within the PCNA monomer such that the trimeric ring structure is broken, while the individual domains largely retain their native structure. Small angle X-ray scattering (SAXS) confirms the disruption of the PCNA trimer upon addition of the TIP protein in solution and together with the X-ray crystal data, provides a structural basis for the mechanism of PCNA inhibition by TIP.

The GAN Exonuclease or the Flap Endonuclease Fen1 and RNase HII Are Necessary for Viability of Thermococcus kodakarensis.

Many aspects of and factors required for DNA replication are conserved across all three domains of life, but there are some significant differences surrounding lagging-strand synthesis. In Archaea, a 5'-to-3' exonuclease, related to both bacterial RecJ and eukaryotic Cdc45, that associates with the replisome specifically through interactions with GINS was identified and designated GAN (for GINS-associated nuclease). Despite the presence of a well-characterized flap endonuclease (Fen1), it was hypothesized that GAN might participate in primer removal during Okazaki fragment maturation, and as a Cdc45 homologue, GAN might also be a structural component of an archaeal CMG (Cdc45, MCM, and GINS) replication complex. We demonstrate here that, individually, either Fen1 or GAN can be deleted, with no discernible effects on viability and growth. However, deletion of both Fen1 and GAN was not possible, consistent with both enzymes catalyzing the same step in primer removal from Okazaki fragments in vivo RNase HII has also been proposed to participate in primer processing during Okazaki fragment maturation. Strains with both Fen1 and RNase HII deleted grew well. GAN activity is therefore sufficient for viability in the absence of both RNase HII and Fen1, but it was not possible to construct a strain with both RNase HII and GAN deleted. Fen1 alone is therefore insufficient for viability in the absence of both RNase HII and GAN. The ability to delete GAN demonstrates that GAN is not required for the activation or stability of the archaeal MCM replicative helicase.IMPORTANCE The mechanisms used to remove primer sequences from Okazaki fragments during lagging-strand DNA replication differ in the biological domains. Bacteria use the exonuclease activity of DNA polymerase I, whereas eukaryotes and archaea encode a flap endonuclease (Fen1) that cleaves displaced primer sequences. RNase HII and the GINS-associated exonuclease GAN have also been hypothesized to assist in primer removal in Archaea Here we demonstrate that in Thermococcus kodakarensis, either Fen1 or GAN activity is sufficient for viability. Furthermore, GAN can support growth in the absence of both Fen1 and RNase HII, but Fen1 and RNase HII are required for viability in the absence of GAN.

The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed.

A novel mechanism for regulating the activity of proliferating cell nuclear antigen by a small protein.

Proliferating cell nuclear antigen (PCNA) forms a trimeric ring that associates with and influences the activity of many proteins participating in DNA metabolic processes and cell cycle progression. Previously, an uncharacterized small protein, encoded by TK0808 in the archaeon Thermococcus kodakarensis, was shown to stably interact with PCNA in vivo. Here, we show that this protein, designated Thermococcales inhibitor of PCNA (TIP), binds to PCNA in vitro and inhibits PCNA-dependent activities likely by preventing PCNA trimerization. Using hydrogen/deuterium exchange mass spectrometry and site-directed mutagenesis, the interacting regions of PCNA and TIP were identified. Most proteins bind to PCNA via a PCNA-interacting peptide (PIP) motif that interacts with the inter domain connecting loop (IDCL) on PCNA. TIP, however, lacks any known PCNA-interacting motif, suggesting a new mechanism for PCNA binding and regulation of PCNA-dependent activities, which may support the development of a new subclass of therapeutic biomolecules for inhibiting PCNA.

Rolf Bernander (1956-2014): pioneer of the archaeal cell cycle.

On 19 January 2014 Rolf ('Roffe') Bernander passed away unexpectedly. Rolf was a dedicated scientist; his research aimed at unravelling the cell biology of the archaeal domain of life, especially cell cycle-related questions, but he also made important contributions in other areas of microbiology. Rolf had a professor position in the Molecular Evolution programme at Uppsala University, Sweden for about 8 years, and in January 2013 he became chair professor at the Department of Molecular Biosciences, The Wenner-Gren Institute at Stockholm University in Sweden. Rolf was an exceptional colleague and will be deeply missed by his family and friends, and the colleagues and co-workers that he leaves behind in the scientific community. He will be remembered for his endless enthusiasm for science, his analytical mind, and his quirky sense of humour.

The solution structure of full-length dodecameric MCM by SANS and molecular modeling.

The solution structure of the full-length DNA helicase minichromosome maintenance protein from Methanothermobacter thermautotrophicus was determined by small-angle neutron scattering (SANS) data together with all-atom molecular modeling. The data were fit best with a dodecamer (dimer of hexamers). The 12 monomers were linked together by the B/C domains, and the adenosine triphosphatase (AAA+) catalytic regions were found to be freely movable in the full-length dodecamer both in the presence and absence of Mg(2+) and 50-meric single-stranded DNA (ssDNA). In particular, the SANS data and molecular modeling indicate that all 12 AAA+ domains in the dodecamer lie approximately the same distance from the axis of the molecule, but the positions of the helix-turn-helix region at the C-terminus of each monomer differ. In addition, the A domain at the N-terminus of each monomer is tucked up next to the AAA+ domain for all 12 monomers of the dodecamer. Finally, binding of ssDNA does not lock the AAA+ domains in any specific position, which leaves them with the flexibility to move both for helicase function and for binding along the ssDNA.

Detection of contaminating enzymatic activity in plant-derived recombinant biotechnology products.

Residual impurities in recombinantly produced protein biologics, such as host cell proteins (HCP), can potentially cause unwanted toxic or immunogenic responses in patients. Additionally, undetected impurities found in recombinant proteins used in cell culture may adversely impact basic research and biotechnology applications. Currently, the enzyme-linked immunosorbent assay (ELISA) is the standard for detection of residual HCP contamination in recombinantly produced biologics. Alternatively, two-dimensional liquid chromatography coupled to mass spectrometry is being developed as a tool for assessing this critical quality attribute. Both of these methods rely on the direct detection of HCPs and some previous knowledge of the contaminant. For contaminating enzymes, the mass level of the impurity may fall below the threshold of detection of these methods and underestimate the true impact. To address this point, here we demonstrate facile detection and characterization of contaminating phytase activity in rice-derived recombinant human serum albumin (rHSA) using a sensitive, label-free nuclear magnetic resonance (NMR) spectroscopy assay. We observed varying degrees of phytase contamination in biotechnology-grade rHSA from various manufacturers by monitoring the degradation of adenosine-5'-triphosphate and myo-inositol-1,2,3,4,5,6-hexakisphosphate by (31)P NMR. The observed lot-to-lot variability may result in irreproducible cell culture results and should be evaluated as a possible critical quality attribute in plant-derived biotherapeutics.

Characterization of family D DNA polymerase from Thermococcus sp. 9°N.

Accurate DNA replication is essential for maintenance of every genome. All archaeal genomes except Crenarchaea, encode for a member of Family B (polB) and Family D (polD) DNA polymerases. Gene deletion studies in Thermococcus kodakaraensis and Methanococcus maripaludis show that polD is the only essential DNA polymerase in these organisms. Thus, polD may be the primary replicative DNA polymerase for both leading and lagging strand synthesis. To understand this unique archaeal enzyme, we report the biochemical characterization of a heterodimeric polD from Thermococcus. PolD contains both DNA polymerase and proofreading 3'-5' exonuclease activities to ensure efficient and accurate genome duplication. The polD incorporation fidelity was determined for the first time. Despite containing 3'-5' exonuclease proofreading activity, polD has a relatively high error rate (95 × 10(-5)) compared to polB (19 × 10(-5)) and at least 10-fold higher than the polB DNA polymerases from yeast (polε and polδ) or Escherichia coli DNA polIII holoenzyme. The implications of polD fidelity and biochemical properties in leading and lagging strand synthesis are discussed.

Crystal structures of two active proliferating cell nuclear antigens (PCNAs) encoded by Thermococcus kodakaraensis.

Proliferating cell nuclear antigen (PCNA) is a ring-shaped protein that encircles duplex DNA and plays an essential role in many DNA metabolic processes in archaea and eukarya. The eukaryotic and euryarchaea genomes contain a single gene encoding for PCNA. Interestingly, the genome of the euryarchaeon Thermococcus kodakaraensis contains two PCNA-encoding genes (TK0535 and TK0582), making it unique among the euryarchaea kingdom. It is shown here that the two T. kodakaraensis PCNA proteins support processive DNA synthesis by the polymerase. Both proteins form trimeric structures with characteristics similar to those of other archaeal and eukaryal PCNA proteins. One of the notable differences between the TK0535 and TK0582 rings is that the interfaces are different, resulting in different stabilities for the two trimers. The possible implications of these observations for PCNA functions are discussed.

Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.

Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 µM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.