Electron transfer in the heliobacterial reaction center: evidence against a quinone-type electron acceptor functioning analogous to A1 in photosystem I.

Membrane fragments from Heliobacillus mobilis were characterized using time resolved optical spectroscopy and photovoltage measurements in order to detect a possible participation of menaquinone (MQ), functioning analogous to the phylloquinone A1 in photosystem I, as intermediate in electron transfer from the primary acceptor A0 to the iron-sulfur cluster FX in the photosynthetic reaction center. The spectroscopic data obtained exclude that electron transfer from a semiquinone anion MQ- to FX occurred in the time window from 2 ns to 4 micros, where it would be expected in analogy to photosystem I. In the case of a prereduction of FX, only the primary pair P798+A0- was formed. The photovoltage data yielded a single kinetic phase with a time constant of 700 ps for the transmembrane electron transfer beyond A0; the relative amplitude of this phase suggests that it reflects electron transfer from A0- to FX.

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

Functional implications of the propionate 7-arginine 220 interaction in the FixLH oxygen sensor from Bradyrhizobium japonicum.

BjFixL from Bradyrhizobium japonicum is a heme-based oxygen sensor implicated in the signaling cascade that enables the bacterium to adapt to fluctuating oxygen levels. Signal transduction is initiated by the binding of O(2) to the heme domain of BjFixL, resulting in protein conformational changes that are transmitted to a histidine kinase domain. We report structural changes of the heme and its binding pocket in the Fe(II) deoxy and Fe(III) met states of the wild-type BjFixLH oxygen sensor domain and four mutants of the highly conserved residue arginine 220. UV-visible, electron paramagnetic resonance, and resonance Raman spectroscopies all showed that the heme iron of the R220H mutant is unexpectedly six-coordinated at physiological pH in the Fe(III) state but undergoes pH- and redox-dependent coordination changes. This behavior is unprecedented for FixL proteins, but is reminiscent of another oxygen sensor from E. coli, EcDos. All mutants in their deoxy states are five-coordinated Fe(II), although we report rupture of the residue 220-propionate 7 interaction and structural modifications of the heme conformation as well as propionate geometry and flexibility. In this work, we conclude that part of the structural reorganization usually attributed to O(2) binding in the wild-type protein is in fact due to rupture of the Arg220-P7 interaction. Moreover, we correlate the structural modifications of the deoxy Fe(II) states with k(on) values and conclude that the Arg220-P7 interaction is responsible for the lower O(2) and CO k(on) values reported for the wild-type protein.

Membrane-bound c-type cytochromes in Heliobacillus mobilis. In vivo study of the hemes involved in electron donation to the photosynthetic reaction center.

The amount of heme per photosynthetic reaction center (RC) was examined in whole cells of Heliobacillus mobilis, and a stoichiometry of 5-6 hemes c and 1-3 hemes b per RC was found. Virtually the full complement of heme was seen to be functionally connected to the pool of electron donors to the photosynthetic RC. The kinetic parameters of electron transfer between reduced c-type hemes and the photooxidized primary donor P798+ were studied in whole cells and membrane fragments. The in vivo half-times of electron donation (50% with t 1/2 = 110 microseconds, 50% with t 1/2 = 600 microseconds) were seen to slow down to half-times in the range of several and several tens of milliseconds following disruption of cells. A severe conformational alteration or a change in the identity of the donating heme is discussed. Redox titrations of the flash-induced absorption changes performed on whole cells in the presence of mediators yielded the following redox midpoint potentials: P798, Em = +240 mV; heme c553, Em = +190, +170, and +90 mV for the heme components oxidized after the first, second, and third flash, respectively. The results demonstrate that the pool of c553 hemes donating electrons to the RC is heterogeneous and that it consists of either several distinguishable cytochromes or multiheme cytochromes or both. The number of hemes reduced and the kinetics of heme rereduction after flash-induced oxidation were found to depend strongly on the degree of anaerobicity in the interior compartment of the cell. A model rationalizing the obtained results in terms of a set of differing redox components is proposed.

Control of nitric oxide dynamics by guanylate cyclase in its activated state.

Soluble guanylate cyclase (sGC) is the target of nitric oxide (NO) released by nitric-oxide synthase in endothelial cells, inducing an increase of cGMP synthesis in response. This heterodimeric protein possesses a regulatory subunit carrying a heme where NO binding occurs, while the second subunit harbors the catalytic site. The binding of NO and the subsequent breaking of the bond between the proximal histidine and the heme-Fe(2+) are assumed to induce conformational changes, which are the origin of the catalytic activation. At the molecular level, the activation and deactivation mechanisms are unknown, as is the dynamics of NO once in the heme pocket. Using ultrafast time-resolved absorption spectroscopy, we measured the kinetics of NO rebinding to sGC after photodissociation. The main spectral transient in the Soret band does not match the equilibrium difference spectrum of NO-liganded minus unliganded sGC, and the geminate rebinding was found to be monoexponential and ultrafast (tau = 7.5 ps), with a relative amplitude close to unity (0.97). These characteristics, so far not observed in other hemoproteins, indicate that NO encounters a high energy barrier for escaping from the heme pocket once the His-Fe(2+) bond has been cleaved; this bond does not reform before NO recombination. The deactivation of isolated sGC cannot occur by only simple diffusion of NO from the heme; therefore, several allosteric states may be inferred, including a desensitized one, to induce NO release. Thus, besides the structural change leading to activation, a consequence of the decoupling of the proximal histidine may also be to induce a change of the heme pocket distal geometry, which raises the energy barrier for NO escape, optimizing the efficiency of NO trapping. The non-single exponential character of the NO picosecond rebinding coexists only with the presence of the protein structure surrounding the heme, and the single exponential rate observed in sGC is very likely to be due to a closed conformation of the heme pocket. Our results emphasize the physiological importance of NO geminate recombination in hemoproteins like nitric-oxide synthase and sGC and show that the protein structure controls NO dynamics in a manner adapted to their function. This control of ligand dynamics provides a regulation at molecular level in the function of these enzymes.

Cyclic electron transfer in Heliobacillus mobilis involving a menaquinol-oxidizing cytochrome bc complex and an RCI-type reaction center.

Flash-induced absorption changes arising from b-type hemes were studied on whole cells of Heliobacillus mobilis under physiological and redox-controlled conditions. The sensitivity of the monitored redox changes to inhibitors of cytochrome bc complexes and the redox potential dependence of reduction and oxidation reactions of cytochrome b-hemes demonstrate that the respective b-hemes are part of a cytochrome bc complex. Both the half-time and the extent of flash-induced reduction of cytochrome b titrated with apparent potentials of about -60 and -50 mV (both n = 2), respectively, i.e., close to the Em,7 value of the menaquinone (MK) pool, indicating a collisional interaction between menaquinol and the Qo site of the cytochrome bc complex. At strongly reducing ambient potentials (< -150 mV), a net flash-induced oxidation of b-hemes was observed in agreement with the Em,7 values of the individual hemes of -90 mV (b(h)) and -190 mV (b(l)) determined in equilibrium redox titrations on membrane fragments. From the extent of photooxidized b- and c-type hemes as well as P798+, a stoichiometry of 0.6-0.75 cytochrome bc complexes per photosynthetic reaction center was estimated. The kinetic behavior and also the energy profiles for Q-cycle turnover of the heliobacterial complex are compared to those of cytochrome bc1 complexes from purple bacteria and of cytochrome b6f complexes from chloroplasts.

Two distinct pathways for thymidylate (dTMP) synthesis in (hyper)thermophilic Bacteria and Archaea.

The hyperthermophilic anaerobic archaeon Pyrococcus abyssi, which lacks thymidine kinase, incorporates label from extracellular uracil, but not from thymidine, into its DNA. This implies that P. abyssi must synthesize dTMP (thymidylate), an essential precursor for DNA synthesis, de novo. However, iterative similarity searches of the three completed Pyrococcus genomes fail to detect candidate genes for canonical thymidylate synthase ThyA, suggesting the presence of alternative pathways for dTMP synthesis. Indeed, by identifying a novel class of flavin-dependent thymidylate synthases, ThyX, we have recently proven that two distinct pathways for de novo synthesis of dTMP are operational in the microbial world. While both thyX and thyA can be found in hyperthermophilic micro-organisms, the phylogenetic distribution of thyX among hyperthermophiles is wider than that of thyA. In this contribution, we discuss the differences in the distinct mechanisms of dTMP synthesis, with a special emphasis on hyperthermophilic micro-organisms.

The Rieske FeS center from the gram-positive bacterium PS3 and its interaction with the menaquinone pool studied by EPR.

The Rieske 2Fe2S center from Bacillus PS3, a Gram-positive thermophilic eubacterium, has been studied by EPR spectroscopy. Its redox midpoint potential at pH 7.0 was determined to be +165 +/- 10 mV and was found to decrease with an apparent slope of -80 mV/pH unit above pH 7.9. The Qo-site inhibitor stigmatellin induced spectral changes analogous to those reported for Rieske centers from mitochondria and chloroplasts. The redox midpoint potential of the PS3 Rieske cluster was not affected by stigmatellin. The orientation of the g tensor was similar to other Rieske centers (gz and gy are oriented parallel, gx is oriented perpendicular to the membrane plane). The shape of the EPR spectrum of the Rieske cluster from PS3 changed as a function of the redox state of the menaquinone (MK) pool. This permitted the redox midpoint potential of the MK pool to be determined in the membrane. Values of -60 +/- 20 mV at pH 7.0 and of -130 +/- 20 mV at pH 8.0 were obtained. The results are compared with already published data from other Rieske centers. It is proposed that all Rieske centers that function in electron transport chains using MK as pool quinone show common features that distinguish them from Rieske centers operating in ubiquinone- or plastoquinone-based electron transfer chains.

Aggregation-Dependent interaction of the Alzheimer's beta-amyloid and microglia.

Chronic glial activation possibly plays a role in chronic neurodegeneration in Alzheimer's disease (AD). It has been shown that amyloid peptide is capable of activating microglial cells in vitro. The aim of this study was to further characterize the structural preconditions for amyloid peptide in order to activate glial cells and to investigate whether this peptide is also able to induce glial activation in the living brain. We observed that amyloid peptide induced strong cellular activation in primary microglial cell culture as detected by the release of stable metabolites of nitric oxide (NO), when the peptide was fibrillar. For this activation, co-stimulation with interferon-gamma was a precondition. Using microdialysis of the living brain in a rat we observed pronounced NO generation when fibrillar amyloid peptide was stereotaxically injected. Non-fibrillar amyloid peptide did not induce such a glial reaction. No administration of interferon-gamma or any other co-stimulatory factor was necessary in vivo. Thus, we show that fibrillar, but not non-fibrillar amyloid peptide induced glial activation also in vivo. In the case of the living brain, the presence of deposits of fibrillar amyloid peptide could maintain a chronic microglial activation, ultimately leading to the progressive neurodegeneration associated with Alzheimer's disease.

Dynamics of nitric oxide in the active site of reduced cytochrome c oxidase aa3.

Nitric oxide (NO) is involved in the regulation of respiration by acting as a competitive ligand for molecular oxygen at the binuclear active site of cytochrome c oxidase. The dynamics of NO in and near this site are not well understood. We performed flash photolysis studies of NO from heme a3 in cytochrome c oxidase from Paracoccus denitrificans, using femtosecond transient absorption spectroscopy. The formation of the product state--the unliganded heme a3 ground state--occurs in a similar stepwise manner (period approximately 700 fs) as previously observed for carbon monoxide photolysis from this enzyme and interpreted in terms of ballistic ligand motions in the active site on the subpicosecond time scale [Liebl, U., Lipowski, G., Négrerie, M., Lambry, J.-C., Martin, J.-L., and Vos, M. H. (1999) Nature 401, 181-184]. A fraction (approximately 35% at very low NO concentrations) of the dissociated NO recombines with heme a3 in 200-300 ps. The presence of this recombination phase indicates that a transient bond to the second ligand-binding site, a copper atom (CuB), has a short lifetime or may not be formed. Increasing the NO concentration increases the recombination yield on the hundreds of picoseconds time scale. This effect, unprecedented for heme proteins, implies that, apart from the one NO molecule bound to heme a3, a second NO molecule can be accommodated in the active site, even at relatively low (submicromolar) concentrations. Models for NO accommodation in the active site, based on molecular dynamics energy minimizations are presented. Pathways for NO motion and their relevance for the regulation of respiration are discussed.

Membrane-bound c-type cytochromes in Heliobacillus mobilis. Characterisation by EPR and optical spectroscopy in membranes and detergent-solubilised material.

The spectral and electrochemical parameters, as well as the orientations of the heme plane with respect to the membrane plane, of the c-type hemes present in membrane fragments from Heliobacillus mobilis were characterised by optical and EPR spectroscopy. Cytochrome C53, was thereby shown to represent at least four and possibly five heme species with the following characteristics: Em = -60 mV +/- 10 mV, g, = 2.92, 60 degrees; Em = +90 mV +/- 10 mV, g, = 2.92, 90 degrees; Em = +120 mV +/- 20 mV, g, = 3.03; and Em = +170 mV +/- 20 mV, g, = 3.03. The latter component may correspond to two hemes with redox midpoint potentials of Em = +160 mV +/- 20 mV and Em = +180 mV +/- 20 mV (all Em values at pH 7.0). For the heme species having g, peaks at g approximately 3.03, determination of individual orientations was precluded due to the superposition of several differently oriented hemes. About one copy of each heme was found to be present per photosynthetic reaction centre, with the exception of the +120 mV component for which a stoichiometry of 2 hemes/reaction centre was obtained. The heme proteins were detergent-solubilised and partially purified. Three c-type cytochromes that migrated with apparent molecular masses of 18, 29 and 50 kDa were detected on SDS/PAGE. Optical redox titrations at pH 7.0 showed redox midpoint potentials of +160 mV +/- 10 mV for the 18-kDa cytochrome, and -60 mV +/- 10 mV, with possible contributions around +160 mV, for the 50-kDa cytochrome. A tentative attribution of heme species observed in membranes to the isolated heme proteins is presented. The results obtained on H. mobilis are compared with those reported for green sulphur bacteria.

Spectral equilibration and primary photochemistry in Heliobacillus mobilis at cryogenic temperature.

We performed multicolor femtosecond transient absorption measurements on membranes of the photosynthetic bacterium Heliobacillus mobilis at 20 K, by selective excitation at either the red or the blue extreme of the bacteriochlorophyll g Q(Y) band, which is split in three spectral forms (Bchl g 778, 793, and 808) at low temperature. In contrast to room temperature, there is no observable uphill energy transfer upon excitation at the red extreme. This provides a direct experimental confirmation of the expected strong temperature dependence of uphill energy transfer in multichromophore systems. Upon excitation at the blue edge, downhill energy transfer is observed on time ranges varying over 2 orders of magnitude and is discussed in terms of four distinct energy transfer processes: Bchl g 778* --> Bchl g 793* (approximately 50 fs); Bchl g 778* --> Bchl g 808* (approximately 400 fs); Bchl g 793* --> Bchl g 808* (approximately 1.4 ps); and within Bchl g 808* (approximately 7 ps). Surprisingly, the amount of oxidized primary donor P798+ formed on the time scale of picoseconds and tens of picoseconds was found to depend on the excitation conditions: trapping occurs mainly in approximately 80 ps and slower from directly excited Bchl g 808* and can additionally occur in a few picoseconds from Bchl g 778* and Bchl g 793* upon blue excitation. This finding implies that spectral equilibration is not complete prior to charge separation and furthermore is inconsistent with a funnel model, in which P798 is surrounded by long-wavelength pigments. More generally, we discuss to what extent our data bring constraints on the spatial distribution of the different spectral forms of the pigments.

Femtosecond resolution of ligand-heme interactions in the high-affinity quinol oxidase bd: A di-heme active site?

Interaction of the two high-spin hemes in the oxygen reduction site of the bd-type quinol oxidase from Escherichia coli has been studied by femtosecond multicolor transient absorption spectroscopy. The previously unidentified Soret band of ferrous heme b(595) was determined to be centered around 440 nm by selective excitation of the fully reduced unliganded or CO-bound cytochrome bd in the alpha-band of heme b(595). The redox state of the b-type hemes strongly affects both the line shape and the kinetics of the absorption changes induced by photodissociation of CO from heme d. In the reduced enzyme, CO photodissociation from heme d perturbs the spectrum of ferrous cytochrome b(595) within a few ps, pointing to a direct interaction between hemes b(595) and d. Whereas in the reduced enzyme no heme d-CO geminate recombination is observed, in the mixed-valence CO-liganded complex with heme b(595) initially oxidized, a significant part of photodissociated CO does not leave the protein and recombines with heme d within a few hundred ps. This caging effect may indicate that ferrous heme b(595) provides a transient binding site for carbon monoxide within one of the routes by which the dissociated ligand leaves the protein. Taken together, the data indicate physical proximity of the hemes d and b(595) and corroborate the possibility of a functional cooperation between the two hemes in the dioxygen-reducing center of cytochrome bd.

Conserved nonliganding residues of the Rhodobacter capsulatus Rieske iron-sulfur protein of the bc1 complex are essential for protein structure, properties of the [2Fe-2S] cluster, and communication with the quinone pool.

The iron-sulfur (Fe-S) protein subunit of the bc1 complex, known as the Rieske protein, contains a high-potential [2Fe-2S] cluster ligated by two nitrogen and two sulfur atoms to its apoprotein. Earlier work indicated that in Rhodobacter capsulatus these atoms are provided by two cysteine (C133 and C153) and two histidine (H135 and H156) residues, located at the carboxyl-terminal end of the protein [Davidson, E., Ohnishi, T., Atta-Asafo-Adjei, E., & Daldal, F. (1992) Biochemistry 31, 3342-3351]. These ligands are part of the conserved sequences C133THLGC138 (box I) and C153PCHGS158 (box II) and affect the properties of the Fe-S protein and its [2Fe-2S] cluster. In this work, the role of amino acid side chains at positions 134 and 136, adjacent to the cluster ligands in box I, was probed by using site-directed mutagenesis and biophysical analyses. These positions were substituted with R, D, H, and G to probe the effect of charged, polar, large, and small amino acid side chains on the properties of the [2Fe-2S] cluster. Of the mutants obtained T134R, -H, and -G were photosynthetically competent (Ps+) but contained Fe-S proteins with redox midpoint potentials (Em7) 50-100 mV lower than that of a wild type strain. In contrast, T134D was Ps- and contained no detectable [2Fe-2S] cluster, although it reverted frequently to Ps+ by substitution of D with N. On the other hand, all L136 mutants were Ps-, the EPR characteristics of their [2Fe-2S] cluster were perturbed, and they were unable to sense the Qpool redox state or to bind stigmatellin properly. The overall data indicated that replacement of the amino acid side chain at position 134 of the Fe-S protein affects mainly the Em7 and oxygen sensitivity of the [2Fe-2S] cluster without abolishing its function, while substitutions at position 136 perturb drastically its ability to monitor the Qpool redox state and its interaction with the Qo site inhibitor stigmatellin. These two distinct phenotypes of box I T134 and L136 mutants are discussed with regard to the recently published three-dimensional structure of the water soluble part of the bovine heart mitochondrial Rieske Fe-S protein.

The amino-terminal portion of the Rieske iron-sulfur protein contributes to the ubihydroquinone oxidation site catalysis of the Rhodobacter capsulatus bc1 complex.

The Rieske iron-sulfur (Fe-S) protein subunit of bc1 complexes contains in its carboxyl-terminal part two highly conserved hexapeptide motifs (box I and box II) that include the four amino acid ligands of its [2Fe-2S] cluster. In the preceding paper [Liebl, U., Sled, V., Brasseur, G., Ohnishi, T., & Daldal, F. (1997) Biochemistry 36, 11675-11684], the effects of mutations at two of the nonliganding residues [threonine (T) 134 and leucine (L) 136 in the Rhodobactercapsulatus Rieske Fe-S protein] of box I have been described. In this work, interactions between the occupants of the Qo site of the bc1 complex (UQ/UQH2 and the inhibitors stigmatellin and myxothiazol) and the [2Fe-2S] cluster of the Rieske Fe-S protein were probed by isolating photosynthesis-proficient (Ps+) revertants of the Ps- mutants L136R, -H, -D and -G. These revertants contained either a single substitution at the original position 136 or an additional mutation located in the amino-terminal part of the Fe-S protein at either position 44 or 46. The same-site revertants L136A and -Y grew well under photosynthetic conditions and contained highly active bc1 complexes but exhibited modified EPR spectra both in the presence and in the absence of stigmatellin. Unexpectedly, they were highly resistant to stigmatellin (StiR) and hypersensitive to myxothiazol (MyxHS) in vivo, demonstrating for the first time that mutations located in the Fe-S subunit confer resistance to stigmatellin. The [2Fe-2S] cluster of the same-site revertants responded weakly to the Qpool redox state and had redox midpoint potential (Em7) values (around 265 mV) lower than those of their wild type counterpart (about 310 mV). On the other hand, the second-site revertants L136H/V44L, L136G/V44F, and L136G/A46T, -V, or -P supported photosynthetic growth poorly, were StiR and MyxHS, and contained barely active bc1 complexes. Like the same-site revertants, they exhibited modified EPR spectra both in the presence and in the absence of stigmatellin and had perturbed Qo site occupancy. In addition, they contained substoichiometric amounts of the Fe-S protein with respect to the other subunits of the bc1 complex. The Em7 values of the [2Fe-2S] cluster of these double mutants were lower (around 245 mV) than that of the wild type strain but appreciably higher than those of their Ps- parents (about 200 mV for L136G). In order to define the molecular nature of the suppression mediated by the second-site mutations, the single mutants V44L and -F and A46T and -V were constructed in the absence of the original mutations at position 136. These mutants behaved like a wild type strain with respect to their Ps+ growth ability, inhibitor sensitivity, EPR spectra of their [2Fe-2S] cluster, and response to stigmatellin or to the Qpool redox state. But surprisingly, the Em7 values of their [2Fe-2S] cluster were much higher (about 385 mV) than that of a wild type strain. These findings demonstrated for the first time that the amino-terminal part of the Rieske Fe-S protein encompassing residues 44 and 46 is important not only for the structure and function of the Qo site of the bc1 complex but also for the properties of its [2Fe-2S] cluster.

Reaction center photochemistry of Heliobacterium chlorum.

Reaction center photochemistry in Heliobacterium chlorum has been investigated by using EPR and flash absorption spectroscopy at low temperatures. The following results were obtained. At 5 K, in the presence of ascorbate, continuous illumination resulted in the formation of P798+ and a reduced iron-sulfur center designated FB (gz = 2.07, gy = 1.93, gx = 1.89). This state was stable at low temperatures, but the yield for this reaction was low, and it was estimated that it occurred only in about 3% of the centers upon the first flash. After continuous illumination of a dilute sample for 10 min, still only half of the centers attained this state. In most centers, flash excitation at 5 K produced a state which recombined with time constants of 2.5 ms (congruent to 80%) and 850 microseconds (congruent to 20%). These two phases were differently influenced by the redox state of the reaction center, indicating that two different acceptors were involved in the recombination reactions. When continuous illumination was given at 200 K, a second center, designated FA, was additionally reduced (gz = 2.05, gy = 1.95, gx = 1.90). High concentrations of dithionite resulted in the chemical reduction of FB and of most of FA; illumination at 200 K resulted in the further reduction of FA. Two triplet states were identified by EPR and optical spectroscopy. The amplitude of the narrower triplet (magnitude of D = 226 x 10(-4) cm-1) varied with the redox state of the iron-sulfur centers and was influenced by a component thought to be a quinone undergoing double reduction. It correlated with a triplet state observed by flash absorption spectroscopy showing a bleaching at 798 nm and is attributed to a triplet state formed by charge recombination in the reaction center. Its narrowness is taken as an indication of its origin on a pair of bacteriochlorophylls, and its orientation indicates an orientation of the chlorophyll ring plane perpendicular to the membrane plane. The second triplet had a wider splitting (magnitude of D = 242 x 10(-4) cm-1), did not vary systematically with redox conditions, corresponds to an optical spectrum with a maximum at 812 nm, and is not ordered in the membrane. It was thus attributed to a triplet located on a BChl g monomer in the antenna. The reaction center photochemistry in H. chlorum is comparable in many respects to that of photosystem I and green sulfur bacteria. Earlier contrasting conclusions are discussed and rationalized in light of the present results.

Single core polypeptide in the reaction center of the photosynthetic bacterium Heliobacillus mobilis: structural implications and relations to other photosystems.

The gene for a reaction center core polypeptide from the anoxygenic photosynthetic bacterium Heliobacillus mobilis was cloned and sequenced. The deduced amino acid sequence consists of 609 residues with a molecular mass of 68 kDa. An adjacent open reading frame is not transcribed under our experimental conditions. No evidence for a second related reaction center core gene was found. The primary sequence of the reaction center protein (P800 protein) shows a high percentage of sequence identity to photosystem I in a cysteine-containing loop, which is the putative binding site of the iron-sulfur center FX and in the preceding hydrophobic region. Our data imply a homodimeric organization of the reaction center. This is fundamentally different from photosystem I and most other photosynthetic reaction centers, where the reaction center core is composed of two similar but nonidentical subunits.

EPR, electron spin echo envelope modulation, and electron nuclear double resonance studies of the 2Fe2S centers of the 2-halobenzoate 1,2-dioxygenase from Burkholderia (Pseudomonas) cepacia 2CBS.

The 2-halobenzoate 1,2-dioxygenase from Burkholderia (Pseudomonas) cepacia 2CBS (Fetzner, S., Müller, R., and Lingens, F. (1992) J. Bacteriol. 174, 279-290) contains both a ferredoxin-type and a Rieske-type 2Fe2S center. These two significantly different 2Fe2S clusters were characterized with respect to their EPR spectra, electrochemical properties (Rieske-type cluster with gz = 2.025, gy = 1.91, gx = 1.79, gav = 1.91, Em = -125 +/- 10 mV; ferredoxin-type center with gz = 2.05, gy = 1.96, gx = 1.89, gav = 1.97, Em = -200 +/- 10 mV) and pH dependence thereof. X band electron spin echo envelope modulation and electron nuclear double resonance spectroscopy was applied to study the interaction of the Rieske-type center of the 2-halobenzoate 1,2-dioxygenase with 14N and 1H nuclei in the vicinity of the 2Fe2S cluster. The results are compared to those obtained on the Rieske protein of the cytochrome b6f complex (Em = +320 mV) and the water-soluble ferredoxin (Em = -430 mV) of spinach chloroplasts, as typical representatives of the gav = 1.91 and gav = 1.96 class of 2Fe2S centers. Properties common to all Rieske-type clusters and those restricted to the respective centers in bacterial oxygenases are discussed.

Geminate recombination of nitric oxide to endothelial nitric-oxide synthase and mechanistic implications.

The nitric-oxide synthase (NOS) catalyzes the oxidation of L-arginine to L-citrulline and NO through consumption of oxygen bound to the heme. Because NO is produced close to the heme and may bind to it, its subsequent role in a regulatory mechanism should be scrutinized. We therefore examined the kinetics of NO rebinding after photodissociation in the heme pocket of human endothelial NOS by means of time-resolved absorption spectroscopy. We show that geminate recombination of NO indeed occurs and that this process is strongly modulated by L-Arg. This NO rebinding occurs in a multiphasic fashion and spans over 3 orders of magnitude. In both ferric and ferrous states of the heme, a fast nonexponential picosecond geminate rebinding first takes place followed by a slower nanosecond phase. The rates of both phases decreased, whereas their relative amplitudes are changed by the presence of L-Arg; the overall effect is a slow down of NO rebinding. For the isolated oxygenase domain, the picosecond rate is unchanged, but the relative amplitude of the nanosecond binding decreased. We assigned the nanosecond kinetic component to the rebinding of NO that is still located in the protein core but not in the heme pocket. The implications for a mechanism of regulation involving NO binding are discussed.