Effect of carbohydrate position on lysosomal transport of procathepsin L.

To study the role of carbohydrate in lysosomal protein transport, we engineered two novel glycosylation signals (Asn-X-Ser/Thr) into the cDNA of human procathepsin L, a lysosomal acid protease. We constructed six mutant cDNAs encoding glycosylation signals at mutant sites Asn-138, Asn-175, or both sites together, in the presence or absence of the wild-type Asn-204 site. We stably transfected wild-type and mutant cDNAs into NIH3T3 mouse fibroblasts and then used species-specific antibodies to determine the glycosylation status, phosphorylation, localization, and transport kinetics of recombinant human procathepsin L containing one, two, or three glycosylation sites. Both novel glycosylation sites were capable of being glycosylated, although Asn-175 was utilized only 30-50% of the time. Like the wild-type glycosylation at Asn-204, carbohydrates at Asn-138 and Asn-175 were completely sensitive to endoglycosidase H, and they were phosphorylated. Mutant proteins containing two carbohydrates were capable of being delivered to lysosomes, but there was not a consistent relationship between the efficiency of lysosomal delivery and carbohydrate content of the protein. Pulse-chase labeling revealed a unique biosynthetic pattern for proteins carrying the Asn-175 glycosylation sequence. Whereas wild-type procathepsin L and mutants bearing carbohydrate at Asn-138 appeared in lysosomes by about 60 min, proteins with carbohydrate at Asn-175 were processed to a lysosome-like polypeptide within 15 min. Temperature shift, brefeldin A, and NH4Cl experiments suggested that the rapid processing did not occur in the endoplasmic reticulum and that Asn-175 mutants could interact with the mannose 6-phosphate receptor. Taken together, our results are consistent with the interpretation that Asn-175 carbohydrate confers rapid transport to lysosomes. We may have identified a recognition domain in procathepsin L that is important for its interactions with the cellular transport machinery.

Hypermethylation of telomere-like foldbacks at codon 12 of the human c-Ha-ras gene and the trinucleotide repeat of the FMR-1 gene of fragile X.

Runs of G residues on the G-rich strands of 30mers from the region spanning codon 12 of c-Ha-ras appear to be protected against chemical modification by dimethylsulfate. This suggests that the G-rich strand might spontaneously form a Hoogsteen-paired quadruplex, which is characteristic of telomere-like DNA sequences. In this report we show that the predominant species in 1:1 mixtures of complementary 30mers from this region are duplex DNA and a smaller amount of unimolecular foldback formed by the C-rich strand. Foldbacks of this type resemble structures first observed in the C-rich strand of telomeric DNA and also occur at the CCG triplet repeat present in the FMR-1 gene of human fragile X syndrome. Foldbacks from the C-rich strand of c-Ha-ras and the FMR-1 triplet repeat are exceptional substrates for the human methyltransferase in isolation. Substituting inosine for guanosine alters the secondary structure of the folded oligomers and dramatically reduces their ability to serve as substrates for the human methyltransferase, suggesting that secondary structure is required for recognition by the enzyme. These findings suggest that one mechanism by which methyl groups accumulate in the c-Ha-ras region of chromosome 11 during carcinogenesis and at the FMR-1 locus during repeat expansion at fragile X may be structurally induced de novo methylation at sites undergoing local conformational change. Such methylation might serve to mark unusual structures for repair. In the absence of repair, asymmetrically methylated duplexes produced by resolution of the unusual structures would be rapidly converted to symmetrically methylated duplexes through the methyl-directed activity also carried by the human methyltransferase.

MDR1 bicistronic vectors: analysis of selection stringency, amplified gene expression, and vector stability in cell lines.

The human multidrug resistance-1 gene (MDR1) is a dominant selectable and amplifiable marker in mammalian tissue culture cells. MDR1 is also being investigated as a gene therapy tool, both to protect normal cells against chemotherapy-related toxicity and to serve as an in vivo selectable marker for the overexpression of non-selectable therapeutic genes. The success of these strategies will depend on whether MDR1 expression can be sustained at levels high enough to confer a survival advantage on target cells. However, the MDR1 selection system is quite stringent, requiring high gene expression for transduced cells to survive in the presence of drug. The current report is a detailed molecular analysis of MDR1 selection stringency compared with the common neo selectable marker. A bicistronic vector encoding MDR1 and neo genes linked through an internal ribosome entry site was transferred into NIH 3T3 mouse fibroblasts and K562 human leukemia cells; cells were then exposed to colchicine (to select for MDR1 expression) or to G418 (to select for neo expression). Surviving populations and individual clones of cells were analyzed for expression levels of MDR1 and neo gene products; resistance to colchicine, paclitaxel, and G418; level and integrity of bicistronic mRNA; and structural integrity, integration number, and copy number of vector DNA. These studies provide direct evidence that colchicine selection is more stringent than G418 selection; that increased selection pressure with colchicine leads to increased gene expression; that increased gene expression can be accommodated primarily by gene amplification, even within an individual transduced clone and starting from a single-copy proviral integration event; and that the clonal diversity of a transduced population of cells is influenced significantly by the stringency of selection. Taken together, these results have important implications for the potential utility of MDR1 as a selectable marker and as a gene therapy tool in hematopoietic cells.

Recognition of foldback DNA by the human DNA (cytosine-5-)-methyltransferase.

In order to specify the recognition requirements of the human DNA (cytosine-5-)-methyltransferase, two isomeric 48mers were synthesized so as to link a long block of DNA with a shorter complementary block of DNA through a tether consisting of five thymidine residues. These isomeric foldback molecules, differing only in the location of the 5-methyldeoxycytosine, were shown to be unimolecular, to contain a region of duplex DNA, and to contain a region of single-stranded DNA. When used as substrates for the DNA methyltransferase, only one of the isomers was methylated. A comparison of the structures of the two isomers allows us to begin to define the potential sites of interaction between the enzyme and the three nucleotides forming a structural motif consisting of 5-methyldeoxycytosine, its base-paired deoxyguanosine, and a deoxycytosine 5' to the paired deoxyguanosine.

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.