Disposable Zirconium trisulfide-Reduced graphene oxide modified conducting thread based electrochemical biosensor for lung cancer diagnosis.

Flexible technology in sensors have received much attention in monitoring of human health through various physiological indicators. Thus, it drawn a lot of interest in the development of flexible substrate for the diagnosis of various diseases via analysis of analytes. Present work focusses on the development of ecofriendly, portable, flexible, conducting thread (Th) and used as smart substrate for fabrication of biosensor towards ultrasensitive detection of the lung cancer biomarker (cytoskeleton-associated protein 4; CKAP4). The zirconium trisulfide-reduced graphene oxide nanocomposite and poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) modified cotton thread based biosensor was fabricated via dip coating method. Next, successive immobilization of monoclonal antibodies of CKAP4 (anti-CKAP4) and bovine serum albumin (BSA) was performed via drop cast approach using fabricated electrode [nZrS3@rGO/PEDOT:PSS/Th]. The response of fabricated electrode (BSA/anti-CKAP4/ZrS3@rGO/PEDOT:PSS/Th) was recorded electrochemically versus CKAP4 concentration via chronoamperometry (CA). The results showed wider linear detection range of 6.25-800 pg mL-1, excellent sensitivity of 85.2 µA[log(pg mL-1)]-1cm-2 with good stability up to 42 days. The response of fabricated biosensor was supported by investigating response of CKAP4 biomarker present in patients of lung cancer (concentration as determined through enzyme-linked immunosorbent assay) and obtained results exhibited excellent correlation with that of standard samples.

Nanoengineered phosphorus doped graphitic carbon nitride based ultrasensitive biosensing platform for Swine flu detection.

In the present study, we developed an amino-polyindole modified phosphorus doped graphitic carbon nitride nanomaterial (APIN/P-g-C3N4) based immunosensing biochip for Serum amyloid A (SAA) biomarker towards early diagnosis of Swine flu. The P-g-C3N4 was synthesis via polycondensation and functionalized with APIN. Further, the biochip was fabricated by modifying the working area of SPE with APIN/P-g-C3N4 using drop cast method, APIN introduced the larger loading of -NH2 group moieties onto P-g-C3N4 matrix and benefitted to reinforced the biomolecules via covalent linkages. The monoclonal anti-SAA was conjugated onto APIN/P-g-C3N4/SPE using EDC-NHS chemistry and BSA was added for non-specific site blocking. The structural, chemical, composition and morphological characteristics of the synthesized, functionalized nanomaterial and fabricated biochips were investigated by XRD, XPS, FT-IR spectroscopy, SEM, FE-SEM and TEM techniques. Further, the electrochemical characterization and response studies of fabricated biochip were analyzed using the CV and DPV techniques. Based on the analytical performance of the proposed immunosensing biochip i.e. BSA/anti-SAA/APIN/P-g-C3N4/SPE, it is capable to detect SAA protein with ultra sensitivity of 79.5 µA log (mL ng-1) cm-2, ultralow limit of detection of 5 ng mL-1 and wider linear detection range of 5 ng mL-1-500 µg mL-1 with quick response time of 10 min. Moreover, the fabricated immunosensing biochips was used to analyse SAA protein in spiked serum samples and the achieved results demonstrated the good agreement with the electrochemical response observed in standard SAA protein samples in analytical solution. The proposed biochip can provide insights for developing a wide range of clinical screening tools for detecting various contagious diseases.

Hemocompatible Functionalized Hydrogen Substituted Graphdiyne Based Highly Durable Biosensor for Liver Cancer Detection.

Present work focuses on the development of a highly durable biosensor for liver cancer (LC) biomarker (Annexin A2; ANXA2) detection. In this work, we have modified hydrogen substituted graphdiyne (HsGDY) using an organofunctional silane [3-(aminopropyl)triethoxysilane (APTES)], leveraging the opposite surface polarities on HsGDY and APTES to fabricate a highly hemocompatible functionalized nanomaterial matrix. The high hemocompatibility of APTES functionalized HsGDY (APTES/HsGDY) allows long-term stabilized immobilization of antibodies in their native state, hence increasing the durability of the biosensor. The biosensor was fabricated using electrophoretic deposition (EPD) of APTES/HsGDY onto an indium tin oxide (ITO)-coated glass substrate at 40% lower DC potential than nonfunctionalized HsGDY with successive immobilization of monoclonal antibodies of ANXA2 (anti-ANXA2) and bovine serum albumin (BSA). The synthesized nanomaterials and fabricated electrodes were investigated using a zetasizer and spectroscopic, microscopic, and electrochemical (cyclic voltammetry and differential pulse voltammetry) techniques. The developed immunosensor (BSA/anti-ANXA2/APTES/HsGDY/ITO) could detect ANXA2 in a linear detection range from 100 fg mL-1 to 100 ng mL-1 with a lower detection limit of 100 fg mL-1. The biosensor demonstrated excellent storage stability of 63 days along with high accuracy toward detection of ANXA2 in serum samples of LC patients as validated via enzyme-linked immunosorbent assay technique.

Nanodot zirconium trisulfide modified conducting thread: A smart substrate for fabrication of next generation biosensor.

In present work, we report an eco-friendly, flexible and highly conducting cotton thread (CT) as a smart substrate for the development of biosensing platform towards ultrasensitive detection of swine flu serum amyloid A (SAA) biomarker. The biosensor was fabricated by optimized coating of CT with poly(3,4-ethylenedioxythiophene): poly(styrenesulfonate) (PEDOT:PSS) conductive ink followed by incorporation of nanodot zirconium trisulfide (nZrS3) which helped in enhancing the electrochemical properties and improving stability of PEDOT:PSS polymeric film. The fabricated nZrS3/PEDOT:PSS/CT electrode was then used for sequential immobilization of monoclonal antibodies of SAA (anti-SAA) and bovine serum albumin (BSA). The synthesized nanomaterials and fabricated electrodes were characterized through X-ray diffraction, Fourier-transform infrared spectroscopy, transmission electron microscopy, scanning electron microscopy and contact angle analyser techniques. The electrochemical response of the fabricated smart thread based biosensor (BSA/anti-SAA/ZrS3/PEDOT:PSS/CT) was recorded against SAA using chronoamperometry technique which revealed superior sensitivity {30.2 µA [log (µg mL-1)]-1 cm-2}, excellent lower detection limit (0.72 ng mL-1) and prolonged shelf life up to 48 days. The response of the biosensor was also validated by analysing the electrochemical response of SAA spiked serum samples and the obtained results showed good correlation with that of standard samples.

Designing of a unique bioreceptor and fabrication of an efficient genosensing platform for neonatal sepsis detection.

We report the results of studies related to the fabrication of a nanostructured graphene oxide (GO)-based electrochemical genosensor for neonatal sepsis detection. Initially, we selected the fimA gene of E. coli for nenonatal sepsis detection and further designed a 20-mer long amine-terminated oligonucleotide. This designed oligonucleotide will work as a bioreceptor for the detection of the virulent fimA gene. An electrochemical genosensor was further developed where GO was used as an immobilization matrix. For the formation of a thin film of GO on an indium tin oxide (ITO)-coated glass electrode, an optimized DC potential of 10 V for 90 s was applied via an electrophoretic deposition unit. Thereafter, the designed oligonucleotides were immobilized through EDC-NHS chemistry. The nanomaterial and fabricated electrodes were characterized via X-ray diffraction, scanning electron microscopy, Fourier transform infrared spectroscopy and cyclic voltammetry techniques. The fabricated genosensor (BSA/pDNA/GO/ITO) has the ability to detect the target fimA gene with a linear detection range of 10-12 M to 10-6 M, a lower detection limit of 10-12 M and a sensitivity of 114.7 µA M-1 cm-2. We also investigated the biosensing ability of the developed genosensor in an artificial serum sample and the obtained electrochemical results were within the acceptable percentage relative standard deviation (% RSD), indicating that the fabricated genosensor can be used for the detection of neonatal sepsis by using a serum sample.

2D transparent few-layered hydrogen substituted graphdiyne nano-interface for unprecedented ultralow ANXA2 cancer biomarker detection.

Herein, we report synthesis of 2D few-layered transparent hydrogen substituted graphdiyne (HsGDY) nanosheets and explored its electrochemical characteristics for the first time to develop a nano-interface for cancer biomarker detection [liver cancer (LC) biomarker; ANXA2]. The semiconducting HsGDY (band gap; 1.98 eV) contains considerable number of sp and sp2 hybridised π-electrons with abundant hierarchical pores, thus reveals a negative peripheral charge and high surface area respectively, making it competent to immobilize mass anti-ANXA2 antibodies. The nano-interface platform is fabricated through electrophoretic deposition of HsGDY onto indium tin oxide (ITO) coated glass substrate (50V, 60s) with subsequent immobilization of anti-ANXA2 biomolecules and bovine serum albumin (BSA) to minimize non-specific binding. The pristine HsGDY and fabricated electrodes were characterized using spectroscopic, microscopic, zetasizer, surface area and pore size analyzer as well as electrochemical techniques. The electrochemical response of fabricated HsGDY nano-interface based biosensing platform (BSA/anti-ANXA2/HsGDY/ITO) is investigated via cyclic voltammetry (CV) and differential pulse voltammetry (DPV) techniques, which covers a wider linear detection range in between 0.01 fg mL-1 to 1000 ng mL-1 along with an exceptional sensitivity of 13.8 µA [log (ng mL-1)]-1 cm-2 and 2.8 µA [log (ng mL-1)]-1 cm-2 via CV and DPV techniques, respectively. This developed biosensor has the ability for unprecedented ultralow level i.e., upto 3 molecules of ANXA2 cancer biomarker detection. Moreover, the obtained electrochemical results show excellent correlation with the concentration of ANXA2 cancer biomarker present in LC patients obtained through enzyme linked immunosorbent assay (ELISA) technique.

Ultrasensitive biosensing platform based on yttria doped zirconia-reduced graphene oxide nanocomposite for detection of salivary oral cancer biomarker.

Herein, we report results of the studies relating to the fabrication of yttria-doped zirconia-reduced graphene oxide nanocomposite (nYZR) based biosensing platform for detection of salivary CYFRA-21-1 biomarker. The nYZR nanocomposite was hydrothermally synthesized and amine-functionalized using 3-aminopropyl triethoxysilane (APTES). This functionalized nanocomposite (APTES/nYZR) was electrophoretically deposited (45 V; 3 min) onto pre-hydrolyzed indium tin oxide (ITO) coated glass substrate (APTES/nYZR/ITO) followed by biofunctionalization via covalent immobilization of the anti-CYFRA-21-1 antibodies (anti-CYFRA-21-1/APTES/nYZR/ITO). The synthesized nanomaterial and the fabricated electrodes were characterized to investigate crystal structure, morphology and electrochemical properties via X-ray diffraction, Fourier transform infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, cyclic voltammetry, differential pulse voltammetry and electrochemical impedance spectroscopy. The fabricated biosensing electrode (BSA/anti-CYFRA-21-1/APTES/nYZR/ITO) has an operating shelf life of 56 days and can be used to detect salivary CYFRA-21-1 biomarker concentration as low as 7.2 pg mL-1 with wide linear detection range of 0.01-50 ng mL-1. This work opens new opportunities to explore the electrochemical behavior of nanostructured yttria stabilized zirconia (YSZ) and its composites at room temperature and its utility in developing biosensors and other electrochemical devices.

Nanostructured graphitic carbon nitride based ultrasensing electrochemical biosensor for food toxin detection.

We report results of the studies related to the fabrication of thionine functionalized graphitic carbon nitride nanosheets based ultrasensing platform for food toxin (Aflatoxin B1, AfB1) detection. The synthesis of graphitic carbon nitride nanosheets (g-C3N4) was carried out by polycondensation of melamine followed by chemical exfoliation. Further, thionine was used for the functionalization of g-C3N4 (Thn/g-C3N4) and deposited electrophoretically onto the indium tin oxide (ITO) coated glass electrode. The fabricated Thn/g-C3N4/ITO electrode was covalently immobilized by EDC-NHS chemistry with anti-aflatoxin B1 (anti-AfB1) followed by blocking of non-specific sites using BSA molecules. For structural, morphological, functional and electrochemical properties analysis of synthesized nanomaterials and fabricated electrodes X-ray diffraction, scanning electron microscopy, transmission electron microscopy, Fourier transform infrared spectroscopy, atomic force microscopy and cyclic voltammetry techniques were used. The electrochemical response studies of the fabricated biosensing platform (BSA/anti-AfB1/Thn/g-C3N4/ITO) were carried out towards detection of AfB1 antigen using cyclic voltammetry technique. The obtained electrochemical results indicate that the fabricated biosensing electrode having ability to detect AfB1 with lower limit of detection of 0.328 fg mL-1, linear detection range in between 1 fg mL-1 to 1 ng mL-1, sensitivity of 4.85 µA log [ng-1 mL] cm-2 with stability upto 7 weeks.

High bio-recognizing aptamer designing and optimization against human herpes virus-5.

While the world is tackling one of the direst health emergencies, it has come to light that in the fight against viruses, preparedness is everything. A disease with the initial symptoms of the common flu has the capacity to disrupt the life of 7.8 billion people and thus no infection and especially no virus can be ignored. Hence, we have designed the high bio-recognizing DNA aptamer for diagnosis and therapeutics role against glycoprotein-B (gB) of Human Herpes Virus-5 (HHV-5). HHV-5 is linked with epidemiological and asymptomatic diseases leading to high mortality. Herein, we report potent aptamer (5'CTCGCTTACCCCTGGGTGTGCGGG3') which has high specificity to gB with energy score -523.28 kJ/mol, more than reference aptamer L19 (-363.50 kJ/mol). The stable binding of aptamer with gB was confirmed with atomic fluctuations 0.1 to 1.8 Å through anisotropic network analysis. Aptamer formed stem-loop conformation (-1.0 kcal/mol) by stochastic simulation and found stable with physicochemical properties. Importantly, aptamer was found biologically significant with consisting of putative transcription factors in its vicinity (SP1, GATA1, AP2, NF1) and also possesses homology with exonic sequence of SGSH gene which indicated regulatory role in blockade of viruses. Inaddition, we also proposed plausible mechanism of action of aptamer as antiviral therapeutics.

Biofunctionalized Nanostructured Yttria Modified Non-Invasive Impedometric Biosensor for Efficient Detection of Oral Cancer.

We report results of the studies relating to the development of an efficient biosensor for non-invasive detection of CYFRA-21-1 cancer biomarker. We used a low dielectric constant material (nanostructured yttrium oxide, nY2O3) for the fabrication of the biosensing platform. The nY2O3 was synthesized via solvothermal process and functionalized using 3-aminopropyl triethoxy silane (APTES). Electrophoretic deposition (EPD) of the functionalized nanomaterial (APTES/nY2O3) onto an indium tin oxide (ITO)-coated glass electrode was conducted at a DC potential of 50V for 60s. The EDC-NHS chemistry was used for covalent immobilization of -COOH bearing monoclonal anti-CYFRA-21-1 onto -NH2 groups of APTES/nY2O3/ITO electrode. To avoid the non-specific interaction on the anti-CYFRA-21-1/APTES/nY2O3/ITO immunoelectrode, bovine serum albumin (BSA) was used. X-ray diffraction (XRD), transmission electron microscopy (TEM), and field emission scanning electron microscopy (FESEM) were utilized for structural and morphological studies, whereas Fourier-transform infrared spectroscopy (FTIR) was used for the bonding analysis. Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) techniques were used for electrochemical characterization and response studies of fabricated electrodes. The fabricated immunosensor (BSA/anti-CYFRA-21-1/APTES/nY2O3/ITO) exhibited linearity in the range of 0.01-50 ng·mL-1, sensitivity of 226.0 Ω·mL·ng-1, and lower detection limit of 0.01·ng·mL-1. A reasonable correlation was observed between the results obtained using this biosensor and concentration of CYFRA-21-1 measured through ELISA (enzyme-linked immunosorbent assay) technique in salivary samples of oral cancer patients.

Protein functionalised self assembled monolayer based biosensor for colon cancer detection.

We report results of the studies relating to the fabrication of a surface plasmon resonance (SPR) based label-free immunosensor for real-time monitoring of endothelin-1 (ET-1), a colon cancer biomarker. A gold disk modified with a self-assembled monolayer (SAM) of 11-mercaptoundecanoic acid (11-MUA) was functionalised via covalent immobilization of monoclonal anti-ET-1 antibodies using EDC-NHS (1-(3-(dimethylamine)-propyl)-3-ethylcarbodiimide hydrochloride, N-hydroxy succinimide) chemistry. This immunosensing platform (ethanolamine/anti-ET-1/11-MUA/Au) was characterized via atomic force microscopy (AFM), contact angle (CA) and Fourier transform infrared (FT-IR) spectroscopic techniques. The fabricated SPR electrode was further used to detect ET-1 in the broad concentration range 2-100 pg mL-1, with a detection limit of 0.30 pg mL-1 and remarkable sensitivity of 2.18 mo pg-1mL. The adsorption mechanism was studied using monophasic model and the values of association (ka) and dissociation (kd) constants for anti-ET-1 and ET-1 binding were calculated to be 4.4 ±â€¯0.4 × 105 M-1 s-1 and 2.04 ±â€¯0.0003 × 10-3 s-1, respectively. The results obtained via analysis of serum samples of colorectal cancer patients were found to be in good agreement with those obtained from enzyme-linked immunosorbent assay (ELISA) technique. Further, electrochemical studies were performed to prove the efficacy of the fabricated platform as a point of care device for the detection of ET-1.

Electrochemical paper based cancer biosensor using iron oxide nanoparticles decorated PEDOT:PSS.

We report results of the studies relating to the fabrication of a label-free, flexible, light weight and disposable conducting paper based immunosensing platform comprising of poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) and nanostructured iron oxide (nFe2O3@PEDOT:PSS) nanocomposite for detection of carcinoembryonic antigen (CEA), a cancer biomarker. The effect of various solvents such as sorbitol, ethanol, propanol, n-methyl-2-pyrrolidone (NMP) and dimethyl sulfoxide (DMSO) on the electrical conductivity of Whatman filter paper (WP) modified with nFe2O3@PEDOT:PSS/WP was investigated. The electrical conductivity of the PEDOT:PSS/WP electrode was found to be enhanced by two orders of magnitude (from 6.8× 10-4 to 1.92 × 10-2 Scm-1) after its treatment with DMSO. Further, nFe2O3 doped PEDOT:PSS/WP electrode exhibited the electrical conductivity as 2.4 × 10-2 Scm-1. Besides this, the incorporation of iron oxide nanoparticles (nFe2O3) into PEDOT:PSS/WP resulted in improved electrochemical performance and signal stability. This nFe2O3@PEDOT:PSS/WP based platform was used for immobilization of the anti-carcinoembronic antigen (anti-CEA) protein for quantitative estimation of cancer biomarker (CEA). The results of electrochemical response studies revealed that this conducting paper based immunoelectrode had a sensitivity of 10.2 µAng-1mLcm-2 in the physiological range (4-25 ngmL-1) and shelf life of 34 days. Further, the proposed immunoelectrode was validated with conventional ELISA for the detection of CEA in serum samples of cancer patients.

Microfluidics Based Point-of-Care Diagnostics.

Point-of-care (POC) diagnostic devices have been predicted to provide a boon in health care especially in the diagnosis and detection of diseases. POC devices have been found to have many advantages like a rapid and precise response, portability, low cost, and non-requirement of specialized equipment. The major objective of a POC diagnostic research is to develop a chip-based, self-containing miniaturized device that can be used to examine different analytes in complex samples. Further, the integration of microfluidics (MF) with advanced biosensor technologies is likely to result in improved POC diagnostics. This paper presents the overview of the different materials (glass, silicon, polymer, paper) and techniques for the fabrication of MF based POC devices along with their wide range of biosensor applications. Besides this, the authors have presented in brief the challenges that MF is currently facing along with possible solutions that may result in the availability of the accessible, reliable, and cost-efficient technology. The development of these devices requires the combination of developed MF components into POC devices that are user-friendly, sensitive, stable, accurate, low cost, and minimally invasive. These MF based POC devices have tremendous potential in providing improved healthcare including easy monitoring, early detection of disease, and increased personalization.

Effect of Brownian motion on reduced agglomeration of nanostructured metal oxide towards development of efficient cancer biosensor.

We report results of the studies relating to fabrication of nanostructured metal oxide (NMO) based cancer biosensor. With the help of 2D electroactive reduced graphene oxide (RGO), we successfully inhibited the Brownian motion of NMO that led to reduced agglomeration of NMO. The nanostructured hafnium oxide (nHfO2) was used as a model NMO. The reduced agglomeration of nHfO2 was achieved through controlled hydrothermal synthesis and investigated via nanoparticles tracking analysis (NTA). X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscope (TEM) techniques were used for phase identification as well as morphological analysis of the synthesized nanohybrid (nHfO2@RGO) material. The 3-aminopropyl triethoxysilane (APTES) was used for the functionalization of nHfO2@RGO and electrophoretic deposition (EPD) technique was used for its deposition onto ITO coated glass electrode. Further, antibodies of cancer biomarker (anti-CYFRA-21-1) were immobilized via EDC-NHS chemistry and Bovine serum albumin (BSA) was used for blocking of the non-specific binding sites. The electrochemical response studies of fabricated immunoelectrode (BSA/anti-CYFRA-21-1/APTES/nHfO2@RGO/ITO) revealed higher sensitivity (18.24µAmLng-1), wide linear detection range (0 to 30ngmL-1), with remarkable lower detection limit (0.16ngmL-1). The obtained results showed good agreement with the concentration of CYFRA-21-1 obtained through enzyme linked immunosorbent assay (ELISA) in saliva samples of oral cancer patients.

Excellent storage stability and sensitive detection of neurotoxin quinolinic acid.

Quinolinic acid (QA) is a metabolite of tryptophan degradation obtained through kynurenine pathway, produced naturally in the mammalian brain as well as in the human cerebrospinal fluid. The presence of QA ~10-40µM is a clear indicator of many neurological disorders as well as deficiency of vitamin B6 in human being. In the present work; rapid, sensitive and cost-effective bio-electrodes were prepared to detect the trace amount of endogenous neurotoxin (QA). Cyclic voltammetry (CV) and differential pulse voltammetry (DPV) studies were carried out to measure the electrochemical response of the fabricated bio-electrodes as a function of QA concentrations. These devices were found to exhibit desirable sensitivity of ~7.86mAµM-1cm-2 in wide concentration range (6.5µM-65mM). The lower detection limit of this device is as low as 6.5µM and it has excellent storage stability of ~30 days. The capability of the proposed electrochemical bio-sensor was also checked to detect QA in the real samples (human serum). These results reveal that the use of this electrochemical bio-sensor may provide a potential platform for the detection of QA in the real samples for the prior detection of many diseases.

Nanostructured zirconia decorated reduced graphene oxide based efficient biosensing platform for non-invasive oral cancer detection.

We report results of the studies relating to fabrication of a non-invasive, label-free and an efficient biosensing platform for detection of the oral cancer biomarker (CYFRA-21-1). One step hydrothermal process was used for uniform decoration of nanostructured zirconia (average particle size 13 nm) on reduced graphene oxide (ZrO2-RGO) to avoid coagulation of the zirconia nanoparticles and to obtain enhanced electrochemical performance of ZrO2-RGO nanocomposite based biosensor. Further, ZrO2-RGO has been functionalized using 3-aminopropyl triethoxy saline (APTES) and electrophoretically deposited on the indium tin oxide coated glass substrate at a low DC potential.The APTES/ZrO2-RGO/ITO electrode exhibits improved heterogeneous electron transfer (more than two times) with respect to that of the APTES/ZrO2/ITO electrode indicating faster electron transfer kinetics. The -NH2 containing APTES/ZrO2-RGO/ITO platform is further biofunctionalized with anti-CYFRA-21-1. The structural and morphological investigations of the ZrO2-RGO based biosensing platform have been accomplished using X-ray diffraction (XRD), electrochemical, transmission electron microscopy (TEM), atomic force microscopy (AFM) and Fourier transform infrared spectroscopy (FT-IR) studies. This immunosensor exhibits a wider linear detection range (2-22 ng mL(-1)), excellent sensitivity (0.756 µA mL ng(-1)) and a remarkable lower detection limit of 0.122 ng mL(-1). The observed results have been validated via enzyme linked immunosorbent assay (ELISA).

Reduced graphene oxide modified smart conducting paper for cancer biosensor.

We report results of the studies relating to the fabrication of a paper based sensor comprising of poly (3,4-ethylenedioxythiophene):poly(styrenesulfonate) ( PEDOT: PSS) and reduced graphene oxide (RGO) composite. The effect of various solvents like methanol, ethylene glycol and H2SO4 on the electrical conductivity of PEDOT: PSS coated Whatman paper has been investigated. The conductivity of this solution processed conducting paper significantly increases from ~1.16×10(-4) S cm(-1) up to ~3.57×10(-2) S cm(-1) (~300 times) on treatment with ethylene glycol. The observed significant increase in electrical conductivity is due to conformational rearrangement in the polymer and is due to strong non-covalent cooperative interaction between PEDOT and the cellulose molecules. Further, incorporation of RGO into the conducting paper results in improved electrochemical performance and signal stability. This paper electrode is a promising alternative over the expensive conventional electrodes (ITO, gold and glassy carbon), that are known to have limited application in smart point-of-care (POC) devices. This low cost, flexible and environment friendly conducting paper based biosensor utilized for cancer biomarker (carcinoembryonic antigen, CEA) detection reveals high sensitivity of 25.8 µA ng(-1) mL cm(-2) in the physiological range, 1-10 ng mL(-1).

Biofunctionalized Nanostructured Zirconia for Biomedical Application: A Smart Approach for Oral Cancer Detection.

Results of the studies are reported relating to application of the silanized nanostructured zirconia, electrophoretically deposited onto indium tin oxide (ITO) coated glass for covalent immobilization of the monoclonal antibodies (anti-CYFRA-21-1). This biosensing platform has been utilized for a simple, efficient, noninvasive, and label-free detection of oral cancer via cyclic voltammetry technique. The results of electrochemical response studies conducted on bovine serum albumin (BSA)/anti-CYFRA-21-1/3-aminopropyl triethoxy silane (APTES)/ZrO2/ITO immunoelectrode reveal that this immunoelectrode can be used to measure CYFRA-21-1 (oral cancer biomarker) concentration in saliva samples, with a high sensitivity of 2.2 mA mL ng-1, a linear detection range of 2-16 ng mL-1, and stability of six weeks. The results of these studies have been validated via enzyme-linked immunosorbent assay.

Microfluidic-integrated biosensors: prospects for point-of-care diagnostics.

There is a growing demand to integrate biosensors with microfluidics to provide miniaturized platforms with many favorable properties, such as reduced sample volume, decreased processing time, low cost analysis and low reagent consumption. These microfluidics-integrated biosensors would also have numerous advantages such as laminar flow, minimal handling of hazardous materials, multiple sample detection in parallel, portability and versatility in design. Microfluidics involves the science and technology of manipulation of fluids at the micro- to nano-liter level. It is predicted that combining biosensors with microfluidic chips will yield enhanced analytical capability, and widen the possibilities for applications in clinical diagnostics. The recent developments in microfluidics have helped researchers working in industries and educational institutes to adopt some of these platforms for point-of-care (POC) diagnostics. This review focuses on the latest advancements in the fields of microfluidic biosensing technologies, and on the challenges and possible solutions for translation of this technology for POC diagnostic applications. We also discuss the fabrication techniques required for developing microfluidic-integrated biosensors, recently reported biomarkers, and the prospects of POC diagnostics in the medical industry.