RESUMEN
Myotonic dystrophy (DM) is a highly variable, multisystemic disorder that clinically affects one in 8000 individuals. While research has predominantly focused on the symptoms and pathological mechanisms affecting striated muscle and brain, DM patient surveys have identified a high prevalence for gastrointestinal (GI) symptoms amongst affected individuals. Clinical studies have identified chronic and progressive dysfunction of the esophagus, stomach, liver and gallbladder, small and large intestine, and rectum and anal sphincters. Despite the high incidence of GI dysmotility in DM, little is known regarding the pathological mechanisms leading to GI dysfunction. In this review, we summarize results from clinical and molecular analyses of GI dysfunction in both genetic forms of DM, DM type 1 (DM1) and DM type 2 (DM2). Based on current knowledge of DM primary pathological mechanisms in other affected tissues and GI tissue studies, we suggest that misregulation of alternative splicing in smooth muscle resulting from the dysregulation of RNA binding proteins muscleblind-like and CUGBP-elav-like is likely to contribute to GI dysfunction in DM. We propose that a combinatorial approach using clinical and molecular analysis of DM GI tissues and model organisms that recapitulate DM GI manifestations will provide important insight into defects impacting DM GI motility.
Asunto(s)
Distrofia Miotónica , Humanos , Distrofia Miotónica/complicaciones , Distrofia Miotónica/genética , Empalme Alternativo , Músculo Esquelético/metabolismo , Proteínas de Unión al ARN/metabolismoRESUMEN
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.
Asunto(s)
Epilepsia/veterinaria , Enfermedades de los Caballos/genética , Caballos/genética , Ribonucleasa P/genética , Ubiquitina-Proteína Ligasas/genética , Animales , Egipto , Electroencefalografía , Epilepsia/diagnóstico , Epilepsia/genética , Genotipo , Convulsiones/genética , Convulsiones/veterinaria , Eliminación de SecuenciaRESUMEN
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses.