Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Resultados 1 - 20 de 51
Filtrar
1.
Georgian Med News ; (346): 124-127, 2024 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-38501634

RESUMEN

Lumbar degenerative disease usually manifests in spine clinics. This study examines the spino-pelvic characteristics of lumbar degenerative disease patients as well as the clinical ramifications in the Indian population which help in early identification of sagittal spine anomalies. Purpose - to study the spinopelvic parameters and correlate them with disability status in patients with degenerative lumbar diseases. This cross-sectional observational study focused on patients aged 40 to 60, diagnosed with degenerative lumbar spine diseases, seen at the Orthopedics Outpatient Department. Thorough history, clinical examination, and disability assessment were conducted using the modified Oswestery Disability Questionnaire (ODI). Radiological evaluation included measuring spinopelvic parameters-Pelvic Incidence (PI), Pelvic Tilt (PT), Sacral Slope (SS), and Lumbar Lordosis (LL)-correlated with disability. Disability status was determined through the Oswestry Low Back Pain Disability (ODI) Questionnaire. Among the study population, the difference in mean of Pelvic Tilt, Sacral slope, Lumbar lordosis, Pelvic incidence across disability status was not statistically significant. BMI and sacral slope showed positive correlation to sacral slope and negative correlation to Pelvic Tilt, Lumbar Lordosis, ODI. This study concluded there was no association between spinopelvic characteristics and level of disability in degenerative lumbar disease. Early detection of spinopelvic changes can aid in early intervention, slow down disease progression, and lessen impairment brought on by degenerative disc diseases.


Asunto(s)
Lordosis , Humanos , Lordosis/diagnóstico por imagen , Vértebras Lumbares/diagnóstico por imagen , Estudios Transversales , Pelvis/diagnóstico por imagen , Región Lumbosacra/diagnóstico por imagen , Estudios Retrospectivos
2.
Georgian Med News ; (346): 156-159, 2024 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-38501642

RESUMEN

Spinal Tuberculosis ranks as one of the most common extrapulmonary varieties of tuberculosis. The study outlines the Extended Posterior Circumferential Decompression (EPCD) procedure for managing tuberculous spondylitis, a prevalent extrapulmonary form of tuberculosis. EPCD involves 360-degree dural decompression, anterior column debridement, and reconstruction following posterior instrumentation. This technique addresses both the infection and associated complications, particularly beneficial in cases with or without paraplegia. EPCD aims to improve outcomes by effectively tackling the pathology and restoring spinal stability. Purpose - to evaluate the functional and radiological outcome following Extended Posterior Circumferential Decompression in the tuberculosis of dorsal spine. A total of 10 patients were included after fulfilling inclusion criteria between July 2019 to December 2021, all patient underwent Extended Posterior Circumferential Decompression. All patients assessed using Visual analog scale (VAS), Medical Research council (MRC) grading, Frankel grading, Kyphus angle, Erythrocyte sedimentation rate (ESR), X-rays preoperative, immediate postoperative period and 9 month follow up. All patients were available for follow up, in this study mean age was 55.7±17.91. Out of 10 patients 60% were female, 40% was male. VAS, MRC grading, Frankel, ESR values, Kyphus angle showed better results in terms of functional and radiological outcome at 9 month follow up compared to preoperative values. The Employed Posterior Costotransversectomy Decortication (EPCD) technique grants ample ingress to both the lateral and anterior domains of the spinal cord, ensuring an equally efficacious decompression. This approach, characterized by its diminished morbidity, steers clear of the entanglements linked with thoracotomy and laparotomy. Moreover, it fosters prompt mobilization, thereby forestalling the adversities entailed by protracted immobility. With its capability for favorable kyphosis correction, adept surgical decompression, and enhanced functional outcomes, it stands as a beacon of surgical finesse.


Asunto(s)
Columna Vertebral , Tuberculosis de la Columna Vertebral , Humanos , Masculino , Femenino , Adulto , Persona de Mediana Edad , Anciano , Estudios Retrospectivos , Resultado del Tratamiento , Columna Vertebral/cirugía , Tuberculosis de la Columna Vertebral/diagnóstico por imagen , Tuberculosis de la Columna Vertebral/cirugía , Tuberculosis de la Columna Vertebral/complicaciones , Descompresión Quirúrgica/métodos , Vértebras Torácicas/diagnóstico por imagen , Vértebras Torácicas/cirugía
3.
CEN Case Rep ; 2024 Apr 21.
Artículo en Inglés | MEDLINE | ID: mdl-38643434

RESUMEN

A 66-year-old non-smoker presented with a 2-week history of new-onset pedal oedema and gross haematuria. On evaluation, he was found to be hypertensive and oedematous with a haemoglobin of 19.1 g/dl, platelet count of 546,000/mm3, and creatinine of 2.6 mg/dl. Urine examination revealed abundant RBCs with 3+ albumin on three separate occasions. His 24-h urine protein level was 3830 mg/day, with a serum cholesterol level of 303 mg/dl. Secondary erythrocytosis and thrombocytosis tests were negative. Bone marrow examination revealed hypercellularity, erythroid hyperplasia, tight clusters of large megakaryocytes, and megakaryocytic hyperplasia suggestive of polycythemia vera. PCR analysis revealed a JAK2V617 F (exon 14) mutation. In view of nephrotic syndrome, azotemia, and microscopic haematuria, a renal biopsy was performed, which revealed features of IgA nephropathy with advanced interstitial fibrosis and tubular atrophy. He was started on angiotensin receptor blockers with hydroxy urea as a part of treatment. This case report highlights the association of glomerular disease with polycythaemia vera and the need of prompt renal biopsy for diagnosis and management.

4.
J Environ Biol ; 34(3): 529-37, 2013 May.
Artículo en Inglés | MEDLINE | ID: mdl-24617138

RESUMEN

The aim of this study was to assess the open pond and groundwater quality of Tiruchirapalli city of Tamil Nadu, India. The groundwater quality viz., pH, electrical conductivity, total hardness, calcium ion, magnesium ion, chloride, carbonate, bicarbonate, inorganic nitrate, nitrite, phosphate, ammonia and reactive silicate were analysed with respect to various seasons and recorded in the range of 7.1 to 8.1, 97.67 to 533.67 mhos cm(-1), 7.07 to 186 mg l(-1), 4.67 and 112.0 mg l(-1), 2.40 to 92.80 mg l(-1), 15.23 to 661.73 mg l(-1), 60 to 480 mg l(-1), 22.7 to 544.9 mg l(-1), 15.33 to 68.00 mg l(-1), 0.001 to 0.480 mg l(-1), 0.01 to 0.42 mg l(-1), 0.02 to 0.75 mg l(-1) and 1.1 to 2.96 mg l(-1) respectively. The present findings concluded that the quality of ground waters can be considered suitable for human consumption. But the pond water available in and around Tiruchirappalli city was not fit for human usage, agricultural or industrial purposes.


Asunto(s)
Agua Subterránea/química , Estanques , Estaciones del Año , India
5.
Oral Microbiol Immunol ; 24(4): 347-52, 2009 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-19572900

RESUMEN

INTRODUCTION: Endodontic infections are very prevalent and have a polymicrobial etiology characterized by complex interrelationships between endodontic microorganisms and the host defenses. Proteomic analysis of endodontic infections can provide global insights into the invasion, pathogenicity mechanisms, and multifactorial interactions existing between root canal bacteria and the host in the initiation and progression of apical periodontitis. The purpose of this study was to apply proteomic techniques such as liquid chromatography-tandem mass spectrometry (LC-MS/MS) for the identification of proteins of bacterial origin present in endodontic infections. METHODS: Endodontic specimens were aseptically obtained from seven patients with root canal infections. Protein mixtures were subjected to tryptic in-solution digestion and analysed by reverse-phase nano-LC-MS/MS followed by a database search. RESULTS: Proteins, mainly of cell wall or membrane origin, from endodontic bacteria especially Enterococcus faecalis, Enterococcus faecium, Porphyromonas gingivalis, Fusobacterium nucleatum, and Treponema denticola were identified from all the samples tested. Identified proteins included adhesins, autolysins, proteases, virulence factors, and antibiotic-resistance proteins. CONCLUSIONS: LC-MS/MS offers a sensitive analytical platform to study the disease processes in the root canal environment. The array of proteins expressed in endodontic infections reflects the complex microbial presence and highlights the bacterial species involved in the inflammatory process.


Asunto(s)
Bacterias Anaerobias/química , Proteínas Bacterianas/análisis , Enfermedades de la Pulpa Dental/microbiología , Periodontitis Periapical/microbiología , Proteoma/química , Cromatografía Liquida , Cavidad Pulpar/química , Cavidad Pulpar/microbiología , Enterococcus/química , Humanos , Espectrometría de Masas en Tándem , Diente no Vital/microbiología
6.
Plant Dis ; 91(6): 767, 2007 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-30780491

RESUMEN

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5'ACACGG AACACCTGGGTA3' and BGR 5'TCGCTCTCCCGAAGAGAT3') gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5'CGAGCT AATACCGCGAAA3' and BLR 5'AGACTCGA GTCAACTGA3') identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5'AGAGTTTGATCCTGGCTCAG3' and 16SR5'GGCTACCTTGTTACGACTT3') and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

7.
Indian J Gastroenterol ; 25(2): 93-4, 2006.
Artículo en Inglés | MEDLINE | ID: mdl-16763341

RESUMEN

We report a 32-year-old man with acute myeloid leukemia presenting as obstructive jaundice. Imaging revealed dilated common bile duct with abrupt narrowing at the lower end, distended gall bladder, and dilated intrahepatic biliary radicles. In addition he had a mass lesion in the urinary bladder. On evaluation he was found to have the eosinophilic variant of M4 subtype acute myeloid leukemia. He expired before chemotherapy could be instituted.


Asunto(s)
Ictericia Obstructiva/etiología , Adulto , Enfermedades del Conducto Colédoco/complicaciones , Humanos , Leucemia Mieloide Aguda/complicaciones , Masculino
8.
Indian J Gastroenterol ; 25(5): 264-5, 2006.
Artículo en Inglés | MEDLINE | ID: mdl-17090854

RESUMEN

A 45-year-old-man presented with severe vomiting, constipation, abdominal distention and bilateral ocular abductor palsy. Evaluation revealed diffuse autonomic dysfunction characterized by intestinal pseudo-obstruction, xerophthalmia, xerostomia, postural hypotension, erectile dysfunction and loss of sinus arrhythmia. Paraneoplastic work-up revealed thymoma. Most symptoms resolved after surgical removal of the thymoma. Six weeks later he developed worsening of external ophthalmoparesis with ptosis, responding to acetylcholinesterase inhibitor, confirming myasthenia gravis.


Asunto(s)
Seudoobstrucción Intestinal/etiología , Miastenia Gravis/complicaciones , Timoma/complicaciones , Neoplasias del Timo/complicaciones , Inhibidores de la Colinesterasa/uso terapéutico , Humanos , Seudoobstrucción Intestinal/diagnóstico , Seudoobstrucción Intestinal/terapia , Masculino , Persona de Mediana Edad , Miastenia Gravis/diagnóstico , Miastenia Gravis/tratamiento farmacológico , Bromuro de Piridostigmina/uso terapéutico , Timectomía , Timoma/diagnóstico , Timoma/cirugía , Neoplasias del Timo/diagnóstico , Neoplasias del Timo/cirugía , Resultado del Tratamiento
9.
Indian J Gastroenterol ; 24(4): 174-5, 2005.
Artículo en Inglés | MEDLINE | ID: mdl-16204913

RESUMEN

There are few reports of skeletal infections in patients with cirrhosis. We present two such cases, both with alcoholic liver disease, seen over a period of one year. The first, a 46-year-old man, presented as pyrexia of unknown origin, and was found to have pyogenic discitis; he responded to antibiotic and surgery. The second, a 42-year-old man, presented with chest wall abscess and was diagnosed to have tubercular osteomyelitis; he expired despite treatment with non-hepatotoxic anti-tubercular drugs.


Asunto(s)
Discitis/etiología , Cirrosis Hepática/complicaciones , Osteomielitis/etiología , Tuberculosis Osteoarticular/etiología , Adulto , Discitis/terapia , Resultado Fatal , Humanos , Cirrosis Hepática Alcohólica/complicaciones , Masculino , Persona de Mediana Edad
10.
Neuropsychopharmacology ; 29(8): 1432-9, 2004 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-15114341

RESUMEN

Cyclic AMP-specific phosphodiesterase 4 (PDE4), which is an integral component of NMDA receptor-mediated cAMP signaling, is involved in the mediation of memory processes. Given that NMDA receptors also mediate MEK/mitogen-activated protein kinase (MAPK, ERK) signaling, which is involved in synaptic plasticity, and that some PDE4 subtypes are phosphorylated and regulated by ERK, it was of interest to determine if PDE4 is involved in MEK/ERK signaling-mediated memory. It was found that rolipram, a PDE4-selective inhibitor, reversed the amnesic effect in the radial-arm maze test of the MEK inhibitor U0126 administered into the CA1 subregion of the rat hippocampus. Consistent with this, rolipram, either by peripheral administration or direct intra-CA1 infusion, enhanced the retrieval of long-term memory impaired by intra-CA1 infusion of U0126 using the step-through inhibitory avoidance test. The same dose of rolipram did not affect U0126-induced reduction of phospho-ERK1/2 levels in the CA1 subregion. However, in primary cultures of rat cerebral cortical neurons, pretreatment with U0126 increased PDE4 activity; this was correlated with the U0126-induced reduction of phospho-ERK1/2 levels. These results suggest that MEK/ERK signaling plays an inhibitory role in regulating PDE4 activity in the brain; this may be a novel mechanism by which MEK/ERK signaling mediates memory. PDE4 is likely to be an important link between the cAMP/PKA and MEK/ERK signaling pathways in the mediation of memory.


Asunto(s)
3',5'-AMP Cíclico Fosfodiesterasas/antagonistas & inhibidores , Butadienos/antagonistas & inhibidores , Butadienos/farmacología , Inhibidores Enzimáticos/farmacología , Trastornos de la Memoria/inducido químicamente , Trastornos de la Memoria/tratamiento farmacológico , Proteínas Quinasas Activadas por Mitógenos/antagonistas & inhibidores , Nitrilos/antagonistas & inhibidores , Nitrilos/farmacología , Inhibidores de Fosfodiesterasa/uso terapéutico , Animales , Reacción de Prevención/efectos de los fármacos , Western Blotting , Células Cultivadas , Corteza Cerebral/citología , Corteza Cerebral/efectos de los fármacos , Fosfodiesterasas de Nucleótidos Cíclicos Tipo 4 , Relación Dosis-Respuesta a Droga , Hipocampo , Masculino , Aprendizaje por Laberinto/efectos de los fármacos , Microinyecciones , Quinasas de Proteína Quinasa Activadas por Mitógenos/antagonistas & inhibidores , Quinasas de Proteína Quinasa Activadas por Mitógenos/metabolismo , Neuronas/efectos de los fármacos , Neuronas/enzimología , Ratas , Ratas Sprague-Dawley , Rolipram/farmacología , Transducción de Señal/efectos de los fármacos
11.
Biosens Bioelectron ; 15(5-6): 241-7, 2000 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-11219735

RESUMEN

A monoclonal-antibody-based, sequential competitive-flow-injection immunoassay system in expanded-bed mode has been developed for the determination of nisin. The system allows the determination of nisin in the presence of suspended particles without any significant interference, illustrating its potential for on-line monitoring of fermentation processes or the analysis of food matrices. The dose response range of the system when operated in expanded-bed mode was 6-90 microM. The detection limit under packed-bed conditions was 3 microM. The results correlated well with the results from conventional ELISA in the analysis of samples of processed cheese. When milk samples, fermentation samples and buffer were spiked with nisin, the mean recoveries were 86% for milk samples, 96% for fermentation samples and 98% for buffer solution.


Asunto(s)
Técnicas Biosensibles , Ensayo de Inmunoadsorción Enzimática/métodos , Análisis de Inyección de Flujo/métodos , Nisina/análisis , Animales , Anticuerpos Monoclonales , Biotecnología , Queso/análisis , Fermentación , Conservantes de Alimentos/análisis , Leche/química , Nisina/inmunología
12.
Biosens Bioelectron ; 14(8-9): 723-7, 1999 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-10641291

RESUMEN

A microbial biosensor based on immobilised psychrotrophic yeast Yarrowia lipolytica integrated to FIA for the determination of middle chain alkanes was developed. The system responded very well to middle chain alkanes even at low operational temperatures down to +5 degrees C. The maximum sensitivity was obtained at 15 degrees C. A linear relationship was observed between the sensor response and dodecane concentration up to 100 microM.


Asunto(s)
Alcanos/análisis , Técnicas Biosensibles/métodos , Saccharomycetales , Alcanos/metabolismo , Técnicas Biosensibles/instrumentación , Técnicas Biosensibles/estadística & datos numéricos , Contaminantes Ambientales/análisis , Contaminantes Ambientales/metabolismo , Estudios de Evaluación como Asunto , Petróleo/análisis , Petróleo/metabolismo , Saccharomycetales/crecimiento & desarrollo , Saccharomycetales/metabolismo , Sensibilidad y Especificidad , Temperatura
13.
J Biotechnol ; 83(3): 211-7, 2000 Oct 13.
Artículo en Inglés | MEDLINE | ID: mdl-11051418

RESUMEN

A procedure for the enhanced lysis of mucous producing psychrotrophic gram positive bacteria for subsequent enzyme studies is described. An initial washing of bacterial cells with Tween 80 was found to improve the degree of cell disruption in subsequent sonication or grinding with glass beads, resulting in about 20-200% increase in total soluble protein content. However, in terms of lactate dehydrogenase (LDH) activity present in the lysate, pretreatment with Tween 80 was more effective in combination with grinding, especially in the highly mucous producing strain GY11. The type of surfactant used in the pretreatment procedure before grinding strongly influenced the percentage lysis of tested strains, both in terms of released soluble protein and enzyme activity. Zymograms of LDH and glutamate dehydrogenase (GDH) activity present in the lysates also very well supported the results obtained by total protein and enzyme activity measurements.


Asunto(s)
Cápsulas Bacterianas/metabolismo , Bacteriólisis , Frío , Bacterias Grampositivas/fisiología , Sonicación , Tensoactivos/farmacología , Adaptación Fisiológica , Proteínas Bacterianas/química , Técnicas Bacteriológicas , Bacterias Grampositivas/química
14.
Am J Med Sci ; 314(3): 207-12, 1997 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-9298048

RESUMEN

Isolated native nonrheumatic tricuspid valve endocarditis rarely is described in the absence of intravenous drug use, intracardiac catheters, or cardiac anomalies. We diagnosed tricuspid valve endocarditis in two elderly nonaddicted patients with recurrent pulmonary infiltrates, anemia, and microscopic hematuria that occurred during several months and was caused by Gemella morbillorum and Candida glabrata, respectively. We have reviewed 27 other cases of nonaddicted patients with tricuspid valve endocarditis from the literature and discussed etiology, clinical characteristics, and outcome. Mean age was 53.5 years (range, 22 to 74 years old), and 72% had underlying medical conditions. Staphylococcus oureus, Streptococcus bovis, and candida species were the causative organisms in 70% of the cases. Average duration of infection before diagnosis was 9.3 months. We conclude that isolated tricuspid valve endocarditis in nonaddicted patients occurs mainly in the middle-aged and older persons, mimicking chronic illness and community-acquired pneumonia. In the absence of a history of intravenous drug use, diagnostic delays are common. We suggest that right-sided endocarditis must be considered in any patient with the "Tricuspid Syndrome," consisting of recurrent pulmonary events, anemia, and microscopic hematuria. Careful evaluation of prior medical records and clinical course can be very helpful. Echocardiography and serial blood cultures provide the key to diagnosis.


Asunto(s)
Endocarditis/diagnóstico , Enfermedades de las Válvulas Cardíacas/diagnóstico , Válvula Tricúspide/patología , Anciano , Sangre/microbiología , Candidiasis/diagnóstico , Electrocardiografía , Endocarditis/complicaciones , Endocarditis Bacteriana/diagnóstico , Enfermedades de las Válvulas Cardíacas/complicaciones , Humanos , Hepatopatías Alcohólicas/complicaciones , Masculino , Persona de Mediana Edad , Infecciones Estreptocócicas/diagnóstico
15.
Indian J Gastroenterol ; 22(6): 221-3, 2003.
Artículo en Inglés | MEDLINE | ID: mdl-15030034

RESUMEN

BACKGROUND: Helicobacter pylori infection has been implicated in the development of encephalopathy in chronic liver disease (CLD); this is possibly due to increased production of ammonia by the action of bacterial urease on urea in the gastric lumen. AIM: To evaluate whether H. pylori eradication in patients with CLD affects arterial ammonia levels. METHODS: Forty-six patients with CLD (40 alcoholic, 6 post hepatitis B; Child's class A 7, B 17, C 22) and 36 patients with symptoms of acid-peptic disease (APD) underwent gastrointestinal endoscopy and biopsy; gastric biopsies were evaluated for H. pylori status using rapid urease test and histology. H. pylori-positive subjects received quadruple-drug eradication therapy for 2 weeks. Fasting arterial plasma ammonia levels were estimated before and after eradication of H. pylori. RESULTS: H. pylori infection was present in 21 of 46 (45.7%) patients with CLD and 23 of 36 (63.9%) with APD. At baseline, mean (SD) ammonia levels were higher in the CLD group (97.4 [10.9] versus 81.3 [7.7] mcg/dL in the APD group; p = 0.0001), irrespective of H. pylori status. Amongst patients with liver disease, arterial ammonia levels were similar in the H. pylori-positive and -negative patients (94.1 [9.7] and 100.2 [11.3] mcg/dL, respectively); however, ammonia levels were higher in patients in Child's class C (102.7 [11.4] mcg/dL/dL) than in those in class A (88.4 [1.6] mcg/dL; p < 0.002) or B (94.1 [9.7] mcg/dL; p < 0.002). In patients with APD, ammonia levels were higher in H. pylori-positive patients (85.3 [6.4] versus 74.1 [3.3] mcg/dL; p < 0.001). After eradication of H. pylori infection, ammonia levels decreased to 88.4 (10.0) mcg/dL in CLD and 76.7 (4.8) mcg/dL in APD (p = 0.001 as compared to baseline). There was no difference in post-eradication ammonia levels between Child's classes. CONCLUSION: Levels of arterial blood ammonia are higher in CLD than in APD, and correlate with severity of liver disease. H. pylori eradication was associated with reduction in arterial ammonia levels in patients with CLD.


Asunto(s)
Infecciones por Helicobacter/sangre , Infecciones por Helicobacter/tratamiento farmacológico , Helicobacter pylori/aislamiento & purificación , Hiperamonemia/etiología , Hepatopatías/sangre , Análisis de Varianza , Enfermedad Crónica , Quimioterapia Combinada , Femenino , Infecciones por Helicobacter/microbiología , Humanos , Hepatopatías/microbiología , Masculino , Persona de Mediana Edad
16.
Folia Microbiol (Praha) ; 47(2): 121-9, 2002.
Artículo en Inglés | MEDLINE | ID: mdl-12058389

RESUMEN

Pseudomonas fluorescens (two native strains, one collection strain and their strain mixtures in all possible combinations) when applied through seed, seedling dip, soil and on leaf significantly reduced the tomato spotted wilt virus (TSWV) disease. In P. fluorescens-treated plants, the peroxidase and phenylalanine ammonia-lyase activity increased. Accumulation of phenolic compounds and lignin were shown to be increased in the P. fluorescens-treated plants. Isoperoxidase native PAGE indicated that the peroxidase isoforms in tomato plants induced by fluorescent pseudomonads were different from the control plants; this suggests that the general phenylpropanoid pathway is probably stimulated in tomato plants treated which in turn led to significant reduction in TSWV.


Asunto(s)
Peroxidasas/metabolismo , Virus de Plantas/fisiología , Pseudomonas fluorescens/fisiología , Solanum lycopersicum/microbiología , Solanum lycopersicum/virología , Electroforesis en Gel de Poliacrilamida , Lignina/metabolismo , Solanum lycopersicum/metabolismo , Fenoles/metabolismo , Enfermedades de las Plantas/microbiología , Enfermedades de las Plantas/virología , Virus de Plantas/patogenicidad , Pseudomonas fluorescens/enzimología , Pseudomonas fluorescens/metabolismo , Virus ARN/fisiología
17.
Indian J Otolaryngol Head Neck Surg ; 66(Suppl 1): 359-63, 2014 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-24533417

RESUMEN

To demonstrate the role of oral acyclovir in monthly regimes after microdebrider assisted excision in 3 patients with adult recurrent respiratory papillomatosis (ARRP). Three patients with ARRP who presented to a tertiary referral hospital in stridor were initially treated with a tracheostomy in order to secure airway. On further evaluation by videolaryngoscopy extensive bilateral laryngeal papillomatosis was noted with history of similar conditions in the past for which they were repeatedly operated. They were admitted and underwent Microlaryngeal surgery and laryngeal microdebrider assisted surgery under general anesthesia. Post operatively a course of oral acyclovir at 800 mg/5 times/day for 5 days was administered. On repeat assessment with videolaryngoscopy at monthly intervals a complete remission of the disease was noted with no residual disease at the end of 1 year in 2 cases. One case had a recurrence. Renal parameters were monitored periodically. It may be concluded that the action of anti viral drugs at regular intervals in addition to a short course of oral steroids lead to rapid recovery and prevented latent virus activation within the laryngo tracheal system hence maintaining long term improvement. This can avoid multiple laryngeal surgeries, repeated respiratory emergencies and risk for malignant transformation in the future thereby reducing morbidity and effect on quality of life.

18.
JBJS Case Connect ; 4(4): e114, 2014.
Artículo en Inglés | MEDLINE | ID: mdl-29252782

RESUMEN

CASE: A thirty-two-year-old man presented with an open type-IIIA Müller type-C2 supracondylar fracture of the femur and an ipsilateral segmental fracture of the tibia. An external fixator was used for initial stabilization. After ten days, the fractured femur was stabilized with a retrograde intramedullary nail along with an autogenous split fibular graft placed on either side of the nail; intramedullary nail fixation of the tibia was also performed. At the two-year follow-up, both fractures had united. CONCLUSION: An autogenous split fibular graft in conjunction with an intramedullary nail is a viable option to manage bone defects in complicated supracondylar fractures of the femur.

20.
J Laryngol Otol ; 125(9): 958-61, 2011 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-21729445

RESUMEN

BACKGROUND AND OBJECTIVES: The incidence of acquired laryngeal stenosis is increasing. This retrospective study aimed to assess the long term results of circumferential resection with end-to-end tracheal anastomosis for isolated post-intubation stenosis of the cervical trachea, and to review the relevant literature. METHODS: Twelve male and two female patients (aged 16-30 years, mean age 24 years) treated between February 2003 and December 2008 were included. Hospital and office records were reviewed and relevant surgical details recorded. RESULTS: Indications for tracheal resection anastomosis were post-intubation stenosis (78.57 per cent) and trauma (21.42 per cent). One to five tracheal rings were resected (i.e. 1-2.5 cm of cervical trachea). Tracheal anastomosis was considered successful if the patient remained asymptomatic for 24 months of close follow up (involving regular flexible bronchoscopy and neck X-ray). The anastomotic success rate was 92.85 per cent. CONCLUSION: Tracheal resection and end-to-end anastomosis is relatively safe and reliable for definitive treatment of benign tracheal stenosis in appropriate patients. Local application of mitomycin C prevents granulation and aids long term airway patency.


Asunto(s)
Anastomosis Quirúrgica/métodos , Intubación Intratraqueal/efectos adversos , Estenosis Traqueal/cirugía , Adolescente , Adulto , Anastomosis Quirúrgica/estadística & datos numéricos , Antibióticos Antineoplásicos/uso terapéutico , Femenino , Tejido de Granulación , Humanos , Laringoestenosis/epidemiología , Laringoestenosis/cirugía , Masculino , Mitomicina/uso terapéutico , Estudios Retrospectivos , Técnicas de Sutura , Estenosis Traqueal/epidemiología , Resultado del Tratamiento , Cicatrización de Heridas/fisiología , Adulto Joven
SELECCIÓN DE REFERENCIAS
Detalles de la búsqueda